Molecular marker closely linked with salt-tolerant QTL-qGRNS6.01 / qRGR6.01 in germination period of corn and application of molecular marker in breeding

By constructing the CSSL population and developing KASP molecular markers, QTL-qGRNS6.01/qRGR6.01 of chromosome 6 of maize was solved, and the genetic improvement problem of salt tolerance traits during corn germination was achieved, and efficient corn salt tolerance breeding effect was achieved.

CN120485423APending Publication Date: 2025-08-15SHIHEZI UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510844254.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-23
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The prior art In the genetic research on salt-tolerant traits of corn, especially the localization and breeding progress of salt-tolerant traits during the germination period, the lack of effective molecular markers and methods makes it difficult to achieve efficient genetic improvement.

Method used

By constructing the CSSL population, genotype analysis was performed using corn 10K-SNP chip to obtain high-quality SNP markers, linkage mapping analysis was performed by combining Joinmap4.0 software to locate QTL-qGRNS6.01/qRGR6.01 of chromosome 6, and KASP molecular markers were developed to detect bases 34,221,420 and bases 63,918,493 of chromosome 6, so as to achieve screening and breeding of salt-tolerant traits during germination.

Benefits of technology

Accurate positioning and efficient screening of salt-tolerant traits during corn germination period has been achieved, and the genetic improvement efficiency of salt-tolerant traits during corn germination period has been improved. It is simple and low-cost, which has significantly improved the germination rate of corn under salt stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_4
    Figure SMS_4
  • Figure SMS_5
    Figure SMS_5
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked with salt-tolerant QTL-qGRNS6.01 / qRGR6.01 in a corn germination period and application of the molecular marker in breeding. A new major QTLqGRNS6.01 / qRGR6.01 for controlling the salt tolerance in the corn germination period is identified in multiple environments by utilizing a CSSL population and chip technology through linkage analysis, and KASP molecular markers are developed on SNP (Single Nucleotide Polymorphism) on two sides of QTL and can be used for molecular marker-assisted selective breeding. The qGRNS6.01 breeding effect evaluation result shows that the excellent allelotype from the NILB73 can obviously improve the germination rate character under the salt stress condition, so that the salt-tolerant effect is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker tightly linked to a maize salt tolerance QTL-qGRNS 6.01 / qRGR6.01 during germination and its application in breeding. Background Art

[0002] Maize salt tolerance is a quantitative trait controlled by micro-effect polygenes, and its genetic basis is relatively complex. Therefore, the research progress on the genetic basis of this trait in maize is relatively slow. Due to the multi-effect of salt stress, many phenotypes are used to measure the salt tolerance of crops, such as germination indexes (germination rate and germination potential), seedling indexes (seedling survival rate, biomass-related traits, relative chlorophyll content, Na + , K + Content, Na + / K + , visual grade scores), and maturity indicators (plant height, yield-related traits, visual grade scores, etc.) (Kumar et al. 2022). Linkage analysis, genome-wide association analysis, and candidate gene association analysis are effective tools for analyzing the genetic basis of complex quantitative traits. Based on these, previous researchers have identified several quantitative trait loci (QTLs) or genes associated with salt tolerance in maize.

[0003] Existing forward genetic studies of salt tolerance in maize indicate that QTL / gene discovery for salt tolerance has primarily focused on seedling-related traits, while relatively few studies have mapped salt tolerance QTLs for traits related to germination and maturity. Under saline-alkali soil conditions, a major QTL for salt tolerance, qFgr1 / qFstr1, was co-localized on chromosome 1 using 161 RIL lines constructed from the 'F63' × 'F35' strain for field germination rate and field salt tolerance index (Cui et al. 2015). Using 240 DH lines, a major QTL for salt tolerance, qSPH1 / qPHI1, was co-localized on chromosome 1 using saline-alkali soil plant height and the saline-alkali soil / conventional soil plant height ratio as phenotypes. Two candidate genes, GRMZ M2G007555 and GRMZ M2G098494, were identified as regulating ion homeostasis (Luo et al. 2017).

[0004] In this study, the excellent local germplasm BMY was used as the donor parent to construct the CSSL genetic population. QTL positioning was performed on the salt tolerance trait of maize during the germination period to discover rare salt-tolerant alleles, and a systematic breeding effect evaluation was conducted to explore their potential application value in actual breeding, providing a scientific basis and practical guidance for the genetic improvement of salt tolerance traits in maize. Summary of the Invention

[0005] Application of reagents for detecting bases 34, 221, 420 and 63, 918, 493 on maize chromosome 6 in screening and breeding for salt tolerance during the germination period of maize.

[0006] Another object of the present invention is to provide a primer for detecting bases 34, 221, 420 and 63, 918, 493 of chromosome 6 of maize for use in screening and breeding for salt tolerance during the germination period of maize.

[0007] The last object of the present invention is to provide a method for screening and breeding corn for salt tolerance during the germination period.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] Obtaining a tightly linked KASP marker for the major QTL for salt tolerance during maize germination:

[0010] The applicant used the local corn germplasm Baima Ya (BMY) as the donor parent and the corn inbred line B73 as the recurrent parent to construct a BC4F4 CSSL population containing 318 lines. The genotype analysis of the above 318 lines was performed using the corn 10K-SNP chip, and 9843 SNP markers were obtained. After screening, 2859 high-quality SNPs markers were finally obtained. The high-quality SNP markers were imported into Joinmap4.0 software for linkage mapping analysis, and a high-density genetic linkage map with a total length of 467.48 cM was constructed. Based on the above high-density genetic linkage map, the genotypes of the 318 CSSL lines, and the phenotypic data of the salt tolerance germination rate and relative germination rate of the above lines, QTL IciMapping X64_V4.2 software was used for QTL positioning, among which significant QTLs were detected for both traits in chromosome 6 6.01bin, namely: qGRNS6.01 / qR GR6.01. Then, based on the QTL interval, the intersection of the same bin QTL was taken. qGRNS6.01 / qRGR6.01 was located between markers 6_34221420 and 6_63918493, with a physical distance of approximately 29.70Mb, an average LOD value of 8.61, an average phenotypic contribution rate of 6.27%, and an average additive effect of -0.07. Further analysis found that there were SNPs at both ends of the qGRNS6.01 / qRGR6.01 QTL, located at bases 34,221,420 and 63,918,493 on chromosome 6 of maize. KASP molecular marker development was performed for these two SNPs. Each primer set included three primers, including two fluorescently labeled primers containing the SNP site (the primer information was labeled FAM fluorescence, GAAGGTGACCAAGTTCA, which was consistent with the B73 sequence). TGCT; a HEX fluorescent marker consistent with the BMY sequence, GAAGGTCGGAGTCAACGGATT) and a universal primer at the other end, as shown in Table 1:

[0011] Table 1 KASP primer information of linked markers

[0012]

[0013] The protection scope of the present invention includes:

[0014] Application of reagents for detecting bases 34, 221, 420 and 63, 918, 493 on maize chromosome 6 in screening and breeding for salt tolerance during the germination period of maize.

[0015] The reagents described above are preferably primers.

[0016] The primers described above are preferably the KASP detection primers provided by the present invention. The primers for detecting bases 34, 221, and 420 of maize chromosome 6 are:

[0017] 6_34221420Rt:GAAGGTGACCAAGTTCATGCTAGAGGTACATGATGCAGCGCT

[0018] 6_34221420Rg:GAAGGTCGGAGTCAACGGATTAGGTACATGATGCAGCGCC

[0019] 6_34221420F:TCGAAGTGCATTTGTGGACAG;

[0020] The primers for detecting base 63,918,493 of maize chromosome 6 are:

[0021] 6_63918493Ra:GAAGGTGACCAAGTTCATGCTTGATGTATGTGTTGACCATGTAAAGA

[0022] 6_63918493Rg:GAAGGTCGGAGTCAACGGATTGATGTATGTGTTGACCATGTAAAGG

[0023] 6_63918493F:ACTAATTTTCTTCGCTTTTTGGG.

[0024] A method for screening and breeding corn for salt tolerance during the germination period comprises detecting bases 34, 221, and 420 and bases 63, 918, and 493 of corn chromosome 6 using conventional protocols in the art. The conventional protocols include, but are not limited to, sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The present invention obtained the major effect QTL locus qGRNS6.01 / qRGR6.01 for salt tolerance during the germination period of maize, which can be repeatedly detected, with an average phenotypic contribution rate of 6.27% and an average additive effect of -0.07, which can be used for genetic improvement of maize salt tolerance.

[0027] (2) The present invention obtains a tightly linked KASP marker qGRNS6.01 / qRGR6.01, and the detection method thereof is simple and low-cost, which can be used to evaluate the salt tolerance breeding effect of corn and help improve the salt tolerance of corn during the germination period. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 SNP high-density genetic linkage map.

[0029] Figure 2 Distribution of germination rates of CSSLs populations under three different salt stress environments (A) and their correlation (B)

[0030] Figure 3 QTL mapping of germination rate (A) and relative germination rate (B) in CSSLs population under salt stress

[0031] Figure 4 Typing map of salt tolerance linked KASP markers during germination;

[0032] Among them: A: 6_34221420; B: 6_63918493.

[0033] Figure 5 Evaluation of the breeding effect of qGRNS6.01 / qRGR6.01. DETAILED DESCRIPTION

[0034] The technical solutions described in this invention, unless otherwise specified, are conventional techniques in the art; the reagents and materials described, unless otherwise specified, are commercially available. The maize genome version used in this invention is B73-V3 (Version 3.B73) https: / / maizegdb.org / genome / assembly / B73%20RefGen_v3.

[0035] Example 1:

[0036] Obtaining a KASP marker tightly linked to the major QTL for salt tolerance during maize germination period -qGRNS6.01 / qRGR6.01

[0037] (1) The applicant used the local maize germplasm Baima Ya (BMY) as the donor parent and the maize inbred line B73 as the recurrent parent to construct a BC4F4 CSSL population containing 318 cells. Young leaves were collected from the seedlings (6-leaf stage) of the CSSSL population constructed in this laboratory, DNA was extracted and stored at -80℃, and the SNP genotyping of the qualified DNA was performed by Boridi Biotechnology Co., Ltd. (Shijiazhuang, Hebei) using a 10K maize chip. GenomeStudio ( Quality control and genotype calling were performed on the 10K array using the PowerMarker v2011.1 software. SNP sequences were aligned to the B73-V3 reference genome using blastn. SNP data were selected for marker analysis using criteria such as minor allele frequency (MAF) ≥ 0.05, miss ratio < 0.10, and heterozygosity < 0.50. The obtained SNP genotyping data were analyzed for marker polymorphism information content (PIC) using PowerMarker v3.25.

[0038] (2) A total of 9843 SNP markers were obtained through genotyping. After screening, SNP markers with MAF ≤ 0.05, missratio > 0.10, and severe segregation deviation were eliminated, resulting in 2859 high-quality SNP markers, accounting for 26.30% of all SNP markers. The 2859 SNPs were relatively evenly distributed across the maize genome, with a distribution range of 201 (Chr07) to 415 (Chr01) on different chromosomes. The average physical distance of SNP markers across the whole genome was 0.75 Mb. The density of SNP markers on different chromosomes varied, ranging from 0.55 Mb (Chr10) to 0.98 Mb (Chr05). Genetic linkage maps are powerful tools for studying plant genome structure and evolution, and are an important foundation for gene mapping, cloning, and molecular marker-assisted breeding. In order to locate candidate genes related to drought resistance, this study used 2859 SNPs markers to construct a genetic linkage map with a total length of 4467.48 cM. The lengths of the 10 chromosome linkage groups ranged from 282.97 cM (Chr10) to 733.63 cM (Chr01). The average genetic distance of SNP markers in the whole genome was 1.56 cM. The density of SNP markers on different chromosomes was different, and its distribution range was: 1.02 cM (Chr10) to 2.00 cM (Chr02) ( Figure 1 , Table 2). Although the marker distribution density on different chromosomes varies, they all have a high density, which is suitable for fine positioning and mining of genes. The polymorphism information content (PIC) reflects the genetic variation. The average PIC value of the whole genome is 0.16, and the distribution range among different chromosomes is 0.14 (Chr10) to 0.19 (Chr02) (Table 2).

[0039] Table 2 Distribution of SNP markers on 10 chromosomes

[0040]

[0041] Note: PIC: Polymorphism coefficient

[0042] (3) The germination rates and relative germination rates of the 318 CSSL lines under salt stress in the three environments were statistically analyzed. The results showed that the germination rates under salt stress in the three environments were significantly lower than those in the control ( Figure 2 In addition, the distribution ranges of the control germination rate (CK), salt stress germination rate (Salt) and relative germination rate (Salt / CK) were 43% to 100%, 22% to 97% and 29% to 120%, respectively, and the coefficients of variation were 9.75% to 12.08%, 17.27% to 21.81% and 15.19% to 20.59%, all exceeding those of the parents, showing richer variation (Table 3). In addition, skewness and kurtosis analysis showed that the control germination rate, salt stress germination rate and relative germination rate of the population all showed a normal distribution (Table 3); correlation analysis showed that the three traits in the three environments showed a significant positive correlation ( Figure 2 After the experiment, the heritability of the three traits was calculated. The results showed that the heritability of control germination rate, salt stress germination rate and relative germination rate were 85.39%, 52.11% and 55.57%, respectively, indicating that the traits were largely controlled by genetic factors (Table 3) and could be directly used for subsequent QTL mapping.

[0043] Table 3 Statistical analysis of germination rate of CSSLs under salt stress

[0044]

[0045]

[0046] (4) Linkage analysis was performed by combining the CSSL population linkage map with the salt stress germination rate and relative germination rate (Salt / CK) phenotypes under three environments. A total of 17 QTLs related to germination period were detected, which were located on chromosomes 1, 3, 4, 6, 7, and 10. Among them, chromosome 6, 6.01 bin, could detect significant QTLs for both salt stress germination rate and relative germination rate, namely: qGRNS6.01 / qRGR6.01 ( Figure 3 Then, based on the QTL interval, the intersection of the same bin QTL was taken. qGRNS6.01 / qRGR6.01 was located between markers 6_34221420 and 6_63918493, with a physical distance of approximately 29.70 Mb, an average LOD value of 8.61, an average phenotypic contribution rate of 6.27%, and an average additive effect of -0.07 (Table 4).

[0047] Table 4 Relevant information of maize tolerance QTL during germination

[0048]

[0049] Example 2:

[0050] Development of KASP markers tightly linked to salt tolerance during germination in maize

[0051] Further analysis of the QTL in the example revealed that there were SNPs at both ends of the qGRNS6.01 / qRGR6.01 QTL, located at bases 34,221,420 and 63,918,493 on chromosome 6 of maize. KASP molecular marker development was performed for these two SNPs. Each primer set included three primers, including two fluorescently labeled primers containing the SNP site (FAM fluorescence, GAAGGTGACCAAGTTCATGCT, a primer information marker consistent with the B73 sequence; HEX fluorescence, GAAGGTCGGAGTCAACGGATT, a marker consistent with the BMY sequence) and a universal primer at the other end, which can quickly and easily perform SNP allele detection ( Figure 4 )

[0052] (1) KASP molecular marker development was performed for the SNPs at both ends of the qGRNS6.01 / qRGR6.01 QTL. First, the sequence near the SNP site was downloaded from the B73 reference genome, and KASP primers were designed based on the SNP site. According to the primer design principles, the KASP marker detection primer sequence was obtained as follows:

[0053] The primers for detecting bases 34, 221, and 420 on chromosome 6 of maize are:

[0054] 6_34221420Rt:GAAGGTGACCAAGTTCATGCTAGAGGTACATGATGCAGCGCT

[0055] 6_34221420Rg:GAAGGTCGGAGTCAACGGATTAGGTACATGATGCAGCGCC

[0056] 6_34221420F:TCGAAGTGCATTTGTGGACAG;

[0057] The primers for detecting base 63,918,493 of maize chromosome 6 are:

[0058] 6_63918493Ra:GAAGGTGACCAAGTTCATGCTTGATGTATGTGTTGACCATGTAAAGA

[0059] 6_63918493Rg:GAAGGTCGGAGTCAACGGATTGATGTATGTGTTGACCATGTAAAGG

[0060] 6_63918493F:ACTAATTTTCTTCGCTTTTTGGG.

[0061] (2) Using the genomic DNA of the maize CSSL population as a template, the above primers were used for fluorescence quantitative PCR amplification. The fluorescence signal was read using a TECAN infinite M1000 microplate reader. The online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was then used to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results were output according to different colors.

[0062] Using primer 6_34221420, the sequence amplified in B73 was: TCGAAGTGCATTTGTGGACAGCAGTGTAGCGCTGCATCATGTACCTCT.

[0063] Using primer 6_34221420, the sequence amplified in BMY was: TCGAAGTGCATTTGTGGACAGCAGTGTGGCGCTGCATCATGTACCT.

[0064] The sequence amplified in B73 using primer 6_63918493 is:

[0065] ACTAATTTTCTTCGCTTTTGGGGCAACATGCCTTGATTGTGGATGAGGAGTCTCCTAGTACTGCAGGAGAGGAAGAAATAGAAGATCAGAAATACCATTTCATGTCCCTTATGCTGAACCTGGTGAACACATTTCTTTACATGGTCAACACATACATCA

[0066] Using primer 6_63918493, the sequence amplified in BMY is:

[0067] ACTAATTTTCTTCGCTTTTGGGGCAACATGCCTTGATTGTGGATGAGGAGTCTCCTAGTACTGCAGGAGAGGAAGAAATAGAAGATCAGAAATACCATTTCATGTCCCTTATGCTGAACCTGGTGAACACATTCCTTTACATGGTCAACACATACATC.

[0068] That is, when the 34, 221, 420th base and the 63, 918, 493rd base of chromosome 6 of the corn to be tested are detected to be A and T respectively, it is salt-tolerant corn during the germination period; when the 34, 221, 420th base and the 63, 918, 493rd base of chromosome 6 of the corn to be tested are detected to be G and C respectively, it is judged to be salt-intolerant corn during the germination period.

[0069] Example 3:

[0070] Application of the prepared KASP marker in screening and breeding for salt tolerance during the germination period of maize:

[0071] (1) Creation of qGRNS6.01 / qRGR6.01 near-isogenic lines:

[0072] NIL B73 :B73 was used as the recurrent parent and Baima Ya as the donor parent. Four generations of hybridization, backcrossing and selfing were performed. Foreground selection (B73 salt tolerance QTL) and background selection (B73 genome) were performed. Finally, a near-isogenic line (NIL) with a genetic background highly similar to B73 (>95%) and carrying the target salt tolerance major effect QTL-qGRNS6.01 / qRGR6.01 was obtained. B73 );

[0073] NIL BMY :B73 was used as the recurrent parent and Baima Ya as the donor parent. Four generations of hybridization, backcrossing and selfing were performed. Foreground selection (Baima Ya QTL) and background selection (B73 genome) were performed. Finally, a near-isogenic line (NIL) with a genetic background highly similar to B73 (>95%) and without the target major effect QTL -qGRNS6.01 for salt tolerance was obtained. BMY ). Excellent inbred lines: Zheng 58, Chang 7-2, 6WC, 4CV.

[0074] (2) Hybridization design:

[0075] Experimental group: NIL B73 xchang 7-2, NIL B73 xZheng 58, NIL B73 x 6WC、NIL B73 x 4CV;

[0076] Control group: NIL BMY xchang 7-2, NIL BMY xZheng 58, NIL BMY x 6WC、NIL BMY x 4CV.

[0077] (3) Salt tolerance evaluation:

[0078] F1 representative phenotyping:

[0079] Salt stress conditions: 150 mM NaCl solution, germination in a light culture room, culture conditions: 16 h of light, temperature 28 ° C; 8 h of darkness, temperature 23 ° C.

[0080] Evaluation indicators: Normal growth until the root and seed are equal in length, and the sprout is half the length of the seed. Count the number of germinated seeds, analyze the germination rate and relative germination rate (Salt / Ck).

[0081] (4) Evaluation of the breeding effect of qGRNS6.01 / qRGR6.01: Four excellent maize inbred lines (Zheng 58, Chang 7-2, 6WC, 4CV) were selected and compared with two NIL lines (NIL) of qGRNS6.01 / qRGR6.01. B73 , NIL BMY ) hybridization, and obtained 8 F1 hybrid combinations, and their salt stress germination rate was investigated and identified. Based on the germination rate statistics of the 8 hybrid combinations, NIL B73 The germination rate and relative germination rate of the hybrid combination with four inbred lines under salt stress were significantly higher than those of NIL. BMY The hybrid combination of 4 inbred lines and NIL B73 The germination rate and relative germination rate ratio of F1 hybrids under salt stress were compared with those of NIL BMY The F1 obtained by hybridization increased by an average of 27.25% and 25.45% ( Figure 5 ), indicating NIL B73 The main salt-tolerance QTL-qGRNS6.01 / qR GR6.01 carried by the plant can significantly improve the salt tolerance of maize during the germination period under the background of heterosis.

[0082] The above results indicate that the prepared KASP molecular marker qGRNS6.01 / qRGR6.01 has a significant effect on salt tolerance of corn during the germination period and has a good effect.

Claims

1. Application of reagents for detecting bases 34, 221, 420 and 63, 918, 493 on chromosome 6 of maize in screening and breeding for salt tolerance during the germination period of maize.

2. The use according to claim 1, wherein the reagent is a primer.

3. The use according to claim 2, wherein the primer is a KASP detection primer, wherein: The primers for detecting bases 34, 221, and 420 on chromosome 6 of maize are: 6_34221420Rt:GAAGGTGACCAAGTTCATGCTAGAGGTACATGATGCAGCGCT 6_34221420Rg:GAAGGTCGGAGTCAACGGATTAGGTACATGATGCAGCGCC 6_34221420F:TCGAAGTGCATTTGTGGACAG; The primers for detecting base 63,918,493 of maize chromosome 6 are: 6_63918493RaGAAGGTGACCAAGTTCATGCTTGATGTATGTGTTGACCATGTAAAGA 6_63918493Rg:GAAGGTCGGAGTCAACGGATTGATGTATGTGTTGACCATGTAAAGG 6_63918493F:ACTAATTTTCTTCGCTTTTTGGG.

4. A method for screening and breeding corn for salt tolerance during germination, comprising detecting bases 34, 221, 420 and 63, 918, 493 of chromosome 6 using conventional protocols in the art, wherein the conventional protocols include: Sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry method.