SNP (Single Nucleotide Polymorphism) marker combination for auxiliary selection of apple surface coloring degree marker, probe group and application of SNP marker combination and probe group

Abstract

The invention belongs to the technical field of plant molecular breeding, and particularly relates to an SNP (Single Nucleotide Polymorphism) marker combination for marker-assisted selection of the coloring degree of an apple surface, a probe group and application of the SNP marker combination and the probe group. The SNP marker combination is composed of four SNP markers; the four SNP markers comprise an SNP1 to an SNP4; the nucleotide sequences from the SNP1 to the SNP4 are sequentially shown as SEQ ID NO.1 to SEQ ID NO.4. The invention further discloses a kit for detecting the content of the SNP4. The invention provides an SNP (Single Nucleotide Polymorphism) marker combination for marker-assisted selection of an apple fruit surface coloring degree. The SNP marker combination for marker-assisted selection of the apple fruit surface coloring degree can be applied to marker-assisted selection of apple fruit surface coloring degree characters in a seedling stage of apple filial generations.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular breeding, and particularly relates to a SNP marker combination, a probe set and applications thereof for marker-assisted selection of apple fruit surface coloration. Background Art

[0002] Apple fruit coloration is an important appearance quality trait, with the red color primarily determined by anthocyanin content. Currently, consumers prefer red apples. Key methods for improving apple fruit coloration include: increasing light utilization through bagging, pruning, and fruit rotation; applying reflective film; and applying fertilizer during the growing season. However, existing methods for improving apple fruit coloration have drawbacks such as high cost and inconsistent results. Therefore, breeding new varieties with high coloration is the best approach to improving fruit appearance quality.

[0003] Conventional hybrid breeding is the main method of apple breeding, which relies on phenotypic screening to select offspring with high fruit surface coloration. MdMYB1 and traits controlled by multiple genes. A genome-wide association study of 160 apple varieties revealed only a single, significant sequence repeat marker, Mdo.chr9.4, associated with fruit surface pigmentation intensity. Although existing studies have shown that SNP markers based on the MdMYB1 gene can predict apple fruit surface pigmentation with an accuracy exceeding 80%, existing marker combinations still have significant limitations: they cover a single allele locus, fail to integrate superior pigmentation-related alleles in wild and closely related species of the genus Malus, and are unable to fully elucidate the genetic mechanisms of apple fruit surface pigmentation. This limits the comprehensiveness and effectiveness of existing SNP marker combinations in predicting fruit surface pigmentation in molecular-assisted breeding, making them inadequate for precision breeding. Therefore, molecular markers for apple fruit surface pigmentation continue to be explored to provide a more comprehensive basis for molecular-assisted breeding of apples. Summary of the Invention

[0004] To address the limited comprehensiveness and effectiveness of existing SNP marker combinations for predicting fruit surface pigmentation in molecular-assisted breeding, making it difficult to meet the needs of precision breeding, the present invention provides a SNP marker combination suitable for marker-assisted selection of apple fruit surface pigmentation, enabling marker-assisted selection of apple fruit surface pigmentation during the seedling stage. To achieve this objective, the present invention employs the following technical solutions.

[0005] One of the objectives of the present invention is to provide a SNP marker combination for marker-assisted selection of apple fruit surface coloration, wherein the SNP marker combination consists of four SNP markers; the four SNP markers include SNP1 to SNP4.

[0006] The SNP1 is Chr00_8912122, and the nucleotide sequence of Chr00_8912122 is shown in SEQ ID NO.1, wherein there is a mutation from G to T at the 201 bp position.

[0007] The SNP2 is Chr06_28125821, and the nucleotide sequence of Chr06_28125821 is shown in SEQ ID NO.2, wherein there is a mutation from A to C at the 201878 bp position.

[0008] The SNP3 is Chr09_34074567, and the nucleotide sequence of Chr09_34074567 is shown in SEQ ID NO.3, wherein there is a mutation from A to G at the 201 bp position.

[0009] The SNP4 is Chr09_35557774, and the nucleotide sequence of Chr09_35557774 is shown in SEQ ID NO.4, wherein there is a mutation from A to T at the 201 bp position.

[0010] The SNP marker combination provided by the present invention has a comprehensive range of excellent alleles related to coloration in wild species of the genus Apple and closely related species, accurately predicts, covers multiple allele sites, and can integrate excellent alleles related to coloration in wild species of the genus Apple and closely related species. It can solve the problem that the existing SNP marker combination has limited comprehensiveness and application effect in predicting fruit surface coloration in molecular assisted breeding, and is difficult to meet the needs of precise breeding.

[0011] A second object of the present invention is to provide a probe set for detecting the SNP marker combination for marker-assisted selection of apple fruit surface coloration, including GenoBaits DNA probes for detecting SNP1 to SNP4.

[0012] The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP1 is shown in SEQ ID NO.5.

[0013] The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP2 is shown in SEQ ID NO.6.

[0014] The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP3 is shown in SEQ ID NO.7.

[0015] The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP4 is shown in SEQ ID NO.8.

[0016] The third purpose of the present invention is to use the apple fruit surface coloration marker-assisted selection SNP marker combination to identify apple germplasm resources, select matching parents, and fully utilize the excellent allelic variations in apple related species and wild species.

[0017] A fourth object of the present invention is to provide a use of the SNP marker combination or the probe group in preparing a kit for determining the coloration of apple fruit surface.

[0018] Preferably, the kit comprises the probe set.

[0019] A fifth object of the present invention is to provide a kit for determining the coloration of apple fruit surface, wherein the kit comprises the SNP marker combination or the probe group.

[0020] A sixth object of the present invention is to provide the use of the SNP marker combination, the probe group or the kit in determining the coloration of apple fruit surface.

[0021] Preferably, the method comprises the following steps: Extract genomic DNA from the tested Malus plants.

[0022] The genomic DNA of the tested Malus plant is used as a template and the probe set is used to perform PCR amplification to obtain a PCR amplification product.

[0023] The PCR amplification products are subjected to typing detection.

[0024] The coloration degree of the fruit surface of the tested apple plant is determined.

[0025] Preferably, when the genotype at Chr09_34074567 is AA, the fruit surface coloration of the tested Malus plant is less than 40%, which is marked as Y.

[0026] When the genotype at Chr00_8912122 is AA, the genotype at Chr06_28125821 is CC, or the genotype at Chr09_35557774 is AA, the fruit surface coloration of the tested Malus plant is greater than 70%, which is marked as R.

[0027] When the above two conditions are not met, the fruit surface coloration of the tested Malus plants of other genotype combinations is 40% to 70%, which is marked as M.

[0028] Among them, fruit surface coloration refers to the red coverage area on the surface of apple fruit.

[0029] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention provides a SNP marker combination for marker-assisted selection of apple fruit surface coloration, wherein the SNP marker combination includes four main effect SNP markers related to apple fruit surface coloration, namely four SNP markers; the four SNP markers include SNP1 to SNP4. The nucleotide sequences of SNP1 to SNP4 are shown in SEQ ID NO.1 to SEQ ID NO.4, respectively. The SNP marker combination is suitable for molecular-assisted evaluation, screening and breeding program design of Malus germplasm resources. The SNP marker combination provided by the present invention has a comprehensive range of excellent alleles related to coloration in wild species and related species of the genus Apple, has accurate prediction, and covers multiple allele sites, and can integrate excellent alleles related to coloration in wild species and related species of the genus Apple. It can solve the problem that the existing SNP marker combination is limited in comprehensiveness and application effect in predicting fruit surface coloration in molecular-assisted breeding, and is difficult to meet the needs of precise breeding.

[0030] 2. The present invention focuses on the main effect variation sites controlling fruit surface coloration other than MYB1, develops SNP markers, and applies them to marker-assisted selection of apple fruit surface coloration traits in the seedling stage of apple hybrid offspring.

[0031] 3. The present invention is applied to the genotype evaluation of fruit surface red color variation sites in apple germplasm resources, selection of parental matching hybrid combinations, and guidance of apple molecular breeding.

[0032] 4. The present invention has developed four major SNP markers related to the apple fruit surface coloration trait, which has low cost and high selection accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The four major effect SNP markers related to the apple fruit surface coloration trait in the present invention are applied to apple fruit surface coloration marker-assisted selection. DETAILED DESCRIPTION

[0034] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0035] The test materials used in the examples of the present invention are as follows: The apple materials used in the embodiments of the present invention include Purple Pearl, Red Fuji, Golden Crown and Red Jade, which are specifically sourced from the apple breeding base in Beidaihe New District, Qinhuangdao City, Hebei Province.

[0036] The 361 germplasm resources used in the examples were sourced from the apple breeding base in Beidaihe New District, Qinhuangdao City, Hebei Province.

[0037] Example 1 1. Identification of apple surface coloration phenotype A total of 5560 hybrid offspring lines from 361 Malus germplasm resources and three hybrid populations, namely 'Purple Pearl' × 'Red Fuji', 'Purple Pearl' × 'Golden Crown', and 'Red Jade' × 'Golden Crown', were used. Fruits were picked for five consecutive years to visually investigate the coloration of the fruit surface of the F1 generation hybrid seedlings at maturity. The ratio of the red area of ​​the fruit surface to the total area was used as the evaluation indicator.

[0038] 2. Mining of variant sites of apple surface coloration BSA-seq was used to explore QTL sites related to fruit surface coloration in the hybrid offspring population. Extreme phenotype pools were constructed using three hybrid combinations. DNA from samples in the two pools was extracted and mixed in equal amounts for high-throughput sequencing to obtain genomic data of extreme phenotypes. By comparing the reference genome, the allele frequency differences of each SNP site in the two pools were calculated, and sites with significant differences were identified as candidate QTL sites.

[0039] A total of 22 QTL loci were discovered across the three hybrid combinations. For apple germplasm resources, GWAS was used to identify association intervals for the fruit coloration trait. Data on apple germplasm resources and phenotypic data were collected, and genome-wide SNP typing was performed on the population. A statistical model was used to analyze the association between each SNP and the phenotype. Genomic regions significantly associated with the trait were identified using a significance threshold, resulting in 15 significant intervals.A total of 57 loci related to fruit surface coloration were obtained by the two methods, namely: Chr00_8912122, Chr00_8912132, Chr00_8912154, Chr00_49172079, Chr00_49448711, Chr01_24056475, Chr01_24598548, Chr02_4194776, Chr02_14658899, Chr03_26163837, Chr04_19998777, Chr05_33334193, Chr05_36563053, Chr05_37652411, Chr05_45823619, Chr05_45825252, Chr06_6190330, Chr06_6396613, Chr06_6948124, Chr06_22672602, Chr06_ 25973045, Chr06_26704604, Chr06_26733868, Chr06_28125821, Chr06_32273327, Chr08_2089437, Chr08_4081610, Chr08_487046 3. Chr08_21075052, Chr09_19032403, Chr09_32264945, Chr09_32573116, Chr09_32717443, Chr09_33001601, Chr09_33305721, C hr09_33801013, Chr09_34071319, Chr09_34074567, Chr09_34269485, Chr09_34594412, Chr09_35135106, Chr09_35486247, Chr09 Chr16_40024381, Chr15_23183829, Chr16_31183115, and Chr16_40024381.

[0040] 3. Development of molecular markers for variation sites in apple fruit surface coloration Based on the variation type, gene expression level, and functional annotation, candidate gene variation sites were selected within each QTL locus and GWAS interval related to apple fruit surface coloration. The specific implementation method is as follows:

[0041] Genomic DNA was extracted from leaves of the target material. The genome was accurately quantified using the Qubit® dsDNA HS Assay Kit. Enzyme digestion and DNA library construction were performed using the GenoBaits® DNA Library Prep Kit for ILM, and adapters were added using the GenoBaits® Barcode for ILM Kits. Hybridization and target capture were then performed using the GenoBaits® DNA Hybridization Kit for ILM, using GenoBaits® DNA probes corresponding to major SNP markers affecting apple fruit surface coloration. The captured target library was sequenced using an Illumina sequencer using the PE150 strategy at a depth of 1000× to 1200×. Sequencing reads were analyzed and genotyped using the GDDH13.1 reference genome.To develop molecular markers, a total of 57 SNP variant sites were selected, including Chr00_8912122, Chr00_8912132, Chr00_8912154, Chr00_49172079, Chr00_49448711, Chr01_24056475, Chr01_24598548, Chr02_4194776, Chr02_14658899, Chr03_26163837, Chr04_19998777, Chr05_33334193, Chr05_36563053, Chr05_37652411, Chr05_45823619, Chr05_45825252, Chr06_6190330, Chr06_6396613, Chr06_6948124, Chr06_22672602, Chr06_ 25973045, Chr06_26704604, Chr06_26733868, Chr06_28125821, Chr06_32273327, Chr08_2089437, Chr08_4081610, Chr08_487046 3. Chr08_21075052, Chr09_19032403, Chr09_32264945, Chr09_32573116, Chr09_32717443, Chr09_33001601, Chr09_33305721, C hr09_33801013, Chr09_34071319, Chr09_34074567, Chr09_34269485, Chr09_34594412, Chr09_35135106, Chr09_35486247, Chr09 _35557774, Chr09_35867856, Chr09_36364387, Chr10_1527990, Chr10_28655035, Chr11_29379387, Chr11_41526745, Chr12_464 4669, Chr12_21214664, Chr13_42366285, Chr14_31245687, Chr15_1934733, Chr15_23183829, Chr15_31183115, Chr16_40024381.

[0042] 4. Estimation of the genotype effect value of apple fruit surface coloration markers and screening of main effect markers A training population consisting of 1777 lines was constructed using the hybrid population and germplasm resources described above. Using the GenoBaits strategy, 100 ng of apple hybrid and germplasm DNA, 4 μL of GenoBaits End Repair Buffer, 3.1 μL of GenoBaits End Repair Enzyme, and 20 μL of water were added to a 0.2 μL PCR tube. The tube was placed in a thermal cycler and incubated at 37°C for 20 min and 72°C for 20 min. Then, 2 μL of GenoBaits Ultra DNA ligase, 8 μL of GenoBaits Ultra DNA Ligase Buffer, 2 μL of GenoBaits Adapter, and 8 μL of Nuclease-free water were added, and the tube was incubated at 22°C for 60 min. A 1.2x volume of GenoPrep DNA Clean Beads was added, mixed thoroughly, placed on a magnetic stand, and allowed to stand for 3 min. The supernatant was removed, and 100 μL of freshly prepared 80 vol% ethanol was added. Incubate at room temperature for 30 seconds and remove the supernatant. Air-dry until all ethanol has evaporated, then add 10μL of GenoBaits PCR Master Mix, 1μL of GenoBaits Uni_oligo, 5μL of GenoBaits DNA index, and 4μL of Nuclease-free water. Resuspend the beads and place in a PCR instrument. Incubate at 98°C for 2 minutes, followed by 7 cycles of 98°C for 30 seconds, 65°C for 30 seconds, and 72°C for 40 seconds. Incubate at 72°C for 4 minutes. Then, add 20μL of GenoPrep DNA Clean Beads, mix thoroughly, and let stand for 5 minutes. Remove the supernatant and add 100μL of freshly prepared 80 vol% ethanol. Incubate at room temperature for 30 seconds and remove the supernatant. Add 30μL of Tris-HCl to resuspend the library, mix thoroughly, place on a magnetic stand, and let stand for 3 minutes. Remove the supernatant to obtain the DNA library. Equal amounts of purified apple cultivar DNA libraries were mixed and hybridized at 65°C for 2 h. The hybridized libraries were eluted using different wash buffers. The eluted target libraries were further enriched to obtain sufficient library for sequencing; the enriched libraries were purified to obtain the final libraries. The final library DNA concentration was determined using Qubit Fluorometric Quantitation (Thermo Fisher). The captured target libraries were sequenced and analyzed using an Illumina sequencer using the PE150 strategy, with a sequencing depth of 1000× to 1200×.Sequencing reads were used to analyze and genotype the 57 fruit coloration SNP markers described above using the GDDH13.1 reference genome. A training population of 1,777 lines was used to estimate the genotypic and marker effects of each marker on apple fruit coloration.

[0043] Four major effect SNP markers related to apple fruit surface coloration with larger marker effect values ​​were selected as the major effect variation sites of apple fruit surface coloration.

[0044] Among them, the four major SNP markers related to apple fruit surface coloration traits are Chr00_8912122, Chr06_28125821, Chr09_34074567 and Chr09_35557774.

[0045] Among them, Chr00_8912122 is the SNP marker SNP1, and its nucleotide sequence is shown in SEQ ID NO.1: ATAGTTGCTAATAGGAGCGTATTTATACGACTTAGTTAGCTTGTTTCTTGCATTTATATTGTTAGTTCATAGTTATTTTAGTATTTTAAGCTGTTTTCGTGTGTTTGTAGGGTCAAATGTCAAAAGTAGCAAGAAAGTGCATTTTAAAGCATTGCGGAGCAGTTTTGGGCTTGGAATGGATAGCTTATGAATGAAGCAA[G / T]GTGGATG GACGTACTTTATGCTAGGAATGTGCTGAAGAGATGAAGTAAATAAATTCAATACAAGGAAGATTAGGAAAGTTAGCAAGAAAGAAGGAATGTTAGTCAAACTACCTTATTTTGACTTAGCCTTTTCCTCATCTGATGTGAAATTTAACTAGCACTCAAATTAAACCCACTTATTGACAATTGTAGTAAAGATG; among them, there is a G to T mutation at 201bp.

[0046] Among them, Chr06_28125821 is the SNP marker SNP2, and its nucleotide sequence is shown in SEQ ID NO.2: AAGAGAACAAATCTGCATGTTAAGTTTAAAGGAATTACTGCAGAGTTGCTAGAGCAGTGTGCGTTTTTCGCAGTTTGAATTCCCCTCCCATTAGTCTAGGTGAATTCCAGGTAGAATATGACTTGTTTAAAGGACTTATTTATAATTAATAAATCAAATTTGTGTTGCAGGTGTCCACTCTGACGCTGCTTTTTCTGGTG[A / C]ACTTTGGGGGATTTTGCTTGATTCTTCTTCTGGCTCACTTCTTATCACAAGGGCCGACCCGCGTCGCAGTTCTAGGATGGGTTTGTGTGACTTTCTCTGTCAGTGTCTTTGCAGCACCTTTAAGCGCCATGGTAATTGATTAAGCAAGTACTGTTTTCAAATTTTAAAGGTTTAAACAAAATCTCAAATTTTCTATGCAT; Among them, there is a mutation from A to C at the 878bp position.

[0047] Among them, Chr09_34074567 is the SNP marker SNP3, and its nucleotide sequence is shown in SEQ ID NO.3: GTTTTGCACCCCATAGAAGATATGAAATGATAATCATAGCAGAGATTAAACAATGAAATAGCAAAGCCCTTCTTTCTATATTCTCAACACGCATCTTCATGTGAATTTTTAAGTTTAATGTGTATATAACACAATTCAAGTGATGTGGAACACGTTTAATCGTTGGGTTTCACACACGAGACAACATGCTCTGATAACAT[A / G]AAAAAAGTTGAAGTTTCATCATAATACCAAATAGCAATATCGAAAGTAATCCAACCATTTTTAAGTGTGAGAGATAAGAGTGAGTTTGTGAATAGCACAAACTATCCTAATAATATTAAAATTGGAAAGAGCCTTCATTTCCATCTCCACTTCCATGTTGATAAAGTCTTCAAATTTGTTTCATAAGTGTTTTTAGCTAT; Among them, there is a mutation from A to G at the 201bp position.

[0048] Among them, Chr09_35557774 is the SNP marker SNP4, and its nucleotide sequence is shown in SEQ ID NO.4: ACAAAGAGTGGAGCATTCTACTCTAACTAACTTATATGTAAATGTGTCTCCAGATTATGAACAGAATAATCTAGGCTTTTACTGGCTTTTCATTTCAACTGATTGTTTGTTTTACATTTGTTGCTAAAGCAGAAACTGAAGACTCGAGTGGTGAAGAAGAATGTGAATCCGGAGTGGAACGAAAAATTGACTCTTTCAGT[A / T]GCAGACC CAAATCTTCCAATCAGGCTTTCTGTGTATGACAAAGATACATTTAGTTTTGATGACAAAATGGGGGATGCAGAGTTTGAGATTGGTACATTTATTAAAGTCTTGAGGATGGGATTGGAAGGCCTCCCAGATGGAACCATAATTACAAAAGTACAACCAAGTAGAAAAAAACTGCCTTGCTGAAGAGAGCTACAT; among them, there is an A to T mutation at 201bp.

[0049] The flanking sequence information for the four major SNP variants affecting fruit surface pigmentation is shown below. The non-variant base (before) and the variant base (after) are indicated within brackets "[ ]," separated by a " / " ( / ).

[0050] The GenoBaits DNA probe sequence information corresponding to the four major SNP markers for apple fruit surface coloration is as follows: The nucleotide sequence of the DNA probe used to detect SNP1 is shown in SEQ ID NO.5: GGAATGGATAGCTTATGAATGAAGCAAGGTGGATGGACGTACTTTATGCTAGGAATGTGCTGAAGAGATGAAGTAAATAAATTCAATACAAGGAAGATTAGGAAAGTTAG.

[0051] The nucleotide sequence of the DNA probe used to detect SNP2 is shown in SEQ ID NO.6: TGACTTGTTTTAAAGGACTTATTTATAATTAATAAATCAAATTTGTGTTGCAGGTGTCCACTCTGACGCTGCTTTTTCTGGTGAACTTTGGGGGATTTTGCTTGATTCTTC.

[0052] The nucleotide sequence of the DNA probe used to detect SNP3 is shown in SEQ ID NO.7: TGTGTATATAACACAATTCAAGTGATGTGGAACACGTTTAATCGTTGGGTTTCACACACGAGACAACATGCTCTGATAACATAAAAAAAGTTGAAGTTTCATCATAATAC.

[0053] The nucleotide sequence of the DNA probe used to detect SNP4 is shown in SEQ ID NO.8: ATCATATTACGAAGGCACATAAGAGGGATTTGTAAATCACTATTTCTGAGTAGGAATTTACAAATATCTCTCGCATGTCTTTGTAATTCTGATATAGTACGTTTTTAATC.

[0054] 5. Marker-assisted selection method for apple surface coloration In the training population of this embodiment, the genotype distribution of the above four main effect markers of apple fruit surface coloration and their contributions to the trait phenotype are as follows: SNP1 is the Chr00_8912122 marker, which includes five genotypes: AA, GA, GG, GT and TT, among which the fruit surface of individuals with the AA genotype is red.

[0055] SNP2 is the Chr06_28125821 marker, which includes three genotypes: AA, AC and CC, among which the fruit surface of individuals with the CC genotype is red.

[0056] SNP3 is the Chr09_34074567 marker, which includes three genotypes: AA, AG and GG. The fruit surface of individuals with the AA genotype is yellow.

[0057] SNP4 is the Chr09_35557774 marker, which includes three genotypes: AA, TA and TT. The fruit surface of individuals with the AA genotype is red.

[0058] There are complementary epistatic effects among the four major SNP markers for apple fruit coloration. Apple germplasm resources or hybrid offspring were evaluated and selected for apple fruit coloration according to the following criteria:

[0059] ① The germplasm resources or hybrid offspring with the genotype of AA at Chr09_34074567 have a fruit surface coloration of less than 40, which is marked as Y.

[0060] ② Germplasm resources with genotype AA at Chr00_8912122, CC at Chr06_28125821, or AA at Chr09_35557774 or hybrid offspring with single fruit surface coloration greater than 70% are marked as R.

[0061] ③ After two rounds of selection in ① and ② above, the germplasm resources or hybrid offspring with the remaining genotype combinations of the above four major effect SNP markers for apple fruit surface coloration have a single plant fruit surface coloration of 40%-70%, and are marked as M.

[0062] As can be seen from the above, the four main effect SNP markers for apple fruit surface coloration can be used to comprehensively and accurately predict apple fruit surface coloration. Among them, the four main effect SNP markers for apple fruit surface coloration are four SNP markers; the four SNP markers include SNP1 to SNP4.

[0063] Example 2 In order to verify the feasibility of the above four major SNP markers for apple fruit surface coloration and their probe sets, the present invention conducted the following studies: Based on the genotyping data of the four major effect markers of 1777 apple materials, the complementary epistatic effects between the four major effect SNP markers linked to the apple fruit surface coloration trait and the judgment and selection criteria for apple fruit surface coloration were used to screen and judge the Malus germplasm resources or hybrid offspring: like Figure 1 As shown in the figure, 1777 apple materials were divided into three grades. Specifically, germplasm resources or hybrid offspring with the genotype of AA at Chr09_34074567 and a fruit coloration of less than 40% were marked as Y; germplasm resources or hybrid offspring with any of the genotypes of AA at Chr00_8912122, CC at Chr06_28125821, or AA at Chr09_35557774 and a fruit coloration of more than 70% were marked as R; after the two rounds of selection mentioned in ① and ②, germplasm resources or hybrid offspring with the remaining genotype combinations of the four major effect SNP markers for apple fruit coloration had a fruit coloration of 40%-70% and were marked as M.

[0064] From the above experimental results, it can be seen that the SNP marker combination provided by the present invention has a comprehensive range of excellent alleles related to coloration in wild species and related species of the genus Apple, has accurate predictions, and covers multiple allele sites. It can integrate excellent alleles related to coloration in wild species and related species of the genus Apple, and can solve the problem that the existing SNP marker combination has limited comprehensiveness and application effect in predicting fruit surface coloration in molecular assisted breeding, and is difficult to meet the needs of precise breeding.

[0065] It should be noted that when the present invention involves a numerical range, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes a preferred embodiment.

[0066] Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once the basic inventive concepts become known, and all such changes and modifications fall within the scope of the present invention.

Claims

1. A SNP marker combination for marker-assisted selection of apple fruit surface coloration, characterized in that: The SNP marker combination consists of 4 SNP markers; the 4 SNP markers include SNP1 to SNP4; The SNP1 is Chr00_8912122, and the nucleotide sequence of Chr00_8912122 is shown in SEQ ID NO. 1, wherein there is a mutation from G to T at the 201 bp position; The SNP2 is Chr06_28125821, and the nucleotide sequence of Chr06_28125821 is shown in SEQ ID NO. 2, wherein there is a mutation from A to C at the 201 bp position; The SNP3 is Chr09_34074567, and the nucleotide sequence of Chr09_34074567 is shown in SEQ ID NO. 3, wherein there is a mutation from A to G at the 201 bp position; The SNP4 is Chr09_35557774, and the nucleotide sequence of Chr09_35557774 is shown in SEQ ID NO.4, wherein there is a mutation from A to T at the 201 bp position.

2. A probe set for detecting the SNP marker combination for marker-assisted selection of apple fruit surface coloration according to claim 1, characterized in that: comprising GenoBaits DNA probes for detecting said SNP1 to said SNP4; The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP1 is shown in SEQ ID NO.5; The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP2 is shown in SEQ ID NO.6; The nucleotide sequence of the GenoBaits DNA probe used to detect SNP3 is shown in SEQ ID NO.7; The nucleotide sequence of the GenoBaits DNA probe used to detect the SNP4 is shown in SEQ ID NO.

8.

3. Use of the SNP marker combination according to claim 1 or the probe set according to claim 2 in the preparation of a kit for determining the coloration of apple fruit surface.

4. The use according to claim 3, characterized in that The kit comprises the SNP marker combination according to claim 1 or the probe set according to claim 2.

5. Use of the SNP marker combination according to claim 1, the probe set according to claim 2, or the kit according to claim 6 in determining the coloration of apple fruit surface.

6. The use according to claim 5, characterized in that The steps include: extracting genomic DNA from the tested Malus plant; Using the genomic DNA of the tested Malus plant as a template, performing PCR amplification using the probe set to obtain a PCR amplification product; Performing typing detection on the PCR amplification product; The coloration degree of the fruit surface of the tested apple plant is determined.

7. The use according to claim 6, characterized in that When the genotype at Chr09_34074567 is AA, the fruit surface coloration of the tested apple plant is less than 40%, which is marked as Y; When the genotype at Chr00_8912122 is AA, the genotype at Chr06_28125821 is CC, or the genotype at Chr09_35557774 is AA, the fruit surface coloration of the tested apple plant is greater than 70%, which is marked as R; When the above two conditions are not met, the fruit surface coloration of the tested Malus plants of other genotype combinations is 40% to 70%, which is marked as M.

8. The use according to claim 6, characterized in that The reaction conditions for the PCR amplification were: 98° C. for 2 min; 7 cycles of 98° C. for 30 s, 65° C. for 30 s, and 72° C. for 40 s; and 72° C. for 4 min.

Images