Nucleic acid aptamer specifically combined with CD72 protein
The SELEX technology screens and synthesizes nucleic acid aptamers that specifically bind to the CD72 protein, which solves the problem of lacking high affinity and specific nucleic acid aptamers in the prior art, and achieves high sensitivity and specific detection and treatment of CD72 protein.
Patent Information
- Application Number
- CN202510320742.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-18
- Publication Date
- 2025-08-15
AI Technical Summary
The prior art lacks nucleic acid aptamers that can be highly affinity, good specificity, easy to modify and artificially synthesized, and methods for detecting and treating CD72 proteins.
Nucleic acid aptamers specifically binding to CD72 protein were screened and synthesized by SELEX technology, and screened by magnetic bead method and blocked in a high-concentration serum environment to obtain nucleic acid aptamers with high affinity and specificity, including modifications and conjugates, to form stable nucleic acid aptamers derivatives.
The detection of CD72 protein with high sensitivity and specificity is achieved, and it is used for purification, imaging and treatment, with a wide range of application prospects.
Smart Images

Figure BDA0005317346850000031 
Figure BDA0005317346850000061 
Figure HDA0005317346860000011
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of targeted drugs, and in particular relates to a nucleic acid aptamer that specifically binds to CD72 protein. Background Art
[0002] CD72 (Lyb-2) is a type II membrane glycoprotein encoded by the CD72 gene and is mainly expressed in B cells. CD72 acts as a co-receptor in the B cell receptor complex. Studies have shown that it binds to CD5 expressed on the surface of T cells and regulates B cell activation. CD72 is a member of the C-type lectin superfamily and is expressed on the surface of all B cell stages from pro-B to mature B cell stages. It carries an immunoreceptor tyrosine-based inhibitory motif (ITIM), which has been shown to recruit tyrosine phosphatase SHP-1 and negatively regulate cell activity. So far, it has been verified as a target for a variety of diseases such as tumors, hairy leukocytes, and autoimmune diseases.
[0003] CD72 belongs to the C-type lectin superfamily and is expressed on the surface of B cell precursors through the mature B cell stage. It is reported to bind to CD5 expressed on the surface of T cells and regulate B cell activation. CD72 is known to play an important role in various B cell processes, including proliferation, apoptosis, and differentiation. Currently, CD72 is an important potential target for many diseases. Recent studies have shown that serum sCD72 levels in SLE patients are increased compared with rheumatoid arthritis patients (as disease controls) and healthy individuals. It is of great significance to achieve qualitative and quantitative detection and purification of CD72, and thus develop reagents or drugs for the diagnosis and treatment of abnormal CD72 expression.
[0004] Aptamers are DNA or RNA molecules isolated and screened through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process. Aptamers can bind with high affinity and specificity to other targets such as proteins, metal ions, small molecules, peptides, and even entire cells. Therefore, they hold great promise in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared to antibodies, aptamers have advantages such as smaller molecular weight, improved stability, ease of modification, lack of immunogenicity, and a shorter production cycle. They can be synthesized artificially, eliminating the need for animal immunization, animal husbandry, protein extraction, and purification. Therefore, if aptamers with higher affinity and specificity for the CD72 protein can be found, it will facilitate the highly sensitive and specific detection of the CD72 protein and aid in the development of drugs targeting the CD72 protein.
[0005] There is an urgent need to find a nucleic acid aptamer that has high binding affinity and good specificity for CD72 protein, is easy to modify and synthesize, has good stability, and is easy to use. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a nucleic acid aptamer that specifically binds to the CD72 protein. The nucleic acid aptamer can bind to a cell line that highly expresses the CD72 protein and can be used for detection, diagnosis, imaging, and treatment, and has broad application prospects.
[0007] The present invention provides a nucleic acid aptamer that specifically binds to the CD72 protein, having a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence that has at least 30% homology to SEQ ID NO.1 and binds to the CD72 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO.1.
[0008] Based on the SELEX technology, the present invention designed and synthesized a random single-stranded DNA library and corresponding primers to screen for nucleic acid aptamers that have small molecular weight, stable chemical properties, easy storage and labeling, and can bind to CD72 protein with high affinity. A nucleic acid aptamer with high affinity binding to CD72 protein was screened out, named JH-72-S0. This nucleic acid aptamer has higher affinity and specificity with CD72 protein.
[0009] It can be understood that the nucleotide sequence that has at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology with the nucleic acid aptamer provided by the present invention and binds to the CD72 protein, for example, the nucleotide sequence shown in any of the above nucleic acid aptamers can be partially deleted or partially added, and still have high affinity with the CD72 protein and are still within the scope of protection of the present invention.
[0010] In some embodiments, as an improvement to the above technical solution, a certain position on the nucleotide sequence of the above-mentioned nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, or isotopization, etc., provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it can have an affinity for binding to CD72 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.
[0011] Therefore, in some embodiments, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the CD72 protein, and the modification is selected from at least one of phosphorylation, methylation, amination, sulfhydrylation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization, which is still within the scope of protection of the present invention.
[0012] The present invention also provides a conjugate or derivative of a nucleic acid aptamer, wherein the conjugate includes a fluorescent marker; the derivative includes a phosphorothioate backbone or peptide nucleic acid that binds to the CD72 protein, which is modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.
[0013] The aptamer conjugate described in the present invention refers to the connection of other groups to the aptamer, such as fluorescent markers with marking functions, such as FAM, radioactive substances, therapeutic substances, biotin, digoxin, nanoluminescent materials, small peptides, siRNA or enzyme labels, so that the modified aptamer sequence has desirable properties, for example, it can have an affinity for binding to CD72 protein that is equal to or higher than that of the parent aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.
[0014] In other words, the above aptamers, whether partially substituted or modified, all have the same or similar molecular structure, physicochemical properties and functions as the original aptamers, and can be used to bind to the CD72 protein.
[0015] In addition, the present invention also provides aptamer derivatives, which are derived from the nucleotide sequence backbone of the aforementioned aptamer by modifying it into a phosphorothioate backbone that binds to the CD72 protein, or are peptide nucleic acids that bind to the CD72 protein by modifying the aptamer or aptamer conjugate described in any of the aforementioned technical solutions. The requirement is that the derivatives have substantially the same or similar molecular structure, physicochemical properties, and functions as the original aptamer and bind to the CD72 protein.
[0016] The term "phosphorothioate backbone" as used herein has the meaning generally understood by those of ordinary skill in the art and refers to the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers that can be replaced by one or two sulfur atoms, resulting in a phosphorothioate backbone having phosphorothioate or phosphorodithioate bonds, respectively. Such phosphorothioate backbones are known to have increased binding affinity to their targets and enhanced resistance to nuclease degradation.
[0017] The term "peptide nucleic acid," as used herein, has the meaning generally understood by those skilled in the art and refers to a synthetic analog of a DNA molecule first reported by Nielsen et al. in 1991. Using N-(2-aminoethyl)-glycine units instead of the sugar-phosphate backbone as repeating structural units, oligonucleotide mimics linked by peptide bonds are synthesized, termed peptide nucleic acids. Because peptide nucleic acids (PNAs) lack the phosphate groups found in DNA or RNA, there is no electrical repulsion between PNAs and DNA, resulting in a stronger binding strength between the two than between DNA.
[0018]
[0019] The present invention also provides a product for detecting CD72 protein, comprising the nucleic acid aptamer, or a conjugate or derivative of the nucleic acid aptamer.
[0020] The present invention also provides a product for purifying CD72 protein, comprising the nucleic acid aptamer, or a conjugate or derivative of the nucleic acid aptamer.
[0021] Preferably, the product includes one or more of a kit, a detection chip, and a chromatography detection device.
[0022] The present invention also provides a method for screening a nucleic acid aptamer that specifically binds to the CD72 protein, comprising the following steps:
[0023] (1) Synthesize random single-stranded DNA library and primers;
[0024] (2) Magnetic bead screening: Perform at least 5 rounds of counter-screening and screening, and add serum starting from the 5th round until the nucleic acid aptamer is obtained.
[0025] Preferably, the specific process of adding serum after the fifth round in step (2) is: adding 5% serum in the fifth round, adding 10% serum in the sixth round, and so on.
[0026] Preferably, the serum is human serum, purchased from Beijing Solebow Technology Co., Ltd., item number: SL010.
[0027] The method provided by the present invention for screening nucleic acid aptamers that bind to the CD72 protein is based on the SELEX screening method. In the magnetic bead screening step, serum is added for blocking starting from the 5th round and the serum concentration is increased in each round to further improve the specificity and stability of the nucleic acid aptamer.
[0028] Aptamer screening is typically performed in an ionic buffer. However, the addition of serum at a certain concentration is used during screening. This is because serum is rich in proteins that can compete with proteins on the magnetic bead surface for binding to the library, thereby removing sequences that have weak binding or are only adsorbed to the target CD72 protein. Furthermore, aptamer binding in a serum environment better meets the practical testing requirements of later aptamer-based applications.
[0029] Studies have shown that using higher concentrations of serum in the final rounds of screening can screen for nucleic acid aptamers with higher affinity and better specificity.
[0030] The present invention also provides the use of the nucleic acid aptamer or the conjugate or derivative of the nucleic acid aptamer for preparing a reagent for detecting or purifying CD72 protein.
[0031] The present invention also provides the use of the nucleic acid aptamer or the conjugate or derivative of the nucleic acid aptamer for preparing a drug targeting CD72 protein.
[0032] In some embodiments, the present invention provides use of the above-mentioned nucleic acid aptamer, its conjugate or derivative in any one of the group consisting of:
[0033] 1) Quantitative or qualitative detection of CD72 protein;
[0034] 2) Purification of CD72 protein;
[0035] 3) Imaging of CD72 protein;
[0036] 4) as an inhibitor of CD72 protein;
[0037] 5) preparing drugs targeting CD72 protein;
[0038] 6) Prepare reagents or drugs for diagnosing and treating abnormal CD72 expression.
[0039] Beneficial effects
[0040] (1) The present invention obtains a nucleic acid aptamer through screening that has a small molecular weight, stable chemical properties, is easy to store and label, and can bind to the CD72 protein with high affinity, and can bind to a cell line that highly expresses the CD72 protein.
[0041] (2) After truncation, the nucleic acid aptamer of the present invention can still maintain high affinity and high specificity binding to the CD72 protein. (3) The nucleic acid aptamer of the present invention has a relatively stable, simple structure, is easy to modify, can be artificially synthesized in a short period of time, has stable chemical properties, and is easy to store and label.
[0042] (4) The nucleic acid aptamers of the present invention can be used in detection, diagnosis, imaging, and treatment, such as purification or high-sensitivity and high-specificity detection of CD72 protein; preparation of drugs targeting CD72 protein; reagents or drugs for diagnosis and treatment of abnormal CD72 expression, etc., and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] Figure 1 Schematic diagram of the binding ability of the aptamers screened by SPR detection with CD72 protein in Example 2;
[0044] Figure 2 This is the affinity test data of nucleic acid aptamer JH-72-S0 and CD72 protein;
[0045] Figure 3 This is the affinity test data of nucleic acid aptamer JH-72-S0 and other proteins;
[0046] Figure 4 Shown are the retention rates for different rounds of screening. DETAILED DESCRIPTION
[0047] Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiments are only used to illustrate the present invention and are not used in limiting the scope of the present invention.In addition, should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall equally within the scope limited by the appended claims of the application.
[0048] Example 1
[0049] Screening of ssDNA aptamers binding to CD72 protein:
[0050] The method of this embodiment for screening ssDNA nucleic acid aptamers that bind to CD72 protein includes the following steps:
[0051] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences:
[0052] Random single-stranded DNA library Lib-18:
[0053] 5'-TCCAGCACTCCACGCATAAC(36N)GTTATGCGTGCTACCGTGAA-3'(SEQ ID NO.2);
[0054] Among them, "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0055] Primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.
[0056] Table 1. Primers and their sequences
[0057] Primer name Sequence (5'-3') JH-72-S1 TCCAGCACTCCACGCATAAC(SEQ ID NO.3) JH-72-FAM-S1 FAM-TCCAGCACTCCACGCATAAC(SEQ ID NO.4) JH-72-pBiotin-A2 Biotin-TTCACGGTAGCACGCATAAC(SEQ ID NO.5) JH-72-A2 TTCACGGTAGCACGCATAAC(SEQ ID NO.6)
[0058] The S in the primer name represents the forward primer, and the A in the primer name represents the reverse primer.
[0059] The primers were prepared into 100 μM stock solution using DPBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, sodium hydrogen phosphate dodecahydrate 2.8915 g / L; pH 7.4, 25°C) and stored at -20°C until use.
[0060] 2. Magnetic bead screening
[0061] The magnetic bead method was used for screening, and a total of 5 rounds of screening were performed. The screening process of each round is shown in Table 2.
[0062] Table 2. CD72 protein aptamer screening process
[0063]
[0064]
[0065] The specific screening process is as follows:
[0066] 1) Carboxyl magnetic beads to immobilize CD72 protein
[0067] Take 50 μl of carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., Catalog No. FM2221) and wash them four times with 200 μl of ultrapure water. Use a magnet to fish the beads and discard the supernatant. Take 100 μl each of the prepared NHS (0.1 M aqueous solution) and EDC (0.4 M aqueous solution) solutions, mix them in equal volumes, add them to the magnetic beads, and incubate at 25°C for 20 minutes to activate the carboxyl groups on the beads. Wash the beads twice with DPBS buffer and set aside.
[0068] Take 10 μl of CD72 protein (purchased from Sino Biological, 10692-H02H, concentration 1 mg / ml), add 80 μl of 10 mM sodium acetate (pH 4.5), mix thoroughly, and add to the activated magnetic beads. Incubate at 25°C on a vertical mixer for 60 minutes to allow the CD72 protein to couple to the magnetic bead surface via the amino groups on the protein surface.
[0069] After coupling, place the tube on a magnetic rack, discard the supernatant, and add 100 μl of 1 M ethanolamine, pH 8.5, to the magnetic beads. Incubate at 25°C on an endover for 10 minutes to block unreacted activated sites on the bead surface. Place the tube on a magnetic rack and discard the blocking solution. Wash the beads four times with 200 μl of DPBS and label them as MB-CD72.
[0070] 2) Counter-screening and screening
[0071] Preparation of counter-screening magnetic beads: Fc protein was conjugated to magnetic beads. The Fc protein was recombinantly expressed by Beijing Sino Biological Technology Co., Ltd. The conjugation procedure for the Fc protein was the same as for the CD72 protein. The Fc protein concentration was 1 mg / ml and diluted with 10 mM NaAC solution, pH 4.5. Specifically, 10 μl of Fc protein was added to 80 μl of 10 mM NaAC solution, pH 4.5, and mixed thoroughly. The remaining steps were the same. The conjugated magnetic beads were labeled MB-Fc.
[0072] Library dissolution and denaturation: Take 1 OD of randomized single-stranded nucleotide library and centrifuge at 14,000 rpm for 5 minutes. The library is then centrifuged to the bottom of the tube and dissolved in DPBS buffer to 10 μM. Mix thoroughly and aliquot into PCR tubes for denaturation. The following steps are performed: Set the PCR instrument to 95°C for 10 minutes to unwind the folded strands, then hold at 4°C for 5 minutes before equilibration to room temperature. Add the treated library to 50 μl of MB-Fc magnetic beads, mix thoroughly, and incubate on a vertical mixer at room temperature for a period of time. Place on a magnetic rack, collect the supernatant, labeled "pool-," and use it as the single-stranded nucleic acid library for positive screening with MB-CD72 magnetic beads. For each round of magnetic bead screening, perform a counter-screen with MB-his before performing a positive screening targeting the CD72 protein. The counter-screened supernatant is used as the single-stranded nucleic acid library for positive screening with MB-CD72 magnetic beads. Specifically, add the pooled library after counterscreening to 50 μl of MB-CD72 magnetic beads and incubate at 25°C for 40 minutes on a vertical mixer. Place the beads on a magnetic rack, aspirate and discard the supernatant, retaining the beads. Wash the beads four times with 200 μl of DPBS. Finally, add 200 μl of DPBS to the washed beads, incubate in a boiling water bath for 10 minutes, and collect the supernatant, labeled elution-CD72.
[0073] Using the nucleic acid molecules in elution-CD72 as template, conventional PCR amplification was performed. The method was as follows: 100 μl of the template elution-CD72 was added to 2 ml of PCR mix. The template and PCR mix mixture was then aliquoted into 100 μl tubes and added to PCR tubes. Amplification conditions were as follows: 25 cycles of pre-denaturation at 95°C for 2 minutes, denaturation at 95°C for 60 seconds, annealing at 60°C for 60 seconds, and extension at 72°C for 60 seconds. The mixture was then stored at 4°C. The PCR mix was prepared using dNTPs purchased from Novozymes (P031-02) and rTaq enzyme (R500Z) purchased from Takara Biotech.
[0074] The amplified product was purified using commercially available Tiandirenhe SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. 1 / 5 volume of 4M sodium chloride was added to 2mL of PCR product, followed by 160uL of SA magnetic beads that had been washed with DPBS and had the supernatant removed. After incubation on a shaker at room temperature for 30 minutes, the PCR product supernatant was removed. The magnetic beads were then washed three times with DPBS containing 0.02% Tween20, and 100uL of 40mM sodium hydroxide solution was added after removing the supernatant. After incubation for three minutes, the magnetic beads were removed by magnetic attraction. 4uL of 1M hydrochloric acid was then added to the supernatant to neutralize the single strand, followed by 104uL of 2*DPBS to dilute and neutralize the salt concentration. Finally, 208uL of the secondary library dissolved in 1*DPBS was obtained, which was used as the library for the next round of screening.
[0075] The magnetic bead method was repeated for 6 rounds. Each operation used the secondary library obtained in the previous operation as the starting nucleic acid library. After the library was denatured and renatured, it was incubated with MB-CD72 magnetic beads. During the screening process, SPR was used to detect the changes in the recognition ability of the DNA single-stranded library for CD72 protein. When the recognition ability of the DNA single-stranded library for CD72 protein met the requirements, that is, the binding ability of the screened DNA single-stranded library to the target protein was higher than that of the library input at the beginning of the screening ( Figure 4 ), it can be seen that the affinity of the library target obtained in the 5th round is high, and the affinity of the 5th round is much higher than that of the 1st and 2nd rounds, which meets the sequencing requirements. The obtained library is subjected to high-throughput sequencing analysis.
[0076] 3. Analysis and identification of the nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Genewizi Biotechnology (Jiangsu) Technology Co., Ltd., and the affinity was tested.
[0077] In subsequent testing, one sequence with the strongest binding ability was identified from the sequences obtained in the final fifth round. The nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO: 1 was named JH-72-S0.
[0078] Example 2
[0079] Surface plasmon resonance (SPR) detection of the affinity between CD72 protein aptamer and CD72 protein:
[0080] Suzhou Genewise Biotechnology Co., Ltd. was commissioned to synthesize the nucleic acid aptamer JH-72-S0, which was diluted to 500 nM with DPBS buffer.
[0081] 1. Couple CD72 protein to channel 2 of the CM5 chip surface as follows: First, wash the chip with 50 mM NaOH and inject 20 μL of sample at a flow rate of 10 μL / min. Then, activate the chip with a mixture of equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M in water) and NHS (N-hydroxysuccinimide; 0.1 M in water) and inject 50 μL of the sample at a flow rate of 5 μL / min. Dilute CD72 protein with 10 mM sodium acetate, pH 4.0, to a final concentration of 50 μg / mL and inject the sample at a flow rate of 5 μL / min. The CD72 protein coupling amount was 3500 Ru. After injection, block the chip with ethanolamine at a flow rate of 10 μL / min and inject 100 μL of sample. Channel 1 was treated as described above, with the Fc protein coupling, activation, and blocking procedures identical to those used for the control channel.
[0082] 2. Detection: Detection parameters were set using a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K). The six diluted aptamer samples were sequentially passed through channels 1 and 2. The procedure for each aptamer was as follows: injection at 30 μL / min for 3 minutes, dissociation at 30 μL / min for 3 minutes, and regeneration with 1 M NaCl at 30 μL / min for 30 seconds. The six diluted nucleic acid aptamers were injected sequentially.
[0083] The affinity test data of nucleic acid aptamer JH-72-S0 and CD72 protein are shown in Figure 1 The data showed that these nucleic acid aptamers were detected to have strong binding with CD72 protein using SPR instrument.
[0084] Table 3. Affinity of nucleic acid aptamers to CD72 protein
[0085] Aptamers Affinity KD for CD72 protein (nM) JH-72-S0 (SEQ ID NO. 1) 39.6
[0086] As can be seen from Table 3, the affinity of JH-72-S0 provided by the present invention to CD72 protein is very high (the smaller the KD value, the greater the affinity).
[0087] Example 3
[0088] Study on the specificity of nucleic acid aptamers:
[0089] This example uses ANP protein, IL-12p40 protein, Annexin V protein, and USO1 protein, respectively. Similar to the method used in Example 4 for immobilizing CD72 protein on an SPR chip for testing, ANP protein, IL-12p40 protein, Annexin V protein, and USO1 protein were coupled to the second channel of four channels on the surface of a CM5 chip, with coupling amounts of 806.6 RU, 6660.4 RU, 489.8 RU, and 5828.5 RU, respectively. The diluted JH-72-S0 aptamer was injected.
[0090] The affinity test data of nucleic acid aptamer JH-72-S0 and ANP protein, IL-12p40 protein, Annexin V protein and USO1 protein are shown in Figure 3 .Depend on Figure 3 It can be seen that the nucleic acid aptamer JH-72-S0 cannot bind to ANP protein, IL-12p40 protein, Annexin V protein, and USO1 protein, which shows that it has very good specificity.
[0091] Example 4
[0092] Detection of CD72 protein by dot blot hybridization assay based on nucleic acid aptamers:
[0093] The steps of the dot blot hybridization experiment performed on the nucleic acid aptamer JH-72-S0 in this example are as follows:
[0094] 1. Take a 6 cm × 1 cm nitrocellulose membrane (purchased from Millipore), dilute the CD72 protein to 0.5 mg / ml with DPBS, spot 1 μl of sample onto the nitrocellulose membrane, and air-dry for 60 minutes.
[0095] 2. After drying, block with 5% BSA protein at room temperature for 3 hours. After blocking, wash with DPBST (DPBS containing 0.5 ppm tween20) for 3 times and aspirate clean.
[0096] 3. Modify the nucleic acid aptamer synthesized by Jinweizhi in Example 1 with Biotin and dilute it to 0.5 uM. Then incubate the diluted nucleic acid aptamer with the protein on the nitrocellulose membrane on a shaker at room temperature for 16 hours.
[0097] 4. Wash three times with DPBST after incubation, placing on a shaker for 15 minutes each time.
[0098] 5. After washing, HRP-Streptavidin (purchased from Beyotime Biotech, 1 mg / ml) was diluted 1:2000 and incubated in the HRP-Streptavidin dilution solution for 60 minutes.
[0099] 6. Wash three times with DPBST after incubation, placing on a shaker for 15 minutes each time.
[0100] 7. Imaging system observation and photography: The instrument used is ImageQuant from GE Healthcare Life Sciences TM LAS 4000 digital imaging system.
[0101] from Figure 2 It can be demonstrated that nucleic acid aptamers can be used to accurately detect 125ug / ml of CD72 protein.
[0102] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.
Claims
1. A nucleic acid aptamer that specifically binds to CD72 protein, characterized in that: A nucleotide sequence having a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence having at least 30% homology to SEQ ID NO.1 and binding to CD72 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO.
1.
2. A conjugate or derivative of the nucleic acid aptamer according to claim 1, characterized in that: The conjugate includes a fluorescent marker; the derivative includes a phosphorothioate backbone or peptide nucleic acid that binds to the CD72 protein, which is modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.
3. A product for detecting CD72 protein, characterized in that: It includes the nucleic acid aptamer according to claim 1, or the conjugate or derivative of the nucleic acid aptamer according to claim 2.
4. A product for purifying CD72 protein, characterized in that: It includes the nucleic acid aptamer according to claim 1, or the conjugate or derivative of the nucleic acid aptamer according to claim 2.
5. The product according to claim 3 or 4, characterized in that The product includes one or more of a test kit, a detection chip, and a chromatography detection device.
6. A method for screening nucleic acid aptamers that specifically bind to CD72 protein, comprising the following steps: (1) Synthesize random single-stranded DNA library and primers; (2) Magnetic bead screening: perform at least 5 rounds of counter-screening and screening, and add serum starting from the 5th round until the nucleic acid aptamer as claimed in claim 1 is obtained.
7. The screening method according to claim 6, wherein The specific process of adding serum after the 5th round in step (2) is as follows: adding 5% serum in the 5th round, adding 10% serum in the 6th round, and so on.
8. The screening method according to claim 6 or 7, wherein The serum is human serum.
9. Use of the nucleic acid aptamer according to claim 1, or the conjugate or derivative of the nucleic acid aptamer according to claim 2 for preparing a reagent for detecting or purifying CD72 protein.
10. Use of the nucleic acid aptamer according to claim 1, or the conjugate or derivative of the nucleic acid aptamer according to claim 2 for preparing a drug targeting CD72 protein.