Application of potato SUMO ligase StSIZ1 gene and molecular marker in new variety breeding

Abstract

The invention discloses a function and a molecular mechanism of the StSIZ1 gene for regulating the drought resistance of potatoes. StSIZ1 transgenic plants are obtained through genetic transformation, it is found that overexpression strains significantly enhance drought resistance, improve POD, CAT and SOD activities and reduce MDA content, interference strains present opposite phenotypes, and it is proved that StSIZ1 is a drought resistance positive regulation factor. Yeast two-hybrid screening finds that the StSIZ1 interacts with StNAC and StbZIP transcription factors, and rotation experiments and BiFC verification show that the StSIZ1 participates in drought resistance response through a regulatory network. 6 SNP and 4 Indel molecular markers developed on the basis of StSIZ1 can realize accurate identification through specific genotype combination in variety identification; in new variety breeding, the KASP marker is developed by combining character correlation analysis, and hybrid offspring can be efficiently screened.

Description

Technical Field

[0001] The present invention belongs to the field of potato molecular breeding, and in particular relates to the application of StSIZ1 gene and molecular markers in the breeding of new varieties. Background Art

[0002] Potatoes are a typical temperate climate crop. Due to their shallow root systems, they are susceptible to a variety of abiotic stresses, particularly water shortages. This poses a severe challenge to potato plants, leading to significant yield declines and even plant death. Breeding drought-resistant potato varieties through research into gene function mechanisms is an effective strategy for coping with high temperatures and drought.

[0003] As a typical representative of SUMO E3 ligase, SIZ1 plays an important role in plant response to abiotic stress. The SIZ1 gene is sensitive to drought treatment and is also involved in the expression regulation of nearly 300 drought-related genes, enabling plants to cope with the challenges of drought at multiple levels, and plants overexpressing SIZ1 show stronger drought tolerance. In plants such as Arabidopsis, rice, and tomato, the SIZ1 gene has been shown to respond to drought stress and enhance the drought tolerance of plants by regulating related gene expression and protein modification. However, there is no report in the prior art on the response of potato SUMO E3 ligase StSIZ1 gene to drought stress, nor is there a report on SNP and Indel molecular markers of StSIZ1 gene. This application provides the specific functions and uses of potato SUMO E3 ligase StSIZ1 gene in drought stress response, providing new genetic resources and basis for potato drought-tolerant breeding. Summary of the Invention

[0004] The key technical problem to be solved by the present invention is to provide an application of the StSIZ1 gene in enhancing the drought resistance of potato plants.

[0005] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0006] 1. Potato StSIZ1 gene. The transcript sequence of this gene is shown in the sequence listing as SEQ No. 1. The CDS length is 2634 bp, encoding 877 amino acids. The accession number in the potato database is Soltu.DM.11G022540.4.

[0007] 2. Application of overexpressing StSIZ1 gene to enhance drought resistance of potato, the transcript sequence of StSIZ1 gene is shown in SEQ No. 1 in the sequence listing.

[0008] 3. Application of potato StSIZ1 gene in breeding new drought-resistant varieties. The transcript sequence of the StSIZ1 gene is shown in SEQ No. 1 in the sequence listing. Varieties with high expression levels of the StSIZ1 gene have stronger drought resistance.

[0009] 4. Overexpression of the StSIZ1 gene increases the activity of peroxidase (POD), catalase (CAT) and superoxide dismutase (SOD), and reduces the content of malondialdehyde (MDA). The transcript sequence of the StSIZ1 gene is shown in the sequence table SEQ No. 1.

[0010] 5. Application of interfering with potato StSIZ1 gene expression to weaken potato drought resistance, the transcript sequence of the StSIZ1 gene is shown in SEQ No. 1 in the sequence listing.

[0011] 6. Verification of the interaction between potato StSIZ1 and StNAC and StbZIP proteins, and SUMOylation modification of StNAC and StbZIP proteins to enhance potato drought resistance.

[0012] 7. Application of up-regulated expression or SUMOylation modification of StNAC gene to enhance drought resistance of potato. The ID number of the StNAC gene is Soltu.DM.07G028300.1.

[0013] 8. Application of up-regulated expression or SUMOylation modification of StbZIP gene to enhance drought resistance of potato, wherein the ID number of the StbZIP gene is Soltu.DM.05G001710.1.

[0014] 9. A method for verifying the application of the potato StSIZ1 gene to enhance drought and salt tolerance in potato plants, including: (1) genetic transformation of potatoes; (2) detection of transgenic positive lines; and (3) identification of drought resistance in transgenic potato plants.

[0015] 10. Application of StSIZ1 gene SNP and Indel molecular markers in variety identification. There are 6 SNP molecular markers and 4 Indel molecular markers. If all match, the corresponding variety can be identified.

[0016] 11. Application of StSIZ1 gene SNP and Indel molecular markers in new variety breeding, wherein there are 6 SNP molecular markers and 4 Indel molecular markers.

[0017] Beneficial effects: The present invention successfully obtained transgenic potato plants by constructing the overexpression vector PRI201-AN-StSIZ1 of the StSIZ1 gene and the interference expression vector pCPB121-amiR-StSIZ1, using genetic transformation technology. Phenotypic observation and qRT-PCR analysis showed that the expression level of StSIZ1 was significantly positively correlated with plant growth indicators, confirming that the gene has a positive regulatory effect on potato growth and development. In a 14-day water-deprivation drought stress experiment, the StSIZ1 overexpression line showed a significant growth advantage, while the interference expression line showed a wilting phenotype. Physiological and biochemical analysis showed that StSIZ1 overexpression can significantly improve the drought resistance of potatoes, and effectively change the POD, CAT and SOD enzyme activities and MDA content, while the interference expression line showed the opposite change trend. Further screening of multiple potential interacting proteins was performed through yeast two-hybrid analysis, and verification was performed through yeast two-hybrid rotation experiments and bimolecular fluorescence complementation (BiFC) experiments. It was found that StSIZ1 interacts with StNAC and StbZIP proteins, and they jointly participate in regulating the potato drought resistance response network. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 : Agrobacterium-mediated transformation of potato and rooting screening of transgenic plants. Figure 1 A. Co-cultivation of transformed potato chips; Figure 1 B. potato chip callus differentiation and budding; Figure 1 C. Rooting and screening of transformed plants. In the figure: WT: non-transgenic plants; OE: overexpression plants; RNAi: interference expression plants.

[0019] Figure 2 : PCR identification and phenotypic analysis of potato StSIZ1 transgenic plants. Figure 2 A. PCR identification of overexpression lines; Figure 2 B. PCR identification of interference expression lines; Figure 2 C. Phenotypic analysis of transgenic plants.

[0020] Figure 3 : Detection of expression level of potato StSIZ1 transgenic plants. Figure 3 A. Expression level detection of overexpression strains; Figure 3 B. Expression level detection of interference expression strains.

[0021] Figure 4 : Changes in POD, CAT, SOD enzyme activities and MDA content in potato StSIZ1 transgenic plants after drought stress. Figure 4 A.POD activity; Figure 4 B.CAT activity; Figure 4 C.SOD activity; Figure 4D. MDA content. The bar graphs from left to right are WT, OE-1, OE-2, OE-3, RNAi-1, RNAi-2, and RNAi-3.

[0022] Figure 5 :Detection of toxicity and autoactivation of potato StSIZ1 protein. Figure 5 A. Toxicity testing; Figure 5 B. Self-activation detection.

[0023] Figure 6 :Verification of the interaction between potato StSIZ1 and StNAC and StbZIP proteins. Figure 6 A. Yeast two-hybrid rotation verification; Figure 6 B. Bimolecular fluorescence complementation verification.

[0024] Figure 7 : The structure of potato StSIZ1 gene. The underlined parts are the start codon and the stop codon, and the CDS region is between them. Specific implementation methods

[0025] The experimental methods described in the following embodiments of the present invention, unless otherwise specified, all adopt conventional experimental methods and equipment; the experimental equipment and reagents involved are all conventional products available on the market. In order to make the purpose, technical solutions and advantages of the present invention clearer, the implementation scheme of the present invention is now described in detail in conjunction with specific examples. It should be noted that: in the specific examples, typical examples of preferred implementation schemes are highlighted; in order to highlight the core innovations of the present invention, only the core content and key operating steps closely related to the technical solutions of the present invention are shown in the examples, and non-critical technical details are appropriately simplified; in order to avoid redundant information interfering with the clear presentation of the technical solution, technical details that are less relevant to the innovation of this technology have been omitted.

[0026] Example 1

[0027] This embodiment provides a potato StSIZ1 gene, which has the following characteristics:

[0028] Potato StSIZ1 (Soltu.DM.11G022540.4) is located on chromosome 11. The gene is 3651 bp long, with a CDS region of 834 bp. The sequence is shown in SEQ ID No. 1 in the sequence listing and contains 16 exons. The protein encoded by StSIZ1 consists of 877 amino acids, with a relative molecular weight of 95.5 kD and a theoretical isoelectric point of 4.96. The protein contains a total of 122 negatively charged residues (Asp+Glu) and 93 positively charged residues (Arg+Lys), and the molecular formula is C 4121 H 6549 N 1185 O 1342 S40 StSIZ1 protein is an unstable acidic protein with an instability coefficient of 44.28, a fat coefficient of 76.34, and an overall average hydrophilicity of -0.453.

[0029] Example 2

[0030] This embodiment provides a method for constructing a plant overexpression and interference vector for the potato StSIZ1 gene, comprising:

[0031] 1. Construction of StSIZ1 gene overexpression vector

[0032] The inventors amplified the StSIZ1 sequence from cDNA of potato cv. Atlantic leaves using the following PCR primers: forward primer: 5'-TCTTCACTGTTGATACATATGATGGATTTGGTTGCTAGCTG-3', reverse primer: 5'-TGTTGATTCAGAATTGTCGACCTATTCAGAATCCGAATCAATAC-3'; the PCR reaction system was: Max DNA Polymerase 10.0 μL, cDNA template (100 ng) 1.0 μL, forward / reverse primers (10 μM) 1.0 μL, ddH2O 7.0 μL; PCR reaction conditions were 98°C for 10 seconds, 60°C for 5 seconds, and 72°C for 40 seconds for a total of 30 cycles. Using homologous recombination, the target gene amplified from the PCR band was recovered from a gel and ligated into the linearized vector pRI201-AN digested with Nde I and Sal I. Heat-shock transformation was performed into Escherichia coli DH5α, and sequencing was performed. Positive clones identified by sequencing, including the pRI201-AN-StSIZ1 plasmid, were transformed into Agrobacterium tumefaciens GV3101. PCR-positive clones were stored for further genetic transformation.

[0033] 2. Construction of StSIZ1 gene interference expression vector

[0034] 2.1 Design and construction of primers for artificial miRNA precursor fragments

[0035] Submit the coding region sequence of the StSIZ1 gene to the WMD3 online website (http: / / wmd3.weigelworld.org / cgi-bin / webapp.cgi), which provides the target gene's amiRNA interference sequence (5'-TACCTTGTCGTTGAGACGCTT-3'). PCR amplification primers were automatically retrieved using the Oligo function on the website. The optimal primer sequence was selected and downloaded for primer synthesis. Specific primer information is shown in Table 1.

[0036] Table 1 PCR amplification primers for amiR-StSIZ1

[0037] Primer name Primer sequence (5'-3') A CTGCAAGGCGATTAAGTTGGGTAAC B GCGGATAACAATTTCACACAGGAAACAG Ⅰ gaTAACCTTGTCGTTGAGACGCTTctctcttttgtattcc Ⅱ gaAAGCGTCTCAACGACAAGGTAtcaaagagaatcaatg Ⅲ gaAAACGTCTCAACGTCAAGGTTtcacaggtcgtgatatg Ⅳ gaAACCTTGACGTTGAGACGTTTTtctacatatattattcct

[0038] 2.2 Cloning of artificial miRNA precursor fragments

[0039] Using the pRS300 plasmid as a template, precursor fragments a, b, and c were amplified separately. The specific amplification principle was that fragment a, amplified using primers A and IV, replaced the 5' arm of pRS300 mi3191a; fragment b, amplified using primers III and II, replaced the central loop of mi3191a; and fragment c, amplified using primers I and B, replaced the 3' arm of mi3191a. The amplification system is shown in Table 2.

[0040] Table 2 PCR system for amiRNA precursor fragments

[0041] PCR reaction Forward primer Reverse primer template Product length (bp) a A IV pRS300 272 b III II pRS300 171 c I B pRS300 298 d A B a+b+c 701

[0042] The PCR reaction system is: Max DNA Polymerase 10.0 μL, cDNA template (100 ng) 1.0 μL, forward / reverse primers (10 μM) 1.0 μL, ddH2O 7.0 μL; PCR reaction conditions were 98°C 10 sec, 60°C 5 sec, 72°C 40 sec for a total of 30 cycles.

[0043] 2.3 Construction of cloning vector pMD18-amiR-StSIZ1

[0044] The amplified fragment d was ligated with the pMD18-T vector using the following ligation system: 1.0 μL of pMD18-T, 4.0 μL of fragment d, and 5.0 μL of Solution I. After addition, the samples were thoroughly mixed and briefly centrifuged. The ligation was then performed in a PCR instrument at 16°C for 30 minutes. The ligated pT18-d fragment was heat-shocked into competent E. coli DH5α and verified by sequencing. The correct clone was designated pMD18-amiR-StSIZ1.

[0045] 2.4 Construction of pCPB121-amiR-StSIZ1 interference expression vector

[0046] The pCPB121 empty plasmid and the pMD18-amiR-StSIZ1 recombinant vector were digested with restriction endonucleases Kpn I and Sac I. The linearized vector large fragment and the desired precursor small fragment with sticky ends were recovered by gel extraction and stored at -20°C until further use. The precursor small fragment and the linearized vector large fragment were ligated using homologous recombination with T4 ligase. The reaction system consisted of 2.0 μL of 10× ligation buffer, 10.0 μL of T18-StSIZ1 small fragment, 4.0 μL of linearized pCPB121 vector, 1.0 μL of T4 ligase, and 3.0 μL of ddH2O. The samples were added on ice and briefly centrifuged to mix. The mixture was then ligated in a PCR instrument at 16°C for 1.5 h. The ligated products were heat-shocked into Escherichia coli DH5α and verified by sequencing. The positive clone pCPB121-amiR-StSIZ1 detected by sequencing was transformed into Agrobacterium GV3101, and the clones positive by PCR were preserved for further genetic transformation.

[0047] Example 3

[0048] This embodiment provides a method for verifying the application of the potato StSIZ1 gene in regulating drought resistance in potatoes, comprising:

[0049] 1. Potato genetic transformation

[0050] Agrobacterium GV3101 containing pRI201-AN-StSIZ1 and pCPB121-amiR-StSIZ1 was inoculated into LB medium containing 50 mg / L Kan and 50 mg / L Rif and cultured at 28 °C and 220 r / min on a shaker until OD 600 The pellet was about 0.6. Centrifuged at 4000 rpm for 6 minutes, and the precipitate was resuspended in 3% MS liquid medium. Atlantic tube potatoes grown for 12-16 weeks and about 0.5 cm in diameter were cut into 1-2 mm thick slices and immersed in the above Agrobacterium solution for 7-8 minutes, with continuous shaking. After the infection, the potato slices were removed and the surface bacterial solution was dried with sterile filter paper. Transferred to co-culture medium S1: 3% MS + 1 mg / L IAA + 0.2 mg / L GA3 + 0.5 mg / L 6-BA + 2 mg / L ZT culture dish ( Figure 1 A), cultured in the dark at 28°C for 2 days, then transferred to S2 medium: S1+75mg / L Kan+400mg / L Cef, and cultured under the conditions of light intensity 2000Lx, photoperiod 16h / d, and temperature 23°C until resistant buds regenerated ( Figure 1 B). When the resistant buds are 1-1.5 cm long, they are cut and transferred to rooting medium S3 ( Figure 1C): 3% MS + 75 mg / L Kan + 400 mg / L Cef. The seedlings that can normally take root after 7 days are considered as transformed seedlings.

[0051] 2. Identification of transgenic positive strains

[0052] Cut 1-2 leaves of the seedling to be tested and place them in a 2ml centrifuge tube. Extract DNA using the CTAB method. After DNA extraction, use it as a template for PCR transgenic strain detection. Use the vector primer NPT II-F: 5'-GCTATGACTGGGCACAACAG-3' and the reverse primer NPT II-R: 5'-ATACCGTAAAGCACGAGGAA-3' to amplify by PCR and detect multiple transgenic plants by electrophoresis ( Figure 2 Total RNA from transgenic plants and control plants was extracted using a plant RNA rapid extraction kit (Tiangen), and reverse transcription was performed using a reverse transcription kit (Sevier) to generate cDNA. Using cDNA as a template, quantitative primers were used to detect the expression of the target gene StSIZ1. The results showed that the expression of StSIZ1 in multiple positive transgenic lines was significantly upregulated / inhibited ( Figure 3 B).

[0053] 3. Identification of drought resistance of transgenic potato plants

[0054] Stem segments of potato plantlets were inoculated onto solid medium containing 3% MS and cultured in a chamber at (22±1)°C with a 16-hour light / 8-hour dark photoperiod for 4 weeks. The plantlets were then transplanted into plastic pots (10×10 cm) containing a soil:vermiculite (3:1, v / v) mixture and cultured under the same temperature and light conditions, with watering every 5 days. Drought stress treatment was initiated after 4 weeks of growth. Under normal growth conditions, the growth and phenotypes of the 8-week-old wild-type (WT), overexpression (OE), and RNAi knockdown (RNAi) lines were largely identical. However, after 14 days of drought treatment, the StSIZ1 overexpression line exhibited a significant growth advantage, while the knockdown line displayed a pronounced wilting phenotype. Further determination of antioxidant enzyme activities and malondialdehyde content in plants under drought stress revealed that under normal conditions, there was no significant difference in the activities of peroxidase (POD), catalase (CAT), and superoxide dismutase (SOD) among WT, OE, and RNAi plants; after drought stress, the activities of these three enzymes increased significantly in all plants, but the enzyme activities of RNAi plants were significantly lower than those of WT and OE lines, while those of OE lines were significantly higher than those of WT ( Figure 4 AC). Malondialdehyde (MDA) content analysis showed that there was no significant difference among the strains before treatment, but after stress treatment, the MDA content of the OE strain was significantly lower than that of the WT, while that of the RNAi strain was significantly higher than that of the WT ( Figure 4D). These results indicate that StSIZ1 overexpressing plants exhibited better drought resistance than the wild type by enhancing antioxidant enzyme activities (POD, CAT, and SOD) and reducing MDA accumulation; in contrast, knockdown plants exhibited poorer drought resistance due to weakened antioxidant capacity.

[0055] Example 4

[0056] This embodiment provides a method for screening StSIZ1 interacting proteins, including:

[0057] 1. Construction of the Bait Vector pGBKT7-StSIZ1

[0058] The inventors used the constructed pRI201-AN-StSIZ1 as a template to amplify the StSIZ1 sequence. The PCR primers used were: forward primer: 5'-catggaggccgaattcccgggATGGATTTGGTTGCTAGCTGCA-3', reverse primer: 5'-atgcggccgctgcaggtcgacCTATTCAGAATCCGAATCAATACTTAGAT-3'; the PCR reaction system was: MaxDNA Polymerase 10.0 μL, cDNA template (100 ng) 1.0 μL, forward / reverse primers (10 μM) 1.0 μL, ddH2O 7.0 μL; PCR reaction conditions were 98°C for 10 seconds, 60°C for 5 seconds, and 72°C for 40 seconds for a total of 30 cycles. Using homologous recombination, the target gene amplified from the PCR band was recovered from the gel and ligated into the linearized pGBKT7 vector digested with Sma I and Sal I. Heat-shock transformation was performed into E. coli DH5α, and sequencing was performed. The plasmid that successfully underwent sequencing was designated pGBKT7-StSIZ1.

[0059] 2. Toxicity and Self-activation Assays of the Bait Vector pGBKT7-StSIZ1

[0060] The bait vector pGBKT7-StSIZ1 plasmid and the pGBKT7 empty vector were introduced into AH109 competent cells by the PEG / LiAc method, and then spread on single-deficient solid medium (SD / -Trp) and double-deficient solid medium (DDO / -Trp / -Leu), and cultured in an inverted incubator at 30°C for 72-96h. The results showed that the bait vector and the empty vector grew colonies of roughly the same size on the SD / -Trp plate, but no colonies grew on the DDO / -Leu / -Trp medium ( Figure 5 A), indicating that the protein encoded by the bait vector pGBKT7-StSIZ1 is not toxic to yeast cells.

[0061] The bait vector pGBKT7-StSIZ1 plasmid and the blank control vector pGADT7 plasmid were co-transfected into AH109 competent cells by the PEG / LiAc method. The pGADT7-RecT and pGBKT7-53 plasmids were selected as positive controls, and the pGADT7-RecT and pGBKT7-Lam plasmids were selected as negative controls. The transformed yeast liquid was spread on two-deficient solid medium (DDO / -Trp / -Leu), four-deficient solid medium (QDO / -Leu / -Trp / -His / -Ade) and four-deficient solid medium (QDO / -Leu / -Trp / -His / -Ade / X-α-gal), respectively, and inverted cultured at 30°C for 72-96h. The results showed that colonies grew in the positive, negative and experimental groups on the DDO / -Trp / -His medium, only the positive control grew colonies on the QDO / -Leu / -Trp / -His / -Ade medium, and the positive colonies turned blue on the QDO / -Leu / -Trp / -His / -Ade / X-α-gal medium, and no colonies grew in the negative control and experimental groups ( Figure 5 B) This indicates that the pGBKT7-StSIZ1 bait vector does not have self-activation activity and can be used for yeast two-hybrid screening library experiments.

[0062] 3. Screening of proteins interacting with StSIZ1 by co-transfection

[0063] The pGBKT7-StSIZ1 bait vector and the potato cDNA library were co-transfected into AH109 competent cells, and proteins interacting with StSIZ1 were screened by co-transfection. Positive clones were selected by screening on the four-deficient medium QDO / -Leu / -Trp / -His / -Ade. The selected colonies were transferred to 0.9% NaCl solution and 10 μL was spotted on QDO / -Leu / -Trp / -His / -Ade / X-α-gal. The positive clones grew and turned blue. The colonies were verified by PCR. Electrophoresis results showed that PCR amplified multiple bands of varying sizes. The results indicate that multiple proteins interacting with StSIZ1 have been successfully screened in the library. The electrophoresis bands ranging from 500 to 2000 bp were sent to the company for sequencing.

[0064] 4. Sequence alignment of candidate positive clones

[0065] The sequencing results were compared and analyzed using the potato databases PGSC and Pfam. The results are shown in Table 3. StNAC (Soltu.DM.07G028300.1) and StbZIP (Soltu.DM.05G001710.1) proteins were selected from the sequencing results for interaction verification.

[0066] Table 3 Analysis of StSIZ1 interacting proteins

[0067] Gene number Notes CDS length Pfam No. Soltu.DM.07G028300.1 NAC family transcription factors 1050nt PF02365 Soltu.DM.05G001710.1 bZIP transcription factors 585nt PF00170

[0068] Example 5

[0069] This implementation provides a method for validating StSIZ1 interacting proteins, including:

[0070] 1. Construction of yeast two-hybrid verification vector

[0071] The inventors amplified StNAC and StbZIP sequences from cDNA extracted from potato cv. Atlantic leaves using the PCR primers listed in Table 4. The PCR reaction system and conditions were the same as described in 4.1. Using homologous recombination, the target gene bands amplified by PCR were recovered from gels and ligated into pGADT7 linearized with Sma I and Sac I enzymes. The plasmids were heat-shock transformed into Escherichia coli DH5α and verified by sequencing. Plasmids that matched the sequencing criteria were designated pGADT7-StNAC and pGADT7-StbZIP.

[0072] Table 4 Primer sequences for constructing vectors

[0073] Primer name Primer sequence (5'-3') Restriction site AD-StNAC-F ggccagtgaattccacccgggATGAGTAACAACAGCAGCTTGAGC Sma I AD-StNAC-R attcatctgcagctcgagctcTCAATAATTGTTCCATATTGTAGGATATCC Sac I AD-StbZIP-F gtaccagattacgctcatatgATGTTAGGGGTAGAAGATTTGAGCT Sma I AD-StbZIP-R cagctcgagctcgatggatccTCAGTGAGCTGGATGGAGAACA Sac I

[0074] 2. Yeast two-hybrid assay rotation verification experiment

[0075] Using pGADT7-Rect+pGBKT7-53 as a positive control and pGADT7-Rect+pGBKT7-Lam as a negative control, the pGBKT7-StSIZ1 vector was co-transformed with the pGADT7-StNAC and pGADT7-StbZIP vectors into yeast AH109 competent cells, spread on a two-deficient medium (SD / -Trp / -Leu), and inverted at 30°C for 3-4 days. After that, a positive single colony was picked and diluted in 20 μL 0.9% NaCl solution. 10 μL was aspirated and spotted on a four-deficient medium (SD / -Leu / -Trp / -His / -Ade / X-α-gal) medium and incubated at 30°C for 3-4 days. The colony turned blue, indicating that StSIZ1 interacted with StNAC and StbZIP proteins. The blue colony was picked and placed in 0.9% NaCl and diluted at 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 Serial dilutions were performed and the samples were spotted on two-deficient medium (SD / -Trp / -Leu), four-deficient medium (SD / -Leu / -Trp / -His / -Ade) and four-deficient medium (SD / -Leu / -Trp / -His / -Ade / X-α-gal). The growth of the colonies was analyzed. Figure 6 A).

[0076] 3. Construction of bimolecular fluorescence complementation vector

[0077] The inventors amplified the StNAC and StbZIP sequences from the pGADT7-StNAC and pGADT7-StbZIP recombinant plasmids described above. The PCR primers used are listed in Table 5. The PCR reaction system and conditions were the same as described in 4.1. Using homologous recombination, the target gene bands amplified by PCR were recovered from gels and ligated into pSPYCE-35S and pSPYNE-35S linearized vectors digested with Xba I and Sma I, respectively. The resulting plasmids were heat-shock transformed into Escherichia coli DH5α and verified by sequencing. Plasmids that successfully underwent sequencing were designated pSPYCE-StSIZ1, pSPYNE-StNAC, and pSPYNE-StbZIP. These plasmids were then transformed into Agrobacterium tumefaciens GV3101, and clones that tested positive for PCR were stored.

[0078] Table 5 Primer sequences for constructing vectors

[0079]

[0080]

[0081] 4. Observation of Bimolecular Fluorescence Complementation Fluorescence Signals

[0082] Using pSPYCE-StSIZ1+pSPYNE-35S as a blank control, pSPYCE-StSIZ1 was mixed with pSPYNE-StNAC and pSPYNE-StbZIP Agrobacterium at a ratio of 1:1 and injected into tobacco leaf cells for transient expression experiments. The yellow fluorescent protein signal in tobacco cells was observed under a laser confocal microscope at an excitation wavelength of 514 nm. Yellow fluorescence was observed in tobacco leaf cells in the experimental groups co-expressing pSPYCE-StSIZ1+pSPYNE-StNAC and pSPYCE-StSIZ1+pSPYNE-StbZIP, while no yellow fluorescence was observed in the control group pSPYCE-StSIZ1+pSPYNE-35S ( Figure 6 B), indicating that StSIZ1 interacts with StNAC and StbZIP.

[0083] Example 6

[0084] This study provides StSIZ1 molecular markers, including whole-genome resequencing of 140 laboratory-maintained potato accessions. Whole-genome resequencing (PE150, 30×) was performed using the DNBSEQ-T7 platform. Sequencing data were filtered using fastp v0.20.0 to create raw FASTQ files. The whole-genome data were then aligned to the C88 reference genome (http: / / spuddb.uga.edu / ) using BWA-MEM v0.7.13-r1126 to generate binary alignment bam files. Single-nucleotide polymorphisms (SNPs) and indels (InDels) were detected using GATK v3.6-0-g89b7209, and sequencing and alignment errors were removed using bcftools-1.13 to generate high-quality SNPs and InDels. The StSIZ1 gene was screened for SNP and InDel markers, with the results shown in Table 6.

[0085] Table 6 StSIZ1 gene SNP and Indel molecular markers

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092] As shown in Table 6, the StSIZ1 gene contains a total of six SNP markers and four indel markers. These markers have important applications in variety identification and new variety breeding. For example, in the Atlantic variety, the SNP genotypes are T, T, A, A, A, T, T, and A, and the indel genotypes are A, AT, C, and A, respectively. This specific combination can serve as a molecular basis for identification of this variety. In the breeding process, these SNP and indel markers can be used for trait association analysis and, further, for the development of KASP markers, enabling efficient screening of target traits in hybrid offspring.

Claims

1. Application of overexpressing StSIZ1 gene to enhance drought resistance in potato, characterized in that The transcript sequence of the StSIZ1 gene is shown in the sequence table SEQ No.

1.

2. Application of potato StSIZ1 gene in breeding drought-resistant new varieties, characterized by The transcript sequence of the StSIZ1 gene is shown in SEQ No. 1 in the sequence table. Varieties with high expression levels of the StSIZ1 gene have stronger drought resistance.

3. The use of the StSIZ1 gene according to any one of claims 1-2, characterized in that The StSIZ1 gene increases the activities of peroxidase POD, catalase CAT and superoxide dismutase SOD, and reduces the content of malondialdehyde MDA to achieve the application.

4. The use of the StSIZ1 gene according to any one of claims 1-2, characterized in that The StSIZ1 performs SUMOylation modification on StNAC and StbZIP to enhance the drought resistance of potatoes.

5. Application of StSIZ1 gene SNP and Indel molecular markers in variety identification, characterized by There are 6 SNP molecular markers and 4 Indel molecular markers. If all of them match, the corresponding variety can be identified.

6. Application of StSIZ1 gene SNP and Indel molecular markers in new variety breeding, characterized by There are 6 SNP molecular markers and 4 Indel molecular markers.

7. A method for verifying the use of potato StSIZ1 gene to enhance drought and salt tolerance in potato plants, characterized in that The method comprises: (1) genetic transformation of potatoes; (2) detection of transgenic positive lines; and (3) identification of drought resistance of transgenic potato plants.

8. Potato StSIZ1 gene. The transcript sequence of this gene is shown in the sequence listing as SEQ No.

1. The CDS length is 2634 bp, encoding 877 amino acids. The accession number in the potato database is Soltu.DM.11G022540.4.

Images