Chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation and application

Abstract

The invention discloses a chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation and application, and belongs to the technical field of molecular biology. According to the method, microcell-mediated chromosome transfer and CRISPR / Cas9 chromosome knockout are combined, endogenous homologous chromosomes are removed while exogenous chromosomes are transferred, the characteristics of cell uploidy are maintained, and the influence of aneuploidy is avoided; and chromosome replacement animal individuals are obtained at one time by using a tetraploid complementation technology, so that the experiment efficiency and success rate are improved. The method is accurate and efficient, has huge potential in the fields of regenerative medicine, synthetic biology and the like, successfully realizes mega-level length Y chromosome transfer and allosome and heterosome chromosome replacement, and shows the value of the method in large-fragment DNA operation and heterosome chromosome application research.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and specifically relates to a chromosome replacement method and application based on CRISPR / Cas9, MMCT and tetraploid complementation. Background Art

[0002] In recent years, mammalian artificial chromosomes (ACs) have become an important tool in synthetic biology and the study of genome function. Currently, there are two main approaches to constructing ACs: top-down and bottom-up. The "top-down" approach builds on natural chromosomes by introducing new telomeres at specific chromosomal loci, resulting in truncated chromosomes that retain only the basic framework. In contrast, the "bottom-up" approach, also known as de novo chromosome construction, typically involves assembling chromosomes in vitro using autonomously replicating sequences (ARSs), centromeres, and / or telomeres. ACs have been widely used in biomedical research and therapeutic development, such as biopharmaceutical production, the generation of humanized animal models, and the development of gene and cell therapies for intractable genetic diseases such as hemophilia A, amyotrophic lateral sclerosis (ALS), and Duchenne muscular dystrophy (DMD).

[0003] Microcell-mediated chromosome transfer (MMCT) is a key technology widely used to transfer chromosomes between mammalian cells. It has successfully achieved cross-species transfer of homologous or heterologous chromosomes (e.g., human chromosomes into mouse cells). However, this technique often results in aneuploidy in the recipient cells, leading to abnormal cell proliferation, genomic instability, and metabolic imbalances (e.g., the developmental disorders caused by trisomy 21 in Down syndrome). Aneuploidy not only limits basic research but also hinders the clinical application of ACs, necessitating the development of euploidy-maintaining technologies. To address this, Yang Hui's group reported in Genome Biology in 2017 a CRISPR / Cas9-based specific chromosome knockout technique. By using the CRISPR / Cas9 system to specifically target chromosomal repetitive sequences, they successfully knocked out the target chromosome in mouse cells and fertilized eggs, without affecting other endogenous chromosomes. This breakthrough provides a new approach to chromosome replacement: transferring an exogenous chromosome while simultaneously eliminating the homologous endogenous chromosome using CRISPR / Cas9, thereby maintaining euploidy.

[0004] Traditionally, chimeric mice are created using transferred chromosome mouse embryonic stem cells (mESCs), and offspring carrying the target chromosome are bred through reproductive chimerism. However, this strategy has significant limitations. When these mESCs successfully achieve reproductive chimerism, the chimeric mice can be used to breed F1 offspring carrying the target chromosome. However, this strategy is time-consuming and has significant limitations. When the target chromosome carries a gene that affects gamete development or when mESCs cannot achieve reproductive chimerism for other reasons, the program will not proceed smoothly. In 2009, Academician Gao Shaorong's team obtained mice derived entirely from iPS cells through tetraploid blastocyst injection. This technology uses in vitro induction of mouse two-cell embryo fusion to obtain tetraploid embryos. Compared to normal diploid embryos, tetraploid embryos lack the ability to develop into normal mouse individuals and can only develop extraembryonic tissues.

[0005] In summary, although existing technologies have made some progress in chromosome transfer and ACs construction, there are still many challenges and limitations. Therefore, developing an efficient and accurate chromosome replacement method to overcome the shortcomings of existing technologies and promote the development and application of chromosome replacement technology has important scientific research and clinical value. Summary of the Invention In response to the technical problems that existing technologies cannot synchronously transfer exogenous chromosomes and eliminate endogenous homologous chromosomes, resulting in difficulty in maintaining euploid characteristics; large DNA fragment transfer efficiency is low, limiting operational potential; homologous / heterogeneous chromosome replacement is difficult, and it is impossible to directly obtain replaced embryonic stem cells and animal individuals; and individuals must be obtained through chimeras, which limits application, the present invention aims to provide a chromosome replacement method and application based on CRISPR / Cas9, MMCT and tetraploid complementation.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The present invention provides a chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation, comprising: Step 1: Using microcell-mediated chromosome transfer and the CRISPR / Cas9 gene editing system, the target exogenous chromosome is introduced into the recipient cell and the endogenous chromosome of the recipient cell is knocked out; Step 2: Evaluate the euploidy of the recipient cells whose endogenous homologous chromosomes have been knocked out to confirm whether the cells maintain a euploid state. If the recipient cells do not maintain euploidy, return to step 1 and adjust the microcell-mediated transfer conditions to regain euploidy. Step 3: Using recipient cells with euploid characteristics, obtain an animal model after chromosome replacement.

[0007] The donor chromosome is a heterologous chromosome that is nonhomologous to the recipient cell, or a homologous chromosome that is partially homologous to the recipient cell.

[0008] In step 1, the target exogenous chromosome is first introduced into the recipient cell through microcell-mediated chromosome transfer, and then the endogenous homologous chromosome in the recipient cell is knocked out using the CRISPR / Cas9 gene editing system.

[0009] In step 1, the CRISPR / Cas9 gene editing system is first used to knock out the endogenous chromosomes in the recipient cells, and then the labeled target exogenous chromosomes are transferred to the recipient cells with knocked-out endogenous chromosomes through microcell-mediated chromosome transfer.

[0010] Furthermore, knocking out endogenous chromosomes in recipient cells using the CRISPR / Cas9 gene editing system specifically includes: co-transfecting a plasmid encoding Cas9, a reporter gene element plasmid containing homology arms, and a designed sgRNA into recipient cells; and obtaining recipient cells in which the endogenous chromosomes are successfully knocked out through screening and identification.

[0011] In step 3, an animal model after chromosome replacement is obtained by injecting or culturing recipient cells with euploid characteristics in vitro.

[0012] Furthermore, the animal model after chromosome replacement obtained by injection specifically includes: microinjecting recipient cells with euploid characteristics into the tetraploid blastocyst cavity to obtain the injected tetraploid blastocyst; transplanting the injected tetraploid blastocyst into the body of a pseudo-pregnant animal of the same period, and after its development, obtaining the animal model after chromosome replacement.

[0013] Furthermore, the animal model after chromosome replacement obtained by in vitro culture specifically includes: mixing recipient cells with euploid characteristics with tetraploid four-cell stage embryos with the zona pellucida removed in vitro to form blastocysts; transplanting the blastocysts into pseudo-pregnant animals of the same period, and obtaining the animal model after chromosome replacement after the blastocysts develop.

[0014] The present invention provides an engineered chromosome obtained by the chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation.

[0015] The present invention provides a cell comprising the engineered chromosome.

[0016] The use of the engineered chromosomes or cells described above in preparing chromosome replacement animal models, improving animal and plant traits, or producing pharmaceutical proteins.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a chromosome replacement method based on CRISPR / Cas9, MMCT, and tetraploid complementation. This method combines microcell-mediated chromosome transfer technology with CRISPR / Cas9 chromosome knockout technology to successfully achieve the simultaneous removal of endogenous homologous chromosomes while transferring exogenous chromosomes, allowing the cells to maintain euploid characteristics after the operation, avoiding the effects of aneuploidy on cell proliferation, genome stability, protein homeostasis, metabolism, and osmotic balance, providing a more ideal cell model for subsequent research and the application of artificial chromosomes. When studying the function of specific genes in vivo or in vitro environments, traditional methods mainly use transgenic methods to integrate them into the cell or animal genome. This method is limited by the shortcomings of current transgenic technology, and the length of DNA inserted into the genome is often only in the kb range. As a result, the transferred fragment often does not contain complete gene regulatory elements, such as the gene's natural promoter or enhancer sequence, and thus cannot fully reflect the regulation and expression of the gene in the natural cellular environment. At the same time, whether the insertion of exogenous DNA will interfere with the expression of endogenous genes near the insertion site is also one of the potential drawbacks of this technology when applied. The chromosome replacement method of the present invention can achieve Mb-level DNA transfer without affecting the integrity of the endogenous genome in the cell. This provides the possibility of transferring the natural coding sequence and regulatory elements of the complete gene. At the same time, due to the knockout of the endogenous chromosomes of the recipient cell, when studying the expression of specific genes carried by the transferred chromosomes, the total copy number of the gene in the cell genome is consistent with the natural state, thereby avoiding the interference caused by the gene copy number on gene expression and regulation. Using tetraploid complementation technology, animal individuals with chromosome replacement are obtained at one time, avoiding the obstacles that may be encountered when traditional chimeric animals are used to obtain individuals carrying target chromosomes, such as the target chromosome carrying genes that affect gamete development or the inability of embryonic stem cells to achieve reproductive chimerism, thereby improving the efficiency and success rate of experimental operations; the method of the present invention, by combining CRISPR / Cas9, MMCT and tetraploid complementation technology, has demonstrated higher reliability and a wider range of applications in the field of chromosome replacement. It can not only be used for basic scientific research, but also provide new technical means and solutions for disease treatment, agricultural improvement and other fields.

[0018] The engineered chromosomes provided by the present invention are obtained based on the chromosome replacement method of CRISPR / Cas9, MMCT and tetraploid complementation, and have technical effects such as efficient and precise gene editing, flexible chromosome replacement, maintenance of euploid characteristics, preparation schemes for multiple animal models, and broad application prospects.

[0019] The cells provided by the present invention, which have been genetically modified by chromosome replacement, can be used to study the role of specific genes or chromosomes in cell function, metabolic pathways and disease occurrence, providing new perspectives and tools for the study of cell biology and genetics.

[0020] The application provided by the present invention integrates multiple biotechnological approaches to achieve efficient chromosome replacement, significantly shortening the experimental cycle and improving research efficiency compared to traditional methods. The combination of CRISPR / Cas9 gene editing technology and MMCT technology ensures the accuracy of chromosome replacement. The method of the present invention can precisely knock out endogenous homologous chromosomes and introduce target exogenous chromosomes, showing great application potential in the fields of regenerative medicine and synthetic biology.

[0021] Furthermore, the method of the present invention was used to successfully transfer Y chromosomes, which are mega-length chromosomes, demonstrating the potential of this method to operate large DNA fragments, laying the foundation for the future transfer of larger artificial chromosomes or other large DNA fragments; the replacement of chromosomes of the same species and heterospecies was successfully achieved, and embryonic stem cells and mouse individuals after chromosome replacement were obtained; the human Y chromosome was used to replace the endogenous Y chromosome of mice, and the instability of the human Y chromosome in mice was discovered, demonstrating the value of chromosome replacement technology in discovering scientific problems in future research on the application of heterospecies chromosomes. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 A schematic diagram of the operation flow of the chromosome replacement scheme of the present invention for introducing exogenous chromosomes without inducing aneuploidy; Figure 2 Preparation of the homologous Y chromosome donor cell line of the present invention; A shows the genomic DNA PCR results of nine DBA / 2 mouse embryonic stem cell clones, where Sry and Mecp2 are located on the Y chromosome and X chromosome, respectively; B shows representative results of DNA-FISH analysis of DBA / 2 mouse embryonic stem cell clones. Green: whole-chromosome probe for the mouse Y chromosome; red: whole-chromosome probe for the mouse X chromosome; blue: Hoechst-labeled DNA. Scale bar, 10 μm. C: Schematic diagram of the gene editing strategy for knocking in CAG-puro-GFP on the mouse Y chromosome. The positions of the primers designed for genomic PCR are indicated by triangles. D: genomic DNA PCR results of 18 embryonic stem cell clones selected after puromycin selection. E: puro element copy number in the genomes of the seven DBA-puro-GFP embryonic stem cell clones shown in D. F: morphology of the DBA-puro-GFP #11 embryonic stem cell line, which expresses GFP. Scale bar, 100 μm. Figure 3Preparation of the Y chromosome receptor cell line of the present invention, wherein A is Ssty2 , sgRNA targeting genes used for mouse Y chromosome knockout. B is the genomic DNA PCR results of 11 C57BL / 6 embryonic stem cell clones that underwent Y chromosome knockout. C is the representative DNA-FISH results of the male C57 embryonic stem cell clones and C57 XO embryonic stem cell clones shown in B. Green, whole chromosome probe for the mouse Y chromosome; red, whole chromosome probe for the mouse X chromosome; blue, Hoechst-labeled DNA. Scale bar, 10 μm. D is C57 XO #1 embryonic stem cell, which contains 39 chromosomes. Scale bar, 10 μm. E is WGS showing that the Y chromosome of C57 XO #1 embryonic stem cell has been eliminated. This cell line carries only a single copy of the X chromosome and lacks the Y chromosome. The vertical axis is chromosome copy number; the horizontal axis is chromosome number. Figure 4 To obtain euploid C57XY by Y chromosome replacement in mice D Embryonic stem cells, where A is CHO td Cell lines and CHO td Morphology of DBAGFP cell line, CHO td DBA GFP The cells contain both GFP markers derived from DBA-puro-GFP and tdTomato markers derived from CHOtd. Scale bar, 500 μm. B is C57 XO #1 and C57 XY D #1 Stem cell morphology. C57XYD #1 cells only contain the GFP marker derived from DBA-puro-GFP and lack CHO td tdTomato markers from the source, scale bar, 500 μm, C is C57 XY D #1 Representative DNA-FISH results of ESCs, green represents the whole chromosome probe of mouse Y chromosome; red represents the whole chromosome probe of mouse X chromosome; blue represents Hoechst-labeled DNA, scale bar, 10 μm; D shows the whole genome sequencing analysis confirming C57 XY D #1 There is a Y chromosome in the stem cell line. C57 XY is a male C57BL / 6 stem cell line. The vertical axis represents the chromosome copy number; the horizontal axis represents the chromosome number; E is C57 XY D Karyotype analysis of stem cell #1 shows that the cell contains 40 chromosomes. Scale bar, 10 μm; F is C57 XY D Comparison of transcriptomes between #1 stem cells and C57 XY stem cells, C57 XY, male C57BL / 6 stem cell line; Figure 5The present invention prepares living mice carrying the same Y chromosome, wherein A is a full-term C57 XY D Mouse pups, the upper part is a bright field photo; the lower part is a GFP signal photo; B is an adult C57 XY D Mice; C represents wild-type C57BL / 6 (n = 8), C57 XO (n = 6), and C57 XY D (n = 8) Growth curves of mice, ns indicates no significant difference; D shows that whole genome sequencing analysis confirmed the C57 XY D There is a mouse Y chromosome in mice. The vertical axis represents the chromosome copy number and the horizontal axis represents the chromosome number. E represents adult C57 XY D Mice exhibit male primary sexual characteristics. The image on the right shows the GFP signal, C57 XY mice, male C57BL / 6 mice; F shows C57 XO and C57 XY mice under different fluorescent labels. D Imaging results of mouse tissue samples; Figure 6 Figure 1 illustrates the preparation of a cross-species Y chromosome donor cell line. Figure A is a schematic diagram of the gene editing strategy for knocking in CAG-puro-GFP into the human Y chromosome. The positions of genomic PCR primers are indicated by triangles. Figure B shows the genomic DNA PCR results of seven embryonic stem cell clones selected after puromycin selection. Figure C shows the droplet digital PCR results of three H1-puro-GFP embryonic stem cell clones. Figure 7 The present invention obtains euploid C57 XY by human Y chromosome replacement H Embryonic stem cells, where A is A9 td Cell lines and A9 td H1 GFP Morphology of cell line, A9 td H1 GFP The cells contain both H1-puro-GFP derived GFP marker and A9 td tdTomato markers from the source, scale bar is 500 μm; B is C57 XO #1 and C57 XY H #3 Morphology of embryonic stem cells, C57XY H Cell #3 contains only GFP marker from H1-puro-GFP and lacks A9 td tdTomato markers from the source, scale bar, 500 μm; C is C57 XY H #3 and C57 XY H #5 Karyotype analysis of embryonic stem cells shows that the cells contain 40 chromosomes. Scale bar is 10 μm; D is C57 XY H #3 and C57 XYH #5 Representative DNA-FISH results of embryonic stem cells. Green represents the whole chromosome probe of human Y chromosome; red represents the whole chromosome probe of mouse X chromosome; blue represents Hoechst-labeled DNA. Scale bar, 10 μm. E represents WGS analysis confirming C57 XY H #3 and C57 XY H #5 Human Y chromosome exists in embryonic stem cells. The vertical axis is the chromosome copy number, and the horizontal axis is the chromosome number. F stands for C57 XY H #3 and C57 XY H #5 Comparison of transcriptomes between embryonic stem cells and male C57 embryonic stem cells (C57 XY); Figure 8 C57 XY H Neonatal mortality and growth defects, where A is a full-term C57 XY H Mouse pups, the upper part is a bright field photo; the lower part is a GFP signal photo, the red arrow indicates GFP-C57 XY H pups; B is C57 XY H #3 and C57 XY H #5 Distribution ratio of mice with different GFP expression patterns in newborn tetraploid compensated mice derived from embryonic stem cells. Mice were divided into three phenotypic groups according to GFP expression: GFP + (whole-body GFP expression, blue), chimeric GFP + (Some body regions express GFP, orange) and GFP - (GFP is not expressed in the whole body, gray); C is wild type C57BL / 6 (n = 8) and C57 XY H (n = 11) Weight of newborn pups, ns indicates no significant difference; D is the left figure 24 hours after birth. Newborn pups with little or no milk in the stomach were classified as the suckling disorder group, while newborn pups with visible milk in the stomach were classified as the normal suckling group. The right figure shows wild type C57BL / 6 (C57 WT; n = 20), C57 XY H GFP + (n = 99) and C57 XY H GFP - (n = 11) Percentage of newborn pups divided into three phenotypic groups: suckling disorder, normal suckling, and postnatal death; E represents male C57BL / 6 (C57 XY; n = 5), C57 XY H GFP + (n = 5) and C57 XY H GFP -(n = 5) Postnatal weight changes of three groups of tetraploid compensated mice. Weight measurements were taken from P7 to P15. Data are presented as mean ± standard error. ****p < 0.0001, Repeated Measures ANOVA; ns indicates no significant difference. F represents C57 XY H GFP + (n = 21) and C57 XY H GFP - Survival curve of mice (n = 7). Survival rate was monitored within 40 days. Log-rank test, p < 0.005. G represents P37 C57 XY H Representative images of mice, GFP + The size of the mouse is larger than its GFP - littermates (n = 4) were small. DETAILED DESCRIPTION

[0023] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.

[0024] The KSOM culture medium used in the present invention was purchased from Millipore, product number: MR-160-D.

[0025] The male DBA / 2 and C57BL / 6 embryonic stem cells used in the present invention are induced from DBA / 2 and C57BL / 6 mouse embryos, respectively; the DBA / 2 strain mice were purchased from Weitonglihua Company, item number: 214; the C57BL / 6 strain mice were purchased from Guangdong Medical Experimental Animal Center, item number: 03; H1 embryonic stem cells were purchased from the Cell Bank of the Chinese Academy of Sciences, item number: SCSP-306; the A9 cell line was purchased from the Cell Bank of the Chinese Academy of Sciences, item number: GNM12; and the CHO cell line was purchased from the Cell Bank of the Chinese Academy of Sciences, item number: SCSP-507.

[0026] The present invention has developed a solution to achieve chromosome replacement while maintaining cell euploidy. The specific implementation method is as follows: Example 1 This example provides a chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation to replace homologous chromosomes in mice.

[0027] See attached Figure 1Schematic diagram of the operational flow of a chromosome replacement protocol for introducing exogenous chromosomes without inducing aneuploidy, integrating CRISPR / Cas9-mediated chromosome elimination with microcell-mediated chromosome transfer. Published studies have shown that MACs constructed from native mouse chromosomes are highly stable in mouse adult tissues and hematopoietic cells. To systematically evaluate the impact of this replacement strategy on chromosome stability, the mouse Y chromosome (chrY) was selected as a validation model.

[0028] 1. Obtaining DBA-puro-GFP clones stably expressing GFP (1) Plasmid preparation First, the donor chrY was labeled, and a plasmid encoding Cas9 and a plasmid containing a CAG-puro-GFP element flanked by homologous arms (a plasmid containing a CAG promoter, a puromycin resistance gene (puro), and a green fluorescent protein gene (GFP); the target region was the region between the Uty and Ddx3y genes on the mouse Y chromosome (chrY: 1259028-1260324 GRCm39 / mm39mouse assembly). Arms homologous to the target region were added to both sides of the GFP gene, and a sgRNA targeting the target region was designed and synthesized. The sgRNA sequence was: agactagagaggctcaattc (as shown in SEIQ NO.1).

[0029] (2) Cell transfection Male DBA / 2 embryonic stem cells were cultured to ensure that the cells were in a good growth state; Cas9 plasmid, CAG-puro-GFP element plasmid and sgRNA were co-transfected into male DBA / 2 embryonic stem cells (ESCs) ( Figure 2 AC).

[0030] (3) Screening and identification After transfection, puromycin was added to the cell culture medium to kill untransfected or unsuccessfully transfected cells, and surviving cell clones were collected. After puromycin selection, genomic DNA of the screened cell clones was extracted and genomic PCR amplification was performed to detect whether the CAG-puro-GFP element was successfully knocked into the expected site. Electrophoresis analysis of the PCR products showed that 7 out of 18 clones (38.9%) successfully achieved site-specific knock-in ( Figure 2 D).

[0031] Droplet digital PCR (ddPCR) verification analysis was performed on clones initially identified as successfully knocked in. Droplet digital PCR (ddPCR) further confirmed that clones #9, #11, #15, and #17 achieved single-copy integration at the intended knock-in site, with no off-target recombination events ( Figure 2 E).

[0032] (4) GFP expression detection The screened cell clones were placed under a fluorescence microscope to observe whether the cells stably expressed GFP. These clones, named DBA-puro-GFP, all stably expressed GFP ( Figure 2 F) Demonstrates successful site-directed knock-in of the CAG-puro-GFP element in male DBA / 2 embryonic stem cells, resulting in the generation of DBA-puro-GFP clones stably expressing GFP.

[0033] 2. Obtaining a low-passage chrY recipient cell line (1) Materials Cas9 mRNA, and two sgRNAs targeting the Ssty2 gene on the long arm of mouse chromosome Y were designed and synthesized. The sgRNA sequences were Catcactcaagaagaagagt (as shown in SEIQ NO.2) and aggagctccacagcgatgag (as shown in SEIQ NO.3). Fertilized eggs of C57BL / 6 mice were obtained. Ssty2 has more than 30 repeat sequences on the long arm of chrY, and sgRNA sequences with high specificity were selected to reduce off-target effects.

[0034] (2) Fertilized egg injection Cas9 mRNA and two sgRNAs targeting the Ssty2 gene on the long arm of the Y chromosome were injected into C57BL / 6 fertilized eggs using microinjection ( Figure 3 A).

[0035] (3) In vitro culture and induction The injected fertilized eggs were placed in KSOM medium for in vitro culture at 37°C, 5% CO2, and the development of the fertilized eggs was monitored. The eggs were cultured in vitro until the blastocyst stage.

[0036] (4) Establishment of mouse embryonic stem cell clones After in vitro culture and further induction, the inner cell mass was isolated from the well-developed embryos and cultured in a culture medium suitable for the growth of embryonic stem cells. Cell growth was monitored, the culture medium was replaced in a timely manner, and the cells were passaged. Mouse embryonic stem cell clones were established through single-cell cloning, and 11 mouse embryonic stem cell (mESC) clones were successfully established using microinjected embryos.

[0037] (5) Screening for chrY-deficient clones The genomic DNA of each clone was extracted and PCR amplified using specific primers to detect the presence of the Ssty2 gene or Y chromosome. Fluorescence in situ hybridization (FISH) was used to directly observe the presence of the Y chromosome in the cells. Based on the PCR or FISH results, clones lacking mouse chrY were screened. Among them, three clones lacked mouse chrY ( Figure 3 B and 3C).

[0038] (6) Karyotype analysis and nomenclature Karyotype analysis was performed on the selected chrY-deficient clones to determine their chromosome number and morphology. Chromosome banding or high-resolution imaging techniques were used to observe and record the characteristics of the chromosomes. These chrY-deficient clones were named C57 XO. The karyotype information of each clone, including the number and morphology of autosomes and sex chromosomes, was recorded. Based on the data and results obtained in the experiment, including the number of successfully established mESC clones and the number and proportion of chrY-deficient clones, the karyotype of the C57 XO clones was compared with that of wild-type C57BL / 6 mESCs. Its karyotype only contained 38 autosomes and one X chromosome ( Figure 3 D and 3E), whereas wild-type C57BL / 6 mESCs contain 40 chromosomes, confirming that C57 XO clones indeed lack a Y chromosome.

[0039] 3.C57 XY D mESCs cloning (1) Construction of hybrid cells (CHO td DBA GFP ) Prepare DBA-puro-GFP #11 ESCs and CHO cells stably expressing tdTomato (CHO td ).

[0040] DBA-puro-GFP #11 ESCs were fused with CHO cells stably expressing tdTomato (CHO td ) fusion ( Figure 4A) After fusion, cells were cultured in Ham's F-12 medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco) to promote the formation of hybrid cells.

[0041] Hybrid cells expressing both green fluorescent protein GFP and tdTomato were screened by flow cytometry, and hybrid cells (CHO td DBA GFP ).

[0042] (2) Microcell-mediated chromosome transfer Minicell preparation: from CHO td DBA GFP Minicells containing chrY from DBA-puro-GFP#11 ESCs were prepared from hybrid cells.

[0043] Fusion of microcells with C57 XO mESCs: Using MMCT technology, CHO td DBA GFP The derived microcells were fused with C57 XOmESCs, and after fusion, the cells were cultured under mouse embryonic stem cell culture conditions.

[0044] Puromycin was added to the culture medium of the fused cells to kill the unfused or unsuccessfully fused cells. After puromycin selection, GFP-positive mESC clones were screened by fluorescence microscopy and cultured at 1 × 10 -6 These clones were obtained at a frequency of 1.5 and named C57 XY D ( Figure 4 B).

[0045] C57 XY D Fluorescence in situ hybridization (FISH) analysis of mESCs was performed using a specific probe for chrY to observe and record the presence of chrY in the cells, confirming that chrY had been successfully transferred into C57 XO mESCs. D Whole genome sequencing of mESCs was performed to analyze the presence and integrity of chrY sequences in the genome. The accuracy and integrity of chrY sequences were confirmed by comparison with the reference genome. FISH and whole genome sequencing (WGS) analysis confirmed that in C57 XY D The presence of chrY sequences in mESCs indicated that mouse chrY transfer was successfully achieved via MMCT ( Figure 4 C and 4D). For C57 XY DChromosome number analysis of mESCs was performed using chromosome banding or high-resolution imaging techniques to observe and record the number and morphology of chromosomes. D mESCs carry 40 chromosomes ( Figure 4 D and 4E), showing that only chrY was specifically transferred and no aneuploidy was induced.

[0046] RNA sequencing analysis showed that C57 XY D The transcriptome of mESCs is highly similar to that of male C57BL / 6 mESCs (C57XY and C57 XY D The Pearson correlation coefficient for #1 is 0.99)( Figure 4 F). These results indicate that chromosome ablation combined with MMCT technology can be used to achieve intraspecific Y chromosome replacement despite DNA damage in the transferred chrY.

[0047] To test C57 XY D Can mESCs be used to generate chrY-substituted mice? D #1 mESCs were injected into tetraploid B6D2F1 blastocysts. 28 surviving pups expressing GFP were successfully obtained ( Figure 5 A; Table 1), thus demonstrating that C57XY D mESCs have full developmental potential. Subsequently, we compared C57XO mice generated by tetraploid complementation of C57XO mESCs, wild-type C57BL / 6 mice, and C57XY D The effects of chrY transfer on individual development were systematically evaluated in mice. The results showed that all young mice showed normal growth and development curves until adulthood ( Figure 5 B and 5C). WGS further confirmed C57XY D Young mice carry mouse chrY ( Figure 5 D), and all C57 XY D All mice were male ( Figure 5 E). In addition, when the mouse embryo develops to day 12.5 (E12.5), in C57 XY D Primordial germ cells (PGCs) were detected in the genital ridges of mouse embryos ( Figure 5 F), indicating that the Sry gene is expressed in C57 XY D It is normally expressed and has biological functions in mice.

[0048] Table 1: Tetraploid blastocyst complementation experiment

[0049] Based on the above findings, the stability of mouse chrY was not affected after chromosome replacement, which shows that chromosome replacement technology can be used to study cross-species chromosome transfer.

[0050] Example 2 In this example, based on Example 1, to explore the feasibility of cross-species chromosome replacement, the human Y chromosome of H1 embryonic stem cells was selected as the research object. By precisely integrating the CAG-puro-GFP reporter gene into the intergenic region between DDX3Y and UTY, three H1 ESC clones (hereinafter referred to as H1-puro-GFP, Figure 6 ). H1-puro-GFP#1 ESCs were crossed with A9 expressing tdTomato td After cell fusion, A9 cells were obtained, which can be used to prepare the minicells required in the MMCT process. td H1 GFP Cell lines ( Figure 7 A).

[0051] Recipient C57 XO mESCs were transplanted with A9 td H1 GFP After the prepared microcells were fused, 29 GFP-positive cell lines were obtained by puromycin selection (efficiency was 1-3×10 -6 ; Figure 7 B). Karyotype analysis showed that 14 clones (48.3%) contained 40 chromosomes ( Figure 7 C), 15 clones (51.7%) contained more than 40 chromosomes (most contained approximately 80 chromosomes), suggesting that the latter may have originated from the fusion of two recipient cells during MMCT. FISH showed that in all 14 mESC lines containing 40 chromosomes, human chrY existed as an independent chromosome (hereafter referred to as C57 XY H mESCs; Figure 7 D).

[0052] WGS analysis showed that C57 XY H Both mESCs #3 and #5 carried the human Y chromosome, and the copy numbers of other endogenous chromosomes were normal ( Figure 7 E). Transcriptome RNA sequencing results showed that C57 XY H The transcriptomes of mESCs and male C57BL / 6 (C57 XY) mESCs are highly correlated (C57 XY and C57 XY H #3: Pearson r = 0.97; C57 XY vs. C57 XY H #5: Pearson r=0.98; Figure 7 F).

[0053] The above experimental results show that chromosome replacement technology can replace the endogenous mouse Y chromosome with the human Y chromosome in mouse embryonic stem cells.

[0054] Tetraploid B6D2F1 blastocysts were prepared: 8-week-old superovulated B6D2F1 females were mated with 2- to 6-month-old B6D2F1 males. Fertilized eggs were collected 22-24 hours after hCG injection. After 24 hours of culture in KSOM, two-cell-stage E1.5 embryos were picked and placed in a microdroplet of 0.3 M mannitol (supplemented with 0.3% bovine serum albumin, Sigma-Aldrich). Fusion was performed using an Electro Cell Fusion CFB16-HB electrofusion instrument (BEX Ltd., Japan) equipped with a 0.1 cm microfusion chamber (BTX 450-1). First, a 15 V AC current was applied for 15 seconds to adjust the two-cell embryo to the optimal fusion position (cleavage plane parallel to the electrodes). Subsequently, a DC fusion pulse (100 V, 40 μs interval, two pulses) was applied. Immediately after the pulse treatment, the embryos were washed twice with KSOM and incubated at 37°C, 5% CO2 for 1 hour. Finally, the fused embryos were washed 6-8 times with KSOM medium and transferred to a 37°C, 5% CO2 incubator for further culture.

[0055] To verify C57 XY H Are mESCs suitable for Y chromosome replacement experiments in mice? H mESCs were injected into tetraploid B6D2F1 blastocysts, and 122 pups were obtained ( Figure 8 A; Table 1). This result indicates that the presence of human chrY does not impair the pluripotency of mESCs. However, compared with C57 XY D Different mice, C57 XY H GFP expression in newborn mice showed significant heterogeneity: some pups showed GFP-negative or mosaic expression patterns ( Figure 8 A, 8B; Table 1). Specifically, in C57 XY H Among pups #3, 87.5% (98 / 112) were GFP positive, 7.1% (8 / 112) were GFP negative, and 5.4% (6 / 112) were mosaic. H Among mice derived from #5, 60% (6 / 10) were GFP negative, only 10% (1 / 10) were positive, and 30% (3 / 10) showed chimeric expression ( Figure 8 B; Table 1).

[0056] C57 XY H GFP+ Mice exhibit severe neonatal mortality and developmental delay. H There was no statistically significant difference in body weight between pups (n=11) and wild-type C57BL / 6 (n=8) (1.55±0.33g vs 1.43±0.14g, p=0.3530; Figure 8 C). However, phenotypic analysis showed significant developmental abnormalities. H GFP + Among the individuals, 39.3% (39 cases) died immediately after birth due to severe malformations such as respiratory distress and omphalocele, while all C57 XY H GFP - and wild-type pups were within normal ranges in terms of respiratory, motor, and developmental parameters ( Figure 8 D). Targeting surviving pups (GFP + 60 / 99; GFP - 11 / 11; wild type 20 / 20) showed that GFP + In the group of mice raised under normal nursing conditions, 39.3% (39 / 99) of the mice died within 48 hours due to dehydration. Autopsy showed no milk residue in their stomachs, indicating that the pups had difficulty sucking milk. - In the wild type group, 36.3% (4 / 11) of the individuals also experienced similar situations. In contrast, all (20 / 20) of the wild type group completed normal suckling, and the GFP + and GFP - The normal sucking rates of the two groups were 21.2% (21 / 99) and 63.6% (7 / 11) ( Figure 8 D).

[0057] Long-term developmental monitoring further revealed phenotypic differences: at postnatal day 7-15 (P7-P15), C57 XY H GFP + The body weight and weight growth rate of mice were significantly lower than those of the control group during the same period, while GFP - Although the body weight of the individuals was slightly lower than that of the wild type, their growth rate was basically the same as that of the control group ( Figure 8 E). Survival analysis showed that GFP - The survival rate of the group was significantly better than that of the GFP group + Group( Figure 8 F). Only one C57 XY H GFP + The mice survived until P37, and their body weight was only 4.9 g, which was significantly lower than that of their littermates GFP - The average weight of the pups was 17.67 g (n=4) ( Figure 8G). The above results indicate that human chrY seriously affects the growth and development of mice, C57 XY H GFP + Mice exhibit severe neonatal mortality and developmental delay.

[0058] In summary, the chromosome replacement method developed by the present invention can successfully achieve the replacement of homologous or heterologous chromosomes in cells and animals, while maintaining the euploidy of the replaced chromosome karyotype. This method also revealed that the human Y chromosome cannot be stably present in mice, further demonstrating the potential application of this approach.

[0059] The above content is only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. A chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation, characterized in that: include: Step 1: Using microcell-mediated chromosome transfer and the CRISPR / Cas9 gene editing system, the donor chromosome is introduced into the recipient cell and the endogenous chromosome of the recipient cell is knocked out; Step 2: Evaluate the euploidy of the recipient cells whose endogenous homologous chromosomes have been knocked out to confirm whether the cells maintain a euploid state. If the recipient cells do not maintain euploidy, return to step 1 and adjust the microcell-mediated transfer conditions to regain euploidy. Step 3: Using recipient cells with euploid characteristics, obtain an animal model after chromosome replacement.

2. The chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation according to claim 1, characterized in that The donor chromosome and the endogenous chromosome of the recipient cell are non-homologous heterologous chromosomes, or partially homologous homologous chromosomes.

3. The chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation according to claim 1, characterized in that: In step 1, the target exogenous chromosome is first introduced into the recipient cell through microcell-mediated chromosome transfer, and then the endogenous homologous chromosome in the recipient cell is knocked out using the CRISPR / Cas9 gene editing system.

4. The chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation according to claim 1, characterized in that In step 1, the CRISPR / Cas9 gene editing system is first used to knock out the endogenous chromosomes in the recipient cells, and then the labeled target exogenous chromosomes are transferred to the recipient cells with knocked-out endogenous chromosomes through microcell-mediated chromosome transfer.

5. The chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation according to claim 1, characterized in that: In step 3, an animal model after chromosome replacement is obtained by injecting or culturing recipient cells with euploid characteristics in vitro.

6. The chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation according to claim 5, characterized in that: The animal model after chromosome replacement obtained by injection specifically includes: microinjecting recipient cells with euploid characteristics into the tetraploid blastocyst cavity to obtain the injected tetraploid blastocyst; transplanting the injected tetraploid blastocyst into the body of a pseudopregnant animal of the same period, and after the pseudopregnant animal develops, obtaining the animal model after chromosome replacement.

7. The chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation according to claim 5, characterized in that: The animal model after chromosome replacement obtained by in vitro culture specifically includes: mixing recipient cells with euploid characteristics with tetraploid four-cell stage embryos with the zona pellucida removed in vitro to form blastocysts; transplanting the blastocysts into pseudopregnant animals of the same period, and obtaining the animal model after chromosome replacement after the blastocysts develop.

8. An engineered chromosome, characterized in that Obtained by the chromosome replacement method based on CRISPR / Cas9, MMCT and tetraploid complementation according to any one of claims 1 to 7.

9. A cell, characterized in that The cell comprises the engineered chromosome of claim 8.

10. Use of the engineered chromosome according to claim 9 or the cell according to claim 10 in preparing a chromosome replacement animal model, improving animal and plant traits, or producing pharmaceutical proteins.

Images