Freshwater mucor and application thereof

By screening and applying the JSAFC 2076 spore suspension of freshwater mucor (Mucor fluvii) JSAFC 2076 spraying on American white moth larvae, the problem of lack of efficient green control of American white moth in the existing technology was solved, and a high mortality rate and environmentally friendly control effect was achieved.

CN120484971APending Publication Date: 2025-08-15JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510625087.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-15
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The existing technology lacks efficient and green biological control methods to prevent and control American white moths, especially mucor fungi. There is little research on the application of this field.

Method used

A freshwater mucor fluvii strain JSAFC 2076 was screened and provided, and prepared into spore suspensions and sprayed on American white moth larvae to prevent and treat American white moth by the pathogenicity of this strain.

Benefits of technology

Freshwater mucor JSAFC 2076 has a high lethality rate for American white moth larvae, and is environmentally friendly and non-toxic, which significantly inhibits its survival and provides an effective way for the green prevention and control of American white moth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120484971A_ABST
    Figure CN120484971A_ABST
Patent Text Reader

Abstract

The invention discloses a freshwater mucor and application thereof, the strain number of the freshwater mucor is JSAFC 2076, the freshwater mucor is preserved in China General Microbiological Culture Collection Center (CGMCC) on September 23, 2024, and the preservation number is CGMCC No.41523. The invention further discloses a preparation method of the freshwater mucor. The strain provided by the invention is a biocontrol fungus which can be used for preventing and treating major insect hyphantria cunea, has the characteristics of strong pathogenicity to hyphantria cunea larvae, safety to the environment and difficulty in causing drug resistance of insects, and can be applied to biological prevention and treatment of hyphantria cunea.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to freshwater mucor and application thereof. Background Art

[0002] The gypsy moth, Hyphantria cunea, belongs to the order Lepidoptera, family Arctiidae, genus Hyphantria. It is native to North America and primarily distributed in the southern United States and Canada. First discovered in Canada in 1922, it spread to Europe and Asia by the late 1940s through human activities and vehicles, becoming a global plant quarantine pest that severely damages trees. The gypsy moth has diverse host plants, a high reproductive potential, strong adaptability, a wide range of transmission pathways, severe direct damage, and widespread nuisance to residents. It can harm over 100 species of trees, fruit trees, and flowers. After devouring all the leaves, it can also attack a variety of nearby crops and vegetables. Currently, the integrated control technology system for the gypsy moth is still incomplete, with chemical control primarily employed. New sustainable biological control technologies are less widely adopted, hindering my country's efforts to reduce pesticide use and control pests.

[0003] Biological control offers numerous advantages, including being harmless, pollution-free, low-cost, and highly effective. It demonstrates enormous potential and is a highly scientific and effective method for pest control in modern agricultural and forestry production. Microorganisms, as an effective green pest control method, are playing an increasingly important role. In the current context of green and healthy ecological development, the use of biological agents, including biogenic growth regulators, fungicides (insecticides), and hormone-based fungicides (insecticides), is encouraged.

[0004] Numerous biopesticides and bioagents have been developed both domestically and internationally. Microbial pesticides primarily focus on bacteria, actinomycetes, and Streptomyces. Insecticidal fungi such as Metarhizium and Beauveria are also gaining popularity. Mucor is a resource fungus commonly used in industrial fermentation, but its application in biocontrol is relatively understudied, particularly in the control of the gypsy moth. Therefore, the discovery and selection of highly targeted and virulent strains is a crucial step in the application of fungal biocontrol.

[0005] In summary, the existing technology still lacks a green and efficient probiotic for controlling the gypsy moth. Screening high-microbial resources can provide an effective way to achieve efficient, green and sustainable control of the gypsy moth. Summary of the Invention

[0006] Purpose of the invention: The purpose of the present invention is to provide a freshwater Mucor (Mucorfluvii) and its application in controlling the American white moth.

[0007] Technical solution: The present invention provides a freshwater Mucor (Mucorfluvii), the strain number of the freshwater Mucor (Mucorfluvii) is JSAFC 2076, which was deposited in the General Microbiology Center of the China Culture Collection Administration on September 23, 2024, with a deposit number of CGMCC No.41523.

[0008] Furthermore, the nucleotide sequence of the ITS gene of the freshwater Mucor is shown as SEQ ID NO.1.

[0009] The present invention also provides a biocontrol fungus agent, the active ingredient of which is the above-mentioned freshwater Mucor (Mucorfluvii) or a spore suspension thereof.

[0010] The present invention also provides the use of the freshwater Mucor (Mucorfluvii) and biocontrol fungi and agents in preventing and controlling the gypsy moth.

[0011] Furthermore, the application is specifically by spraying the spore suspension of Mucorfluvii JSAFC 2076 on the larvae of the white moth.

[0012] Furthermore, the spore suspension is prepared by: (1) taking the biocontrol fungus freshwater mucor JSAFC 2076, picking up mycelium with an inoculation needle under sterile conditions, inoculating it into a sterilized PDA culture medium, and culturing it for 5-7 days; (2) scraping the mycelium under sterile conditions, washing the mycelium with sterile water, and filtering it with gauze.

[0013] Furthermore, the culture conditions in step (1) are 25° C., 75% humidity, and dark culture.

[0014] Furthermore, the concentration of the spore suspension is 10 8 / ml.

[0015] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: A freshwater Mucor (Mucorfluvii) strain was isolated and purified from soil in Wenzhou, Zhejiang Province. This strain can be used as a biocontrol agent against the gypsy moth, exhibiting a high lethality rate and being environmentally friendly and non-toxic. It can significantly inhibit the survival activity of the gypsy moth, and is of great significance for the future development of biocontrol agents for the gypsy moth. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Colony morphology of Mucorfluvii JSAFC 2076.

[0017] Figure 2 : Phylogenetic tree of Mucorfluvii JSAFC 2076.

[0018] Figure 3 : Effects of Mucorfluvii JSAFC 2076 on the growth of larvae of the gypsy moth. DETAILED DESCRIPTION

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0020] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and identification of Mucorfluvii JSAFC 2076

[0022] 1. Isolation of Mucorfluvii JSAFC 2076

[0023] JSAFC 2076 was isolated from soil in Wenzhou, Zhejiang Province. The bacterial colony characteristics are as follows: when cultured on PDA plate medium, the bacterial colony grows rapidly in a radial shape, and its surface color is white.

[0024] 2. Molecular Biological Identification of Mucorfluvii JSAFC 2076

[0025] (1) The genomic DNA of strain JSAFC 2076 was extracted using a kit from TIANGEN.

[0026] (2) Amplification of the ITS gene from genomic DNA. DNA amplification was performed in a 30 μL reaction volume, containing 15 μL 2× EasyTaq PCR SuperMix (+ dye), 1 μL each of the primer pairs ITS1 (SEQ ID NO. 2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') and ITS4 (SEQ ID NO. 3: 5'-TCCTCCGCTTATTGATATGC-3') (10 μM), 2 μL template DNA, and 11 μL ddH2O. The PCR amplification program conditions were as follows: 94°C denaturation for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 45 s, and extension at 72°C for 60 s; and a final extension at 72°C for 10 min.

[0027] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the ITS gene sequence of strain JSAFC 2076 was SEQ ID NO. 1 (GGTAACTACGAGGTCTTAATAATTTGATAATTAC ACAATTATCTAATTTACTGTGAACTGTTTTAATTATGACGCATAAGGGGATGACTATATACCATAGGGTAGGTATATAGAATGTTAACCTAGTCATAGTCAAGCTTGATGCTTGGTACCCATTATTATTTACCAAAAGAATTCAGATTAAATAATGTAACATAGATCTAAACAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCAT ATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCACTCATTGGTATTCCAATGAGTACGCCTGTTTCAGTATCAAAAACAACCCTTATTCAAACATTTTGTTGGAATAGACTTGAGCGTAGTAAGTTT AACTTGAGACGCTTTAAATTCAGTAAGGCCTGATATTGTTTCACTGCCTATATTTTTTTTTAATTTAAGAAAGATAGAAGCGATTGAAGCTGTGGTTAAGGCCTCCCAAAATAATTTTTTAAATTTGATCT).

[0028] (4) Compare the SEQ ID NO.1 sequence on the NCBI database website and build a phylogenetic tree. Figure 2 The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 2076 of the present invention is freshwater Mucor (Mucorfluvii), named Mucorfluvii JSAFC 2076, and the strain was deposited in the General Microbiology Center of the China Culture Collection of Microorganisms on September 23, 2024, with a deposit number of CGMCC No.41523, and classified as Mucorfluvii JSAFC 2076. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Courtyard, Chaoyang District, Beijing.

[0029] Table 1 Sequence alignment results of SEQ ID NO.1

[0030]

[0031] Example 2: Determination of the pathogenicity of Mucorfluvii JSAFC 2076 to nymphalid larvae

[0032] 1. Preparation of spore suspension

[0033] (1) A 5 mm diameter mycelium block of the strain Mucorfluvii JSAFC 2076 was taken using a borer and inoculated into a 9 cm diameter culture dish (containing 15 ml of PDA medium) and cultured in the dark at 25°C and 75% humidity for 5-7 days.

[0034] (2) Under sterile conditions, the mycelia of Mucorfluvii JSAFC 2076 cultured for 5-7 days were scraped, washed with sterile water and filtered with gauze, and then the spore concentration was adjusted to 10 8 / mL.

[0035] 2. Test insect inoculation

[0036] (1) 2nd-3rd instar larvae of the cuneiform moth were purchased from the Institute of Forest Ecology, Environment and Protection, Chinese Academy of Forestry. If the larvae were less than 3rd instar, they were reared in an artificial climate chamber (temperature 25°C, humidity 60-70%, light-dark ratio 14:10) and provided with surface-sterilized mulberry leaves daily. When the larvae reached 3rd instar, they were used for bioassays.

[0037] (2) Determination of the insecticidal activity of JSAFC 2076 against the gypsy moth: 10 mL of spore suspension was placed in a petri dish. During inoculation, the test insects were immersed in the spore suspension for 30 seconds and then removed. The inoculated insects were transferred to a transparent plastic box and placed in an artificial climate chamber (temperature 25°C, humidity 60-70%, light-dark ratio 14:10). They were fed with sterilized mulberry leaves. The leaves were changed daily and the mortality of the larvae was observed and recorded. Starting from the second day, the observation was made once a day for a total of 7 days. Each group had 30 test insect larvae, and the experiment was repeated 3 times. Sterile water treatment was used as a negative control.

[0038] The experimental results are shown in Table 2.

[0039] Table 2 Mortality of nymphalid moth larvae after inoculation with JSAFC 2076 (%)

[0040]

[0041] From the data in Table 2, it can be seen that the mortality rate of the larvae of the gypsy moth in the treatment group is significantly higher than that in the control group, indicating that the strain JSAFC 2076 of the present invention has a good lethal effect on the gypsy moth. 8The mortality rate of the JSAFC 2076 spore suspension at 100% / mL on the gypsy moth was 100% after 7 days, indicating that JSAFC 2076 has a control effect on the larvae of the gypsy moth.

[0042] In summary, the JSAFC 2076 provided by the present invention is a biocontrol fungus that can be used to control the larvae of the cuneiform moth, which will provide a basis for the green control of the cuneiform moth and has great development and application potential.

Claims

1. A freshwater Mucor (Mucorfluvii), characterized in that The strain number of the freshwater Mucor (Mucorfluvii) is JSAFC 2076, which was deposited in the General Microbiology Center of the China Culture Collection Administration on September 23, 2024, with the deposit number CGMCC No.41523.

2. The freshwater Mucor (Mucorfluvii) according to claim 1, characterized in that The nucleotide sequence of the ITS gene of the freshwater Mucor is shown in SEQ ID NO.

1.

3. A biocontrol agent, characterized in that: The active ingredient of the biocontrol agent is the freshwater Mucor (Mucorfluvii) or its spore suspension according to any one of claims 1 to 2.

4. Use of the freshwater Mucor (Mucorfluvii) according to any one of claims 1 to 2 and the biocontrol fungus agent according to claim 3 in controlling the gypsy moth.

5. The use according to claim 4, characterized in that The application is specifically to spray the spore suspension of freshwater Mucor fluvii JSAFC 2076 according to any one of claims 1 to 2 on the larvae of the white moth.

6. The use according to claim 5, characterized in that The preparation method of the spore suspension is as follows: (1) taking the biocontrol fungus freshwater mucor JSAFC 2076, picking up mycelia with an inoculation needle under sterile conditions, inoculating the mycelia into a sterilized PDA culture medium, and culturing for 5-7 days; (2) scraping the mycelia under sterile conditions, washing the mycelia with sterile water, and filtering with gauze.

7. The use according to claim 6, characterized in that The culture conditions in step (1) are 25° C., 75% humidity, and dark culture.

8. The use according to claim 5, characterized in that The concentration of the spore suspension is 10 8 / mL.

Citation Information

Cited By

  • Mucor circinelloides, identification method, microbial insecticide and application

    CN121203843A