Application of CUL1 gene in preparation of kit for diagnosing microhead malformation and congenital intellectual development retardation
By constructing a CUL1 knockout zebrafish model, using CRISPR-Cas9 technology, the association between CUL1 gene mutations and microcephaly and congenital intellectual developmental retardation was solved, providing a basis for diagnosis and treatment, and achieving molecular detection and drug screening of neurodevelopmental abnormalities.
Patent Information
- Application Number
- CN202510410793.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-02
- Publication Date
- 2025-08-15
AI Technical Summary
The association between CUL1 gene mutations and microcephaly and congenital intellectual developmental retardation has not been clarified in the prior art, and there is a lack of effective diagnostic and treatment methods.
By constructing a CUL1 knockout zebrafish model, using CRISPR-Cas9 technology to knock out the CUL1 gene of zebrafish, simulate human disease mechanisms, observe neurodevelopmental abnormalities, and develop kits for diagnosing and screening therapeutic drugs.
It provides genotype-phenotype correlation evidence of CUL1 gene and microcephaly and congenital intellectual developmental retardation, establishes a molecular detection process for neurodevelopment abnormalities, lays the foundation for the development of targeted therapeutic drugs, and the constructed zebrafish model can be used to screen effective drugs.
Smart Images

Figure CN120485348A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of a CUL1 gene in preparing a kit for diagnosing microcephaly and congenital mental retardation. Background Art
[0002] Microcephaly is a neurodevelopmental disorder (NDD) characterized by a significantly reduced head circumference, reflecting impaired brain growth and development. This condition exhibits significant clinical heterogeneity, with patients often experiencing a range of neurological and developmental abnormalities. The core characteristic of microcephaly is a smaller-than-average brain size, often accompanied by intellectual disability (ID), developmental delay, movement disorders, and, in some cases, seizures. Additionally, patients with microcephaly may exhibit varying degrees of psychiatric symptoms and challenges with adaptive functioning. Rare inherited and de novo genetic mutations are the primary contributors to the etiology of microcephaly, disrupting key pathways involved in neuronal proliferation, differentiation, and survival (see Zaqout, S., Kaindl, AM, 2022. Autosomal Recessive Primary Microcephaly: Not Just a Small Brain. Front. Cell Dev. Biol. 9. https: / / doi.org / 10.3389 / fcell.2021.784700). To date, numerous genes associated with microcephaly have been identified, highlighting the genetic complexity of the disorder. Understanding the genetic and molecular mechanisms of microcephaly is crucial for elucidating its pathogenesis and developing targeted therapeutic interventions.
[0003] The SCF (Skp1-Cul1-F-box protein) ubiquitin ligase complex is a highly conserved multiprotein complex that plays a central role in the ubiquitin-proteasome system, a key pathway regulating protein degradation, cell cycle progression, and signal transduction. The SCF complex is composed of three core components: Skp1, Cul1 (Cullin-1), and an F-box protein that determines substrate specificity. In the nervous system, the SCF complex is crucial for neural development by regulating the turnover of proteins involved in neuronal differentiation, synaptic plasticity, and cell survival. Dysregulation of the SCF complex is associated with a variety of neurological diseases, particularly those affecting neurodevelopment. For example, variants in genes encoding F-box proteins, such as FBXO28 (see Sano, K., Miya, F., Kato, M., Omata, T., Takanashi, J.-I., 2023. Neurochemistry evaluated by magnetic resonance spectroscopy in a patient with FBXO28-related developmental and epileptic encephalopathy. Brain Dev 45, 583–587. https: / / doi.org / 10.1016 / j.braindev.2023.07.003) and FBXW11 (see Holt, RJ, Young, RM, Crespo, B., Ceroni, F., Curry, CJ, Bellacchio, E., Bax, DA, Ciolfi, A., Simon, M., Fagerberg, CR, van Binsbergen, E., De Luca,A.,Memo,L.,Dobyns,WB,Mohammed,AA,Clokie,SJH,Zazo Seco,C.,Jiang,Y.-H., KP, Andersen, H., Sullivan, J., Powis, Z., Chassevent, A., Smith-Hicks, C., Petrovski, S., Antoniadi, T., Shashi, V., Gelb, BD, Wilson, SW, Gerrelli, D., Tartaglia, M., Chassaing, N., Calvas, P., Ragge, NK, 2019. De Novo Missense Variants in FBXW11 Cause Diverse Developmental Phenotypes Including Brain, Eye, and Digit Anomalies. Am J HumGenet 105, 640–657. https: / / doi.org / 10.1016 / j.ajhg.2019.07.005) have been found to be associated with intellectual disability and other neurodevelopmental abnormalities. Cullin-1 is a scaffolding protein in the SCF complex and is essential for its structural integrity and function. Despite its central role, no mutations in the CUL1 gene have been reported to cause human disease. Summary of the Invention
[0004] To solve the technical problems existing in the prior art, the present invention provides an embodiment of the invention for the use of the CUL1 gene in the preparation of a kit for diagnosing microcephaly and congenital mental retardation. The technical solution is as follows:
[0005] Application of CUL1 gene in the preparation of a kit for diagnosing microcephaly and congenital mental retardation.
[0006] Use of a reagent for detecting CUL1 gene mutation in the preparation of a kit for diagnosing microcephaly and congenital mental retardation.
[0007] Optionally, the reagent for detecting a mutation in the CUL1 gene includes a reagent for performing whole-exome sequencing on the CUL1 gene.
[0008] Application of sgRNA for knocking out the CUL1 gene in the method of constructing an animal model of microcephaly and congenital mental retardation.
[0009] Optionally, the nucleotide sequence of the sgRNA is selected from at least one of SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, and SEQ ID No.10; and / or
[0010] The animal model is a zebrafish model.
[0011] A sgRNA for knocking out the CUL1 gene, wherein the nucleotide sequence of the sgRNA is selected from at least one of SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, and SEQ ID No. 10.
[0012] A method for constructing an animal model of microcephaly and congenital mental retardation, wherein the animal model is a zebrafish model, and the method comprises:
[0013] 1) synthesizing sgRNA for knocking out the CUL1 gene, wherein the nucleotide sequences of the sgRNAs are SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, and SEQ ID No. 10, respectively;
[0014] 2) preparing a CRISPR complex, wherein the Cas9 protein and the four sgRNAs prepared in step 1) are mixed to obtain the CRISPR complex;
[0015] 3) microinjecting the CRISPR complex prepared in step 2) into zebrafish embryos and culturing larvae to obtain the animal model of microcephaly and congenital mental retardation.
[0016] Application of the animal model of microcephaly and congenital mental retardation constructed according to the method in screening drugs for treating microcephaly and congenital mental retardation.
[0017] The beneficial effects brought about by the technical solution provided by the embodiment of the present invention include at least:
[0018] In this study, the inventors report that three patients with neurodevelopmental abnormalities (including microcephaly and intellectual disability) harbor heterozygous mutations in the CUL1 gene. To further validate the effects of CUL1 loss of function, the inventors developed a cul1a&b knockout (KD) zebrafish model. These KD zebrafish exhibited significantly reduced central nervous system (CNS) areas. These phenotypes were highly similar to the clinical features observed in patients, providing strong evidence for the functional role of CUL1 in brain development. This study establishes, for the first time, a detailed genotype-phenotype correlation for CUL1 in NDDs, identifying CUL1 as a novel causative gene for severe neurodevelopmental disorders. This serves as a foundation for establishing molecular detection protocols for genes associated with neurodevelopmental abnormalities and a prerequisite for developing targeted therapeutic drugs. Furthermore, the zebrafish model constructed in this study can also be used to screen for drugs to treat microcephaly and congenital intellectual disability caused by CUL1 gene mutations. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.
[0020] Figures 1A to 1D The diagram is a diagram of the CUL1 gene variation family diagram, sequencing chromatogram and conservation analysis provided in Example 1 of the present invention; wherein, Figure 1A The pedigrees and CUL1 gene sequencing chromatograms of the two families in Example 1 are shown, where squares represent males, circles represent females, black symbols represent affected individuals, and arrows indicate probands; Figure 1B is a schematic diagram of the distribution of the three mutations in Example 1 on the Cullin-1 protein; Figure 1C This is a diagram of the spatial conformation of Cullin-1 protein. The enlarged view shows the difference between the 450th amino acid residue in the wild type (right) and the mutant (bottom). Residue distribution within the radius: wheat-colored sticks mark residue 450, smoke-colored sticks mark Residues within the radius, yellow dashed lines indicate hydrogen bonds; Figure 1D This is a diagram showing the conservation analysis of amino acid residue 450 in Cullin-1 proteins across species;
[0021] Figures 2A to 2L This is a diagram showing that knockout of the zebrafish cul1a and cul1b genes leads to abnormal embryonic development and neural developmental defects, as provided in Example 2 of the present invention; wherein, Figure 2A Representative bright field images (dorsal view) of zebrafish larvae at 5 days post-fertilization (dpf), including the upper panel: cas9-injected control group, the lower panel: cul1a & b double-knockout group, the red line indicates the interocular distance and body length, scale bar: 500 μm; Figures 2B to 2C Graph showing the results of interocular distance (p = 0.4424, unpaired t-test) and body length (p < 0.0001) measurements in the cas9 control group (n = 38) and the cul1a & b double knockout group (n = 42) (data were normalized to the mean of the control group); Figure 2D Representative images (dorsal view) of the central nervous system (CNS) morphology of Tg(HuC:eGFP) transgenic zebrafish larvae at 5 dpf, including left: cas9 control group; right: cul1a&b double knockout group. The white dotted boxes indicate the measured CNS regions (forebrain, midbrain, and hindbrain from top to bottom). Scale bar: 200 μm. Figures 2E to 2HFigure 2 shows the normalized total CNS area (p<0.0001) and the area of each subregion (forebrain p=0.0017, midbrain p=0.0004, hindbrain p=0.0010, unpaired t-test) of the cas9 control group (n=38) and the cul1a&b double knockout group (n=34); Figures 2I to 2J are graphs showing the movement trajectories of spontaneous swimming activity (I) and light-dark response (J) (gray blocks indicate dark conditions), including the cas9 control group (n=40) and the cul1a&b double knockout group (n=26); Figure 2K is a graph quantifying the total distance moved (p = 0.0047) and maximum speed (p = 0.0088) during 15 minutes of spontaneous swimming activity; Figure 2L Graphs quantify the mean total distance moved (dark / light conditions, p < 0.0001) and maximum velocity (dark p = 0.0002 / light p = 0.0001) under alternating light and dark stimulation. Note: Error bars in trajectory graphs represent standard error of magnitude (SEM), while error bars in quantitative graphs represent standard deviation. Statistical significance is indicated by **p < 0.01 and ***p < 0.001. DETAILED DESCRIPTION
[0022] The technical solution of the present invention is described below in conjunction with the accompanying drawings.
[0023] Currently, there is no direct evidence that CUL1 gene mutations can cause human disease. Microcephaly and congenital intellectual disability are neurodevelopmental disorders that can be caused by mutations in multiple genes, but the causative genes remain largely unidentified. This study aims to identify a novel neurodevelopmental disorder-causing gene, CUL1, to link CUL1 gene mutations with microcephaly and congenital intellectual disability.
[0024] The CUL1 gene consists of 22 exons and encodes a 776-amino acid protein containing a Cullin homology domain at its carboxyl (C) terminus. Cullin-1 is a molecular scaffold that connects two key biochemical functions of SCF E3 ligases: its C-terminal region recruits the small RING protein RBX1 to facilitate interaction with the E2 ubiquitin-conjugating enzyme, while its N-terminal region binds SKP1 and a variable F-box protein.
[0025] The present inventors further studied the functional impact of CUL1 loss using a zebrafish model. The advantages of using a zebrafish model are:
[0026] (1) Gene homology: The zebrafish CUL1 gene has over 93% homology with the human CUL1 gene, and its core functions are highly conserved, which can mimic the human disease mechanism;
[0027] (2) Neural developmental similarity: The brain structure of zebrafish embryos (such as the telencephalon and cerebellum) is highly similar to human early neural development;
[0028] (3) Zebrafish embryos are transparent, allowing direct observation of brain developmental defects, and phenotypes such as microcephaly are easy to observe;
[0029] (4) Gene editing is convenient and significantly shortens the research cycle.
[0030] Experimental results showed that knockout of cul1a & b in zebrafish resulted in a significant reduction in the size of the central nervous system, including the forebrain, midbrain, and hindbrain. These phenotypes closely resemble the clinical features observed in patients by the inventors, providing strong evidence for the pathogenicity of CUL1 mutations.
[0031] Example 1
[0032] 1. Study Cohort and Exome Sequencing
[0033] Genomic DNA was isolated from peripheral blood samples using a genomic DNA extraction kit (Aidlab). Whole-exome sequencing (WES) was performed on the patient and her parents using the Illumina HiSeq6000 platform (San Diego, CA, USA) at an average sequencing depth of 100x. Raw sequencing data were processed using Berry Genomics' proprietary VeritaTrekker variant detection system and annotated against the human reference genome hg19 (GRCh37) using the Enliven variant annotation and interpretation system. Variants were screened using stringent quality control criteria, including a minimum read depth of 10, an allelic balance threshold of 0.25, and a Phred quality score of 20 or higher.
[0034] 1.1 Extraction of genomic DNA from venous blood and preparation of mother solution
[0035] Inclusion criteria: Patients diagnosed with congenital intellectual disability (IDD) according to the expert consensus on the etiological diagnostic strategy for intellectual disability or global developmental delay in children were recruited. After obtaining informed consent from the patient's guardian, detailed clinical data were registered, a pedigree chart was drawn, and test and examination results were recorded.
[0036] From 1277 patients who met the inclusion criteria and their blood-related family members, after obtaining informed consent, 10 ml of peripheral venous blood was drawn into EDTAK2 anticoagulant tubes (purple-top tubes) in accordance with the WS / T661-2020 venous blood specimen collection guidelines. After gently mixing, the blood was stored in a refrigerator at 4°C. Within 72 hours, genomic DNA (gDNA) was isolated from the peripheral blood samples using a genomic DNA extraction kit (Aidlab) to obtain gDNA stock solution.
[0037] 1.2 Genomic DNA (gDNA) quality testing and preparation of working solution
[0038] (1) Switch the UV spectrophotometer to double-stranded DNA mode, take 1 μl of 1xTE solution to clean the probe, wipe off the residual liquid with a dust-free paper, and then take 1 μl of 1xTE solution to zero;
[0039] (2) After wiping off all the liquid, take 1 μl of the gDNA stock solution and test it. Record its concentration (ng / μl) and DNA purity (OD260 / OD280). If the OD260 / OD280 ratio is greater than 1.8, the DNA purity is qualified; if the measured DNA concentration is greater than 50 ng / μl, the DNA concentration is qualified.
[0040] (3) According to the gDNA concentration, take appropriate amount of mother solution and 1xTE solution to prepare 100 μl of working solution with a concentration of 50 ng / μl. Detect whether DNA degradation is present by agarose gel electrophoresis.
[0041] 1.3 Whole-exome sequencing
[0042] (1) Quality control
[0043] Agarose gel electrophoresis was used to examine DNA degradation and the presence of contaminating bands, RNA, and proteins. Qubit 3.0 was used to accurately quantify DNA concentration. Samples with a DNA concentration ≥20 ng / μL and a total volume of 0.4 μg or more were selected for library construction. Samples that did not meet the criteria were resubmitted.
[0044] (2) Database construction
[0045] The Agilent SureSelect Human All Exon V6 Kit (Agilent) was used for library construction and capture. gDNA was randomly fragmented into 180-280 bp fragments using a Covaris fragmentor. Following end-repair and A-tailing, adapters were ligated to the fragments to prepare a DNA library. Specifically labeled fragments were hybridized with biotinylated probes in liquid phase, and exon sequences were captured using streptavidin-labeled magnetic beads. For detailed procedures, please refer to the instructions for the Agilent SureSelect Human All Exon V6 Kit (Agilent).
[0046] (3) Sequencing
[0047] Samples that passed quality control were sequenced using the Illumina HiSeq6000 platform at an average sequencing depth of 100. The resulting raw data were filtered, quality checked using FastQC, and low-quality bases (Q < 20), adapters, and short reads (< 50 bp) were removed using Fastp. The data were aligned using BWA-MEM with the hg19 reference genome. Sorting and deduplication were then performed using samtools with default parameters. During the quality control phase, Qualimap and Picard were used to assess alignment rate (≥ 90%), duplication rate (< 20%), and coverage uniformity to ensure data reliability.
[0048] The Enliven variant annotation and interpretation system was used for annotation. Variants were screened using stringent quality control criteria, including a minimum read depth of 10 and an allelic balance threshold of 0.25.
[0049] 2. Bioinformatics Analysis
[0050] The obtained gene variants were analyzed under dominant and recessive inheritance modes.
[0051] (1) Screening of candidate pathogenic genes for dominant inheritance patterns
[0052] Select all variants that meet the following criteria:
[0053] 1) Variant sites with a frequency lower than 0.001 in 1000Genomes, esp6500s, GnomAD, ExAC, and in-house databases;
[0054] 2) Meet any of the following conditions:
[0055] a. Loss-of-function variants, including loss of stop codons, gain of stop codons, frameshift mutations, and splice site variants;
[0056] b. Missense mutation function prediction software predicts it as a deleterious mutation.
[0057] (2) Screening of candidate pathogenic genes for recessive inheritance patterns
[0058] 1) Variant sites with a frequency lower than 0.01 in 1000Genomes, esp6500s, GnomAD, ExAC and in-house databases;
[0059] 2) Meet any of the following conditions:
[0060] a. Loss-of-function variants, including loss of stop codons, gain of stop codons, frameshift mutations, and splice site variants;
[0061] b. Missense mutation function prediction software predicts it as a deleterious mutation.
[0062] (3) Candidate variants were verified by Sanger sequencing of the subjects and their biological parents
[0063] Primer design: Primers were designed using primer3plus (https: / / www.primer3plus.com) for the detected CUL1 gene variants. The detected variants and their corresponding sequencing primers are as follows:
[0064] NM_003592:c.817C>T
[0065] Forward Primer:AATCCTCCTGCTTCAGCCAC(SEQ ID No.1);
[0066] Reverse Primer:GCAGAAGTCTGAAATTGGCACA(SEQ ID No. 2);
[0067] NM_003592:c.1348A>T
[0068] Forward Primer:ACTCAGTCAGTCCAACTCACTG(SEQ ID No.3);
[0069] Reverse Primer:ACCATGCCCGGCTAATGTTT(SEQ ID No.4);
[0070] NM_003592:c.1819C>T
[0071] Forward Primer:GTTGCATTGTAGTGGCATTGC(SEQ ID No.5);
[0072] Reverse Primer:ACATGAAGCTTTTTGTAGTGCGT (SEQ ID No. 6).
[0073] PCR amplification: PCR amplification was performed using TSINGKE TSE004 2×TSINGKE Master Mix (blue) in a 25 μL system. The PCR reaction program was as follows: a pre-denaturation step at 95°C for 5 minutes to ensure complete denaturation of the template DNA; 30 cycles of amplification were performed, each cycle consisting of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds; a final extension at 72°C for 5 minutes was performed after the cycle to ensure product integrity; and the reaction product was stored at 4°C until removal.
[0074] Purification and Recovery: First, prepare a 2% agarose gel at an appropriate concentration and load the PCR product along with a DNA marker for electrophoresis (100V, 20-30 minutes). After confirming the location of the target band under UV light, cut the gel containing the target fragment with a clean blade. Using a column-based gel recovery kit (QIAGEN QIAquick), dissolve the gel, perform column purification, and elute according to the manufacturer's instructions to obtain the purified product.
[0075] Sanger sequencing: Cycle sequencing was performed using the Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) in a PCR instrument to generate fluorescently labeled DNA fragments (containing ddNTP terminators). The products were loaded onto an ABI3730XL sequencer for capillary electrophoresis analysis. DNA fragments of varying lengths were separated by electrophoresis, and a laser detection system captured four fluorescent signals (A / T / C / G) to generate an electropherogram. These signals were then converted to base sequences and exported as .ab1 files. Sequencing peaks were then analyzed using SnapGene software.
[0076] (4) Structural analysis
[0077] AlphaFold2 was used to generate the protein three-dimensional structure model, and PyMOL (Version 3.1.3.1) was used to analyze and visualize the interactions between amino acid residues. The protein sequences of Cullin-1 homologous proteins from different species and different isoforms of human Cullin proteins were retrieved from the NCBI database, and multiple sequence alignment was performed using ClustalW (default parameters) in MEGA11.
[0078] The experimental results are as follows:
[0079] Heterozygous mutations in the CUL1 gene were found in three unrelated patients with intellectual disability and microcephaly: two nonsense mutations (Gln607* and Arg273*) and one missense mutation (Met450Leu). No other gene mutations were found in any of these three patients that could explain their neurodevelopmental phenotypes.
[0080] Figures 1A to 1D The diagrams of the CUL1 gene mutation pedigree, sequencing chromatogram, and conservation analysis provided in Example 1 are shown; wherein, Figure 1A The pedigrees and CUL1 gene sequencing chromatograms of the two families in Example 1 are shown, where squares represent males, circles represent females, black symbols represent affected individuals, and arrows indicate probands; Figure 1B Schematic diagram of the distribution of the three mutations in Example 1 on the Cullin-1 protein.
[0081] Gln607*, located in exons 17 / 22 of the CUL1 gene, has not been previously reported in public databases (EXAC, gnomAD3.1.2non-neuro). This variant was inherited from the patient's mother, who also exhibited significant language impairment and microcephaly, but currently has normal motor function and can complete simple household chores with guidance.
[0082] Arg273* is located in exon 8 / 22 of the CUL1 gene and is not included in any public mutation database.
[0083] Met450Leu is located in exon 13 of the CUL1 gene. This variant is not included in public databases (including gnomAD, ExAC, and 1000Genomes). Functional prediction software (such as CADD score 22.7) suggests that the variant is harmful. Amino acid residue 450 is located in the Cullin homology domain of the Cullin-1 protein, see Figure 1B This region is highly conserved in the Cullin protein family. This site is highly evolutionarily conserved in vertebrates, see Figure 1D .
[0084] The inventors constructed a three-dimensional protein structure model of the Leu450 variant and found that the mutated amino acid residues can Additional hydrogen bonds are formed with surrounding residues within the radius, see Figure 1C , this structural change may affect the overall conformation of the protein. Figure 1C This is a diagram of the spatial conformation of Cullin-1 protein. The enlarged view shows the difference between the 450th amino acid residue in the wild type (right) and the mutant (bottom). Residue distribution within the radius: wheat-colored sticks mark residue 450, smoke-colored sticks mark Residues within the radius, yellow dashed lines indicate hydrogen bonds.
[0085] Example 2
[0086] 1. Zebrafish Husbandry
[0087] 1.1. Animal husbandry and management
[0088] 1) Adult fish rearing conditions
[0089] Adult zebrafish (Danio rerio) were maintained in a circulating water system at 28 ± 0.5°C. Water quality parameters were maintained as follows:
[0090] - pH: 7.0-7.5;
[0091] - Conductivity: 500-550 μS / cm;
[0092] -Dissolved oxygen: ≥6.5 mg / L;
[0093] -Ammonia nitrogen concentration: <0.02 mg / L;
[0094] The photoperiod was set to 14 h light (08:00-22:00) / 10 h dark, regulated by an automatic timing control system. Feeding was done twice daily (09:00 and 17:00).
[0095] 2) Embryo acquisition and processing
[0096] Obtaining embryos by natural mating:
[0097] (1) On the afternoon of the day before the experiment, sexually mature zebrafish were placed in a breeding tank at a male-to-female ratio of 1:2;
[0098] (2) Setting up isolation devices to prevent broodstock from swallowing eggs;
[0099] (3) Spawning is completed within 1 hour after the start of the next day's light;
[0100] (4) After collecting the embryos, they were washed three times with 0.003% phenylmethylsulfonyl fluoride (PMSF) solution;
[0101] (5) Screen embryos with normal development under a stereomicroscope (Leica M205 C, 40×).
[0102] 1.2 Juvenile fish culture system
[0103] 1) Culture medium preparation
[0104] Embryo culture medium (E3 medium) composition:
[0105] -0.03% Instant Ocean salt (w / v);
[0106] -0.0002% methylene blue (w / v);
[0107] - Prepared using Milli-Q reverse osmosis distilled water (resistivity 18.2 MΩ·cm);
[0108] - Sterilize by filtration through a 0.22 μm filter membrane (Millipore).
[0109] 2) Culture conditions
[0110] (1) Embryos were placed in 6-well culture plates (Corning), with 50 embryos per well in 10 mL of culture medium.
[0111] (2) The culture temperature was maintained at 28 ± 0.5°C (Panasonic MIR-154 incubator);
[0112] (3) Replace the culture medium with fresh one daily and remove dead embryos;
[0113] (4) After the fish develop to 72 hpf, they are raised in a circulating water system.
[0114] 1.3 Transgenic strain experiments
[0115] 5 dpf (days post fertilization) juvenile fish were selected for the experiment. Before the experiment, the fish were anesthetized with 0.016% tricaine (MS-222) and fixed in 1% low-melting point agarose (Invitrogen).
[0116] 2. Gene Editing and TIDE Assessment
[0117] 2.1 Target gene selection and sgRNA design
[0118] Two CUL1 orthologs exist in the zebrafish genome: cul1a and cul1b. Orthologs were identified using the DIOPT Ortholog Finder. To identify orthologs, open the DIOPT Ortholog Finder (https: / / www.flyrnai.org / cgi-bin / DRSC_orthologs.pl) website, select DIOPT Version 9.0, set Search Type to Orthologs, select Human as the Input Species, select Zebrafish as the Output Species, and select the gene name, CUL1.
[0119] The results showed that the protein identity between human CUL1 and zebrafish cul1a was 96%, and the protein identity between human CUL1 and zebrafish cul1b was 93%.
[0120] Single guide RNAs (sgRNAs) were designed using the CHOPCHOP online tool (v3.0) targeting the exonic regions of cul1a and cul1b. Two sgRNAs were designed for each gene, with the following nucleotide sequences (PAM sequence in lowercase):
[0121] cul1a:
[0122] CAGTCGAATCAGGTCCGCGGtgg(SEQ ID No.7);
[0123] CGGGAGGAGCTCAGTTTGTGggg (SEQ ID No. 8);
[0124] cul1b:
[0125] AGTCTATACACGCCAGAGCAtgg(SEQ ID No.9);
[0126] CATGGCTAGGTCTCGCTACAtgg (SEQ ID No. 10).
[0127] All sgRNAs were synthesized by GenScript and purified by PAGE to ensure quality.
[0128] 2.2 CRISPR-Cas9 microinjection
[0129] (1) Embryo preparation: Select 1-2 cell stage zebrafish embryos and place them in 1×E3 culture medium for injection.
[0130] (2) CRISPR complex preparation:
[0131] Cas9 protein (Thermo Fisher Scientific): final concentration 250 ng / μL;
[0132] sgRNA mixture (4 sgRNAs, 90 ng / μL each);
[0133] Dissolved in RNase-free injection buffer (0.2 M KCl, 0.1% Phenol Red).
[0134] (3) Microinjection parameters were set as follows:
[0135] Injection volume: ∼2 nL / embryo;
[0136] Injection pressure: 4-6 psi (FemtoJet 4i, Eppendorf);
[0137] Tip diameter: ~1 μm (borosilicate glass capillary, Sutter P-97 puller).
[0138] (4) Control group: embryos injected with only Cas9 protein (without sgRNA) or not injected served as controls.
[0139] (5) 24 hours after injection, embryos from the injected group were pooled and analyzed by Sanger sequencing to verify mutation efficiency using the TIDE (Tracking Insertions and Deletions by Decomposition) online tool. Post hoc genotyping was performed after phenotypic studies. Individual larvae were collected for sequencing and TIDE analysis to confirm mutations. Larvae with TIDE efficiency less than 5% were excluded from phenotypic data analysis.
[0140] 3. Morphological Examination
[0141] 3.1 Sample preparation and imaging system
[0142] (1) Sample selection:
[0143] 5 dpf (days post fertilization) Tg(HuC:eGFP) transgenic zebrafish larvae were selected (n≥20 per group).
[0144] (2) Fixed:
[0145] Larvae were anesthetized with 0.016% Tricaine (MS-222). Larvae were placed in custom microplates (5 mm diameter, 1 mm depth), one fish per well, with the dorsal surface facing upward to standardize imaging angles. The plates were covered with 1% low-melting-point agarose (Invitrogen) to stabilize the fish and prevent motion artifacts.
[0146] 3.2 Image Acquisition
[0147] Imaging was performed using a Nikon SMZ800N stereo fluorescence microscope, and three images (dorsal, left, and right) were collected for each sample to ensure data reproducibility.
[0148] 3.3 Use Fiji for quantitative analysis. The steps are as follows:
[0149] (1) Body length measurement
[0150] Open the bright field image and use the Straight Line Tool to draw a straight line from the tip of the snout to the end of the caudal fin. Select Analyze → Measure and record the Length (μm).
[0151] (2) Eye distance measurement
[0152] Switch to the fluorescence image and use the Freehand Line Tool to draw a line along the outermost edges of both eyes. Select Analyze → Measure and record the Distance (μm).
[0153] (3) Measurement of central nervous system (CNS) area
[0154] Preprocessing: Image→Adjust→Threshold (default algorithm: Huang), binarize the GFP signal.
[0155] Process→Binary→Fill Holes to fill in discontinuous areas.
[0156] The brain and spinal cord regions were manually selected using the Freehand Selection Tool (avoiding surrounding nonspecific fluorescence).
[0157] Analyze→Measure, output Area (μm2) and Integrated Density (total fluorescence intensity).
[0158] 3.4 Data Standardization and Statistics
[0159] The eye distance was standardized according to the eye distance / body length × 100%; the CNS area was standardized according to the CNS area / body length. 2 CNS area was normalized; statistical analysis was performed using Prism 8 (GraphPad Software). Two-way comparisons were performed using an unpaired t-test. Significance for all tests was defined as *p < 0.05; **p < 0.01; ***p < 0.001.
[0160] 4. Behavioral Assessment of Zebrafish Using Light and Dark Stimuli
[0161] 4.1 Experimental Procedure
[0162] (1) Add 400 μL of E3 culture medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2·2H2O, 0.33 mM MgSO4·7H2O, adjusted to pH 7.2) (also containing 0.003% PTU to inhibit pigment formation and improve imaging clarity) to each well of a 48-well plate (10 mm diameter, 5 mm height).
[0163] (2) 5 dpf zebrafish juveniles (n ≥ 30 per group) were selected and placed individually in a well plate 1 hour before the experiment to avoid human interference.
[0164] (3) Use the following light stimulation program (automatic control):
[0165] Phase 1 (baseline period): 5 minutes of darkness (0 lux) → spontaneous movement was recorded.
[0166] Phase 2 (stimulation period): 5 minutes of white light burst stimulation (2000 lux, 1 Hz flicker frequency) → recording of light-induced movements.
[0167] Total duration: 10 minutes / sample, data acquisition frequency 25fps.
[0168] 4.2 Data Analysis
[0169] ZebraLab software was used to output the coordinates (X, Y) and instantaneous velocity (mm / s) of each frame. The average distance traveled by each juvenile fish over a 10-minute period was calculated. Statistical analysis was performed using Prism 8. Two-variable comparisons were performed using unpaired t-tests. Significance in all tests was defined as *p < 0.05; **p < 0.01; ***p < 0.001.
[0170] Experimental results
[0171] 1. Zebrafish cul1a&b gene knockout leads to neurodevelopmental defects
[0172] To explore whether Cullin-1 functional loss causes abnormal development of the central nervous system, the present inventors constructed a cul1a&b double gene knockout zebrafish model and focused on analyzing the interocular distance, body length and central nervous system morphological characteristics of 5-day post-fertilization (dpf) larvae.
[0173] Figures 2A to 2L This is a diagram showing that knockout of the zebrafish cul1a and cul1b genes leads to abnormal embryonic development and neural developmental defects, as provided in Example 2 of the present invention; wherein, Figure 2A Representative bright field images (dorsal view) of zebrafish larvae at 5 days post-fertilization (dpf), including the upper panel: cas9-injected control group, the lower panel: cul1a & b double-knockout group, the red line indicates the interocular distance and body length, scale bar: 500 μm; Figures 2B to 2C Graph showing the results of interocular distance (p = 0.4424, unpaired t-test) and body length (p < 0.0001) measurements in the cas9 control group (n = 38) and the cul1a & b double knockout group (n = 42) (data were normalized to the mean of the control group); Figure 2D Representative images (dorsal view) of the central nervous system (CNS) morphology of Tg(HuC:eGFP) transgenic zebrafish larvae at 5 dpf, including left: cas9 control group; right: cul1a&b double knockout group. The white dotted boxes indicate the measured CNS regions (forebrain, midbrain, and hindbrain from top to bottom). Scale bar: 200 μm. Figures 2E to 2H The graph shows the normalized total CNS area (p<0.0001) and the area of each subregion (forebrain p=0.0017, midbrain p=0.0004, hindbrain p=0.0010, unpaired t-test) of the cas9 control group (n=38) and the cul1a&b double knockout group (n=34).
[0174] Quantitative analysis showed that there was no significant difference in interocular distance between the Cas9 control group (n=38) and the cul1a&b knockout group (n=43) (unpaired t-test, p=0.4341). Figure 2B However, the body length of the knockout group was significantly shorter than that of the control group (p<0.0001). Figure 2C . And the ratio of eye distance to body length increases.
[0175] Notably, cul1a&b knockout zebrafish (n=35) showed significant central nervous system developmental abnormalities: compared with the control group (n=38), the total area of the central nervous system was significantly reduced (p<0.0001), and the structures involved were Figures 2D to 2E .
[0176] Regional analysis revealed that all brain regions showed consistent shrinkage, with the forebrain (p=0.0011), midbrain (p=0.0002), and hindbrain (p=0.0008) being significantly smaller than those in the control group. Figure 2F , midbrain area results see Figure 2G , the results of hindbrain area can be found in Figure 2H These results indicate that Cullin-1 plays a key regulatory role in the normal development of the zebrafish central nervous system, affecting overall brain morphology and the development of specific brain regions.
[0177] 2. Behavioral defects in cul1a&b knockout zebrafish
[0178] To further verify the effect of cul1a&b functional loss on behavior, the present inventors detected the spontaneous movement and light-dark response behavior of zebrafish.
[0179] Figures 2I to 2J It is a diagram showing the movement trajectory of spontaneous swimming activity (I) and light-dark response (J) (the gray block indicates the dark condition), including the cas9 control group (n=40) and the cul1a&b double knockout group (n=26). Figure 2K is a graph quantifying the total distance moved (p = 0.0047) and maximum speed (p = 0.0088) during 15 minutes of spontaneous swimming activity; Figure 2L The graph quantifies the average total distance moved (darkness / light conditions p < 0.0001) and the maximum speed (darkness p = 0.0002 / light p = 0.0001) under alternating light and dark stimulation.
[0180] Quantitative analysis showed that there were significant behavioral differences between the knockout group and the Cas9 control group: in the spontaneous movement experiment, the total movement distance (unpaired t-test, p<0.01) and maximum movement speed (p<0.01) of the knockout group were significantly lower than those of the control group, indicating that its spontaneous movement activity was weakened. Figure 2I and Figure 2K , the maximum movement speed see Figure 2K .
[0181] In the light and dark stimulation experiment, the knockout group's ability to respond to changes in light conditions was significantly impaired: its total movement distance and maximum speed were both sharply reduced compared with the control group (both indicators p < 0.001). Figure 2J and Figure 2L The results suggest that the loss of cul1a&b function significantly impairs the zebrafish's ability to respond to environmental stimuli.
[0182] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications or substitutions that can be easily conceived by a person skilled in the art within the technical scope disclosed in the present invention should be included in the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims.
Claims
1. Application of CUL1 gene in the preparation of a kit for diagnosing microcephaly and congenital mental retardation.
2. Use of a reagent for detecting CUL1 gene mutation in the preparation of a kit for diagnosing microcephaly and congenital mental retardation.
3. The use according to claim 2, characterized in that The reagent for detecting the mutation of the CUL1 gene includes a reagent for performing whole exon sequencing on the CUL1 gene.
4. Application of sgRNA for knocking out the CUL1 gene in the method of constructing animal models of microcephaly and congenital mental retardation.
5. The use according to claim 4, characterized in that The nucleotide sequence of the sgRNA is selected from at least one of SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, and SEQ ID No.10; and / or The animal model is a zebrafish model.
6. An sgRNA for knocking out the CUL1 gene, characterized in that The nucleotide sequence of the sgRNA is selected from at least one of SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, and SEQ ID No.
10.
7. A method for constructing an animal model of microcephaly and congenital mental retardation, characterized in that: The animal model is a zebrafish model, and the method comprises: 1) synthesizing sgRNA for knocking out the CUL1 gene, wherein the nucleotide sequences of the sgRNAs are SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, and SEQ ID No. 10, respectively; 2) preparing a CRISPR complex, wherein the Cas9 protein and the four sgRNAs prepared in step 1) are mixed to obtain the CRISPR complex; 3) microinjecting the CRISPR complex prepared in step 2) into zebrafish embryos and culturing larvae to obtain the animal model of microcephaly and congenital mental retardation.
8. Use of the animal model of microcephaly and congenital mental retardation constructed according to the method of claim 7 in screening drugs for treating microcephaly and congenital mental retardation.