PTK7 targeted nucleic acid aptamer coupling medicine and new application thereof

Abstract

The invention provides a PTK7 targeted nucleic acid aptamer coupled drug and application thereof, through research, drugs are coupled to the third end and the fifth end of a targeted PTK7 nucleic acid aptamer, it is found that the constructed drug is obviously different in stability and drug effect, aiming at a PTK7 target, the most preferable targeted nucleic acid aptamer and the most preferable drug are found, and the most suitable connexon is selected, so that the PTK7 targeted nucleic acid aptamer coupled drug is obtained. Based on a covalent coupling reaction of sulfydryl-maleimide, a PTK7 targeted aptamer coupling drug SM capable of remarkably improving the anti-tumor effect is constructed, and a new direction is provided for screening more efficient anti-tumor drugs.

Description

[0001] This application is a divisional application of the parent case 202411662863.5. Technical Field

[0002] The present invention belongs to the field of biotechnology, and in particular relates to a PTK7-targeted nucleic acid aptamer-coupled drug and an application thereof. Background Art

[0003] PTK7 (protein tyrosine kinase 7) is a receptor tyrosine kinase in the Wnt pathway, involved in Wnt signaling during hematopoiesis, somatic progenitor cell development, and stem cell development. It is overexpressed in multiple tumor types, including advanced triple-negative breast cancer, non-small cell lung cancer, ovarian cancer, colorectal cancer, gastric cancer, and esophageal cancer. Furthermore, PTK7 expression is associated with lymph node metastasis and is highly expressed in tumor-initiating cells (TICs) or cancer stem cells (CSCs), as well as stromal cells, which are closely associated with tumor recurrence and progression. The development of targeted drugs targeting PTK7 is expected to overcome the limited efficacy of drugs for malignancies such as triple-negative breast cancer and non-small cell lung cancer. For example, Chinese patent application publication number CN 113491773 A discloses an artemisinin derivative aptamer-drug conjugate, its preparation method, and its use. By conjugating a PTK7-targeting aptamer to the drug molecules, Compretin, and artemisinin, the PTK7-targeting aptamer-drug conjugate effectively inhibits cells and tumors with high PTK7 expression. Although existing aptamer-drug conjugates have demonstrated some anti-tumor efficacy in the treatment of certain tumors, there is still a lack of highly effective anti-tumor aptamer-drug conjugates for tumors such as non-small cell lung cancer and colorectal cancer. Therefore, there is an urgent need to develop a PTK7-targeted aptamer-drug conjugate with greater stability and efficacy, and to fully validate its anti-tumor efficacy. Summary of the Invention

[0004] To address the above-mentioned problems, the present invention provides a PTK7-targeting aptamer-coupled drug and its application. By studying the coupling of drugs at the 3' and 5' ends of the PTK7-targeting aptamer, it was found that the constructed drugs had obvious differences in stability and efficacy. Targeting the PTK7 target, the most preferred targeting aptamer and the most preferred drug were found, and the most suitable linker was selected. Based on the covalent coupling reaction of thiol-maleimide, a PTK7-targeting aptamer-coupled drug SM with significantly improved anti-tumor effect was constructed, providing a new direction for screening more efficient anti-tumor drugs.

[0005] In one aspect, the present invention provides a PTK7-targeting aptamer-drug conjugate, comprising a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 3' end of the aptamer.

[0006] This study explores the specific preparation process and structure of aptamer-drug conjugates targeting PTK7, hoping to develop safer and more effective anti-tumor drugs by providing more detailed insights. By comparing the plasma stability of the constructed aptamer-drug conjugates by conjugating the drug to the 5'- and 3'-termini of the PTK7-targeting aptamer, it was found that the drug conjugated to the 3'-terminus of the PTK7-targeting aptamer exhibited better stability and was less susceptible to degradation during long-term incubation in plasma, suggesting that it could be used to prepare more promising anti-tumor drugs.

[0007] Furthermore, the nucleic acid aptamer targeting PTK7 has a sequence as shown in SEQ ID No. 1 in the sequence listing.

[0008] By screening more suitable nucleic acid aptamers targeting PTK7 and using them to construct nucleic acid aptamer-conjugated drugs, it is helpful to improve their affinity with the target, thereby improving the targeting effect.

[0009] Furthermore, the drug is the auristatin microtubule inhibitor MMAE.

[0010] Compared with other drugs, the drug constructed by coupling MMAE with a nucleic acid aptamer targeting PTK7 has a better tumor inhibition effect.

[0011] However, MMAE can only be coupled to the 3' end of the aptamer to produce a highly stable drug. When coupled to the 5' end, the stability is unsatisfactory and the anti-tumor efficacy cannot be fully exerted. The present invention, through in-depth research on aptamer-drug conjugates constructed with MMAE, ultimately successfully obtained an aptamer-drug conjugate SM that is highly stable, has excellent targeting effects, and significantly stronger anti-tumor effects. This fully unleashes the efficacy of MMAE and fully taps its anti-tumor potential.

[0012] Furthermore, the linker is a Vc linker, and the linker-containing drug has the following structural formula:

[0013]

[0014] Furthermore, the PTK7-targeting nucleic acid aptamer and the linker-containing drug are prepared through a covalent coupling reaction based on thiol-maleimide.

[0015] Furthermore, the structural formula of the PTK7-targeting aptamer-drug conjugate is as follows:

[0016]

[0017] The ribbon with thiol groups is a nucleic acid aptamer targeting PTK7.

[0018] On the other hand, the present invention provides a use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving plasma stability, wherein the aptamer-drug conjugate comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 3' end of the aptamer.

[0019] Studies have shown that when the aptamer-drug conjugated to the PTK7-targeting drug is coupled to the 3' end of the aptamer, the amount of nucleic acid fragmentation in plasma is significantly increased compared to when the drug is coupled to the 5' end of the aptamer. The higher the amount of nucleic acid fragmentation, the less likely it is to break. In other words, coupling the drug to the 3' end of the aptamer can significantly improve stability.

[0020] Furthermore, the nucleic acid aptamer is Sgc8, having the sequence shown in SEQ ID No. 1 in the sequence listing; the drug is the auristatin microtubule inhibitor MMAE, and the linker is a Vc linker.

[0021] In another aspect, the present invention provides a use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving tumor inhibition effects, wherein the aptamer-drug conjugate comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 3' end of the aptamer.

[0022] Furthermore, the nucleic acid aptamer targeting PTK7 has a sequence as shown in SEQ ID No. 1 in the sequence listing; the drug is an auristatin-type microtubule inhibitor; and the tumor includes any one or more of colorectal cancer, lung cancer, ovarian cancer, breast cancer, and pancreatic cancer.

[0023] In some embodiments, the auristatin-type tubulin inhibitor is MMAE, and the linker is a Vc linker.

[0024] As previously mentioned, the 3-terminal-coupled drug SM of the PTK7-targeting aptamer exhibits improved stability in plasma and is less susceptible to degradation after long-term incubation. Therefore, theoretically, when delivered in vivo, the 3-terminal-coupled drug of the PTK7-targeting aptamer may exhibit better anti-tumor efficacy than the 5-terminal-coupled drug MS. However, greater drug stability does not necessarily guarantee higher anti-tumor activity. Whether anti-tumor activity can be enhanced depends on whether the aptamer-coupled drug structure itself promotes drug activity.

[0025] Extensive research has shown that, for most tumor cells, the anti-tumor activity of the drug SM coupled to the 3-terminus of the nucleic acid aptamer is significantly improved compared to the drug MS coupled to the 5-terminus of the nucleic acid aptamer. This may be because when the nucleic acid aptamer targeting PTK7 is coupled to the 3-terminus, its conformation is more conducive to the anti-cancer activity of the MMAE drug.

[0026] However, the anticancer activity of the aptamer-coupled drug differs significantly for different tumor cells. The present invention verifies the inhibitory effects of drugs coupled to the 3- or 5-terminal ends of aptamers targeting PTK7 on a variety of different tumors. It is found that for some tumor cells, such as pancreatic cancer, lung cancer, breast cancer, colon cancer, and ovarian cancer, the inhibitory effect of drugs coupled to the 3-terminal end of aptamers targeting PTK7 is significantly better than that of drugs coupled to the 5-terminal end. The most obvious effect is in breast cancer and pancreatic cancer cells, where the 3-terminal-coupled drug can achieve almost 100% inhibition rate. However, in some tumor cells, such as soft tissue sarcoma and bladder cancer Scaber cells, the inhibitory effect of drugs coupled to the 3-terminal end of aptamers targeting PTK7 is not significantly different from that of drugs coupled to the 5-terminal end. In osteosarcoma, thymic carcinoma, and central nervous system tumor cells, drugs coupled to the 3-terminal end of aptamers targeting PTK7 are even slightly worse than those coupled to the 5-terminal end. This also shows that the higher the stability, the better the tumor inhibition effect, but that it is necessary to analyze them separately for different tumor cells.

[0027] It is understood that the tumor-suppressing activity of aptamer-drug conjugates is related to the following four aspects: 1. The sequence of the aptamer; 2. The drug conjugated to the aptamer; 3. The linker; and 4. The connection method. These four aspects complement each other and work together to enhance the anti-tumor effect.

[0028] First, regarding aptamer sequences, different tumor cells bind to different receptors, resulting in varying binding strengths. The same aptamer sequence may have stronger targeting ability in some tumor cells but weaker targeting ability in others. Therefore, designing aptamers with specific sequences for drug conjugation is essential for different tumor cell types. However, aptamers with stronger targeting efficacy do not necessarily lead to higher tumor inhibitory activity. It is important to comprehensively consider whether the aptamer's conformation is optimized after drug conjugation to effectively release the drug's activity. Second, regarding drug selection, different drugs exhibit varying inhibitory activity against different tumor cell types. Some drugs are highly effective against specific tumor cell types but less so against others. Therefore, it is important to select the appropriate drug for each tumor cell type. Furthermore, after conjugating a drug to an aptamer, it is important to consider the impact of the conjugation method on the conformation and its effect on drug efficacy, including whether changes in the spatial structure caused by different linkers may affect drug activity. Linkers play a crucial role in this process; their spatial conformation, affinity, and binding efficiency can all influence drug efficacy. Choosing different linkers can significantly alter drug efficacy. Finally, the choice of linker is crucial: whether the aptamer is conjugated to the drug via its 5' or 3' end. This linker method can influence the aptamer's sequence stability and targeting efficacy, while also significantly impacting the release of active drug activity. In summary, comprehensive consideration of the aptamer, linker, drug, and linker method is crucial to selecting the appropriate combination for a specific tumor cell. This allows for the development of an aptamer-drug conjugate that effectively inhibits that tumor cell and enhances anti-tumor efficacy.

[0029] Furthermore, the tumors include lung cancer, breast cancer and pancreatic cancer.

[0030] In some approaches, particularly for pancreatic and breast cancer, the aptamer-3-terminus-coupled drug (SM) constructed by the present invention can achieve a 100% tumor inhibition rate against these cancers, significantly improving efficacy and demonstrating significant potential. This may be due to the aptamer (SEQ ID No. 1) targeting PTK7, when coupled to the drug MMAE at its 3-terminus with a Vc linker, resulting in a drug SM that is particularly suitable for the treatment of pancreatic and breast cancer.

[0031] In another aspect, the present invention provides a use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving tumor inhibition effects, wherein the aptamer-drug conjugate comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 5-end of the aptamer, and the PTK7-targeting aptamer has a sequence as shown in SEQ ID No. 1 in the sequence listing; the drug is the auristatin-type microtubule inhibitor MMAE, and the linker is a Vc linker; the tumor comprises any one or more of osteosarcoma, thymic carcinoma, and central neurocytoma.

[0032] Studies have shown that for osteosarcoma, thymic carcinoma, and central neurocytoma, the drug MS constructed by using a PTK7-targeting nucleic acid aptamer (SEQID No. 1) and coupling the drug MMAE at the 5-terminus with a Vc linker can significantly improve the inhibitory effect on ovarian cancer cells. Therefore, it is recommended for the treatment of osteosarcoma, thymic carcinoma, and central neurocytoma.

[0033] Furthermore, the structural formula of the drug coupled to the 5-end of the nucleic acid aptamer is as follows:

[0034]

[0035] In another aspect, the present invention provides use of sgc8c for preparing a reagent for improving the targeting property of a nucleic acid aptamer-drug conjugate targeting PTK7, wherein the sgc8c has a sequence as shown in SEQ ID No. 1 in the sequence listing.

[0036] Studies have shown that compared with other nucleic acid aptamers, the nucleic acid aptamer-drug conjugate targeting PTK7 prepared using sgc8c has better affinity with the target protein and more obvious targeting effect, thereby improving the anti-tumor effect.

[0037] In another aspect, the present invention provides the use of MMAE with a Vc linker for preparing a reagent for improving the efficacy of a nucleic acid aptamer-drug conjugate targeting PTK7, wherein the drug containing the Vc linker has the following structural formula:

[0038]

[0039] Compared with other linkers, the PTK7-targeted nucleic acid aptamer-drug conjugate constructed using the Vc linker has better anti-tumor efficacy.

[0040] The present invention has the following beneficial effects:

[0041] (1) It was found that the blood stability of the PTK7-targeting aptamer conjugated with a drug at the 3' end was significantly improved compared with that of the 5' end conjugated drug;

[0042] (2) We screened different PTK7-targeting aptamers and found that sgc8c significantly improved the targeting effect compared with other aptamers, and thus the constructed aptamer-drug conjugates could also significantly improve the efficacy;

[0043] (3) Comparison of the differences between SMs constructed with different linkers to further improve the anti-tumor efficacy;

[0044] (4) Construct a PTK7-targeted nucleic acid aptamer-coupled drug that can significantly improve the anti-tumor effect and inhibit a variety of malignant tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 is the mass spectrum of the SM prepared in Example 1;

[0046] Figure 2 is the mass spectrum of the MS prepared in Example 2;

[0047] Figure 3 is the mass spectrum of SD prepared in Example 3;

[0048] Figure 4 This is a schematic diagram of the results of nucleic acid fragmentation detection of SM and MS in Example 4 at different time points after incubation in mouse plasma in vitro;

[0049] Figure 5 Schematic diagram of the affinity test results between SM and human PTK7 protein in Example 5;

[0050] Figure 6 Schematic diagram of the affinity test results between JHG35-2AM and human PTK7 protein in Example 5;

[0051] Figure 7 Schematic diagram of the affinity test results between CJH-C4M and human PTK7 protein in Example 5;

[0052] Figure 8 This is a schematic diagram showing the comparative results of the cytotoxicity of SM and SD in Example 6;

[0053] Figure 9 This is a schematic diagram of the results of SM's inhibition of HT-29 cell proliferation in Example 7;

[0054] Figure 10 This is a schematic diagram of the results of SM's inhibition of NCI-H1975 cell proliferation in Example 7;

[0055] Figure 11 This is a schematic diagram of the results of SM's inhibition of SKOV3 cell proliferation in Example 7;

[0056] Figure 12 Schematic diagram of the results of SM's inhibition of SUM159 cell proliferation in Example 7;

[0057] Figure 13 This is a schematic diagram of the inhibitory effect of SM on HT-29 tumor volume in Example 8;

[0058] Figure 14 This is a schematic diagram of the inhibitory effect of SM on HT-29 tumor volume ratio in Example 8;

[0059] Figure 15 This is a schematic diagram showing the effect of SM on the body weight of mice in Example 8;

[0060] Figure 16 This is a schematic diagram showing the effect of SM on the body weight ratio of mice in Example 8;

[0061] Figure 17 This is a schematic diagram showing the inhibitory effect of SM on human lung cancer NCI-H1975 tumor volume in Example 9;

[0062] Figure 18 This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of human lung cancer NCI-H1975 in Example 9;

[0063] Figure 19 This is a schematic diagram of the effect on mouse body weight in Example 9;

[0064] Figure 20 This is a schematic diagram of the effect of the weight ratio of mice in Example 9;

[0065] Figure 21 This is a schematic diagram showing the inhibitory effect of SM on human ovarian cancer SKOV3 tumor volume in Example 10;

[0066] Figure 22 This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of human ovarian cancer SKOV3 in Example 10;

[0067] Figure 23 This is a schematic diagram of the effect on mouse body weight in Example 10;

[0068] Figure 24 Schematic diagram of the effect of the weight ratio of mice in Example 10;

[0069] Figure 25 Schematic diagram of the inhibitory effect of SM on human breast cancer SUM159 tumor volume in Example 11;

[0070] Figure 26 Schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human breast cancer SUM159 in Example 11;

[0071] Figure 27 This is a schematic diagram of the effect on mouse body weight in Example 11;

[0072] Figure 28 This is a schematic diagram showing the effect of the weight ratio of mice in Example 11;

[0073] Figure 29 This is a schematic diagram of the inhibitory effect of SM on human pancreatic cancer MIA PaCa-2 tumor volume in Example 12;

[0074] Figure 30 This is a schematic diagram of the inhibitory effect of SM on the tumor volume ratio of human pancreatic cancer MIA PaCa-2 in Example 12;

[0075] Figure 31 This is a schematic diagram of the effect on mouse body weight in Example 12;

[0076] Figure 32 This is a schematic diagram of the effect of the weight ratio of mice in Example 12;

[0077] Figure 33 This is a schematic diagram showing the inhibitory effect of SM on human lung cancer A549 tumor volume in Example 13;

[0078] Figure 34 This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of human lung cancer A549 in Example 13;

[0079] Figure 35 This is a schematic diagram of the effect on mouse body weight in Example 13;

[0080] Figure 36 This is a schematic diagram of the effect of the weight ratio of mice in Example 13;

[0081] Figure 37 This is a schematic diagram of the inhibitory effect of SM on pancreatic cancer PDX tumor volume in Example 14;

[0082] Figure 38 This is a schematic diagram of the inhibitory effect of SM on pancreatic cancer PDX tumor volume ratio in Example 14;

[0083] Figure 39 This is a schematic diagram of the effect on mouse body weight in Example 14;

[0084] Figure 40 This is a schematic diagram of the effect of the weight ratio of mice in Example 14;

[0085] Figure 41 This is a schematic diagram showing the inhibitory effect of SM on breast cancer MDA-MB-468 tumor volume in Example 15;

[0086] Figure 42 This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of breast cancer MDA-MB-468 in Example 15;

[0087] Figure 43 This is a schematic diagram of the effect on mouse body weight in Example 15;

[0088] Figure 44 This is a schematic diagram of the effect of the weight ratio of mice in Example 15;

[0089] Figure 45 This is a schematic diagram of the inhibitory effect of SM on ovarian cancer OVCAR3 tumor volume in Example 16;

[0090] Figure 46This is a schematic diagram showing the inhibitory effect of SM on the tumor volume ratio of ovarian cancer OVCAR3 in Example 16;

[0091] Figure 47 This is a schematic diagram of the effect on mouse body weight in Example 16;

[0092] Figure 48 This is a schematic diagram of the effect of the weight ratio of mice in Example 16;

[0093] Figure 49 This is a schematic diagram of the inhibitory effect of SM on pancreatic cancer BxPC3 tumor volume in Example 17;

[0094] Figure 50 This is a schematic diagram of the inhibitory effect of SM on the tumor volume ratio of pancreatic cancer BxPC3 in Example 17;

[0095] Figure 51 This is a schematic diagram of the effect on mouse body weight in Example 17;

[0096] Figure 52 This is a schematic diagram of the effect of the weight ratio of mice in Example 17;

[0097] Figure 53 This is a schematic diagram of the inhibitory effect of SE on colorectal cancer HT-29 tumor volume in Example 21;

[0098] Figure 54 This is a schematic diagram of the inhibitory effect of SE on the tumor volume ratio of colorectal cancer HT-29 cells in Example 21;

[0099] Figure 55 This is a schematic diagram of the effect on mouse body weight in Example 21;

[0100] Figure 56 This is a schematic diagram of the effect of the weight ratio of mice in Example 21;

[0101] Figure 57 This is a diagram showing the tumor inhibition effect of SM on Scaber tumors treated with intravesical instillation in Example 22. DETAILED DESCRIPTION

[0102] The present invention will be further described in detail below with reference to the accompanying drawings and examples. It should be noted that the following examples are intended to facilitate understanding of the present invention and do not have any limiting effect on the present invention.

[0103] Example 1. Preparation of PTK7-targeted nucleic acid aptamer 3-terminus coupled drug SM

[0104] This example prepared a PTK7 (sgc8c, a public sequence) aptamer-drug conjugate (SM) with a VcMMAE (MMAE drug with a Vc linker) drug coupled to its 3-terminus. SM was synthesized using a thiolmaleimide chemical reaction, as shown in the following reaction formula:

[0105]

[0106] Among them, the ribbon with thiol group is nucleic acid aptamer, and DMTr is dimethoxytrityl protecting group.

[0107] The preparation process is as follows:

[0108] (1) Preparation of thiol-modified PTK7 aptamer aqueous solution:

[0109] First, it is necessary to synthesize compound a in the above reaction formula. Compound a is directly synthesized in a solid phase synthesizer (K&A H8). The synthesis reaction formula is as follows (the synthesis process of compound a is a conventional technical means in the art):

[0110]

[0111] Controlled-pore glass (3'thiol SS CPG) beads modified with thiol groups were used as the solid-phase support for the synthesis reaction. The synthesis reagents were rigorously dehydrated and deoxygenated during the reaction. The nucleic acid sequence (sgc8c: 5'-3': ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) (SEQ ID No. 1) was input into the solid-phase synthesizer control software. The bases were coupled sequentially from the 3' to the 5' position, ultimately yielding the target oligonucleotide chain.

[0112] After the synthesis is completed, the solid phase support part (compound a) is rinsed with acetonitrile and dried, and then treated with 30% concentrated ammonia water for aminolysis to remove the protecting groups on the oligonucleotide chain and hydrolyze it from the support. After the heat treatment is completed, the reaction solution is cooled, and 10% of the volume of 3M sodium chloride solution is added according to the volume of ammonia water added. After mixing, anhydrous ethanol is added according to 2.5 times the volume of ammonia water added. Mix again, and a white flocculent precipitate is produced, which is the crude product obtained by synthesis. Centrifuge to remove the supernatant and dry as much as possible, then add pure water to redissolve, filter to obtain the crude product, purify using HPLC, and collect the corresponding fractions. Add 40% acetic acid aqueous solution to treat, remove the DMT protecting group to expose the 5' terminal hydroxyl group, and obtain compound I.

[0113] At this time, the thiol group of the nucleic acid aptamer product was protected by a disulfide bond and reduced using 20 times the equivalent of TCEP. After that, desalting and removing small molecules, an aqueous solution of the PTK7 nucleic acid aptamer modified with thiol groups at the three ends (Compound II) was obtained.

[0114] (2) Preparation of nucleic acid aptamer-drug conjugate SM:

[0115]

[0116] Add an aqueous solution of PTK7 nucleic acid aptamer modified with 3' thiol groups (1 equivalent), and a mixed solution of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) (2-30 equivalents, preferably 3 equivalents) of Auristatin microtubule inhibitor VcMMAE (CAS: 646502-53-6, purchased from Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) with a Vc linker into a centrifuge tube. Keep the temperature at 4-40°C, preferably 25°C, and stir the reaction for 2-24 hours, preferably 12 hours. Purify by reverse phase preparative column and freeze-dry to obtain PTK7 nucleic acid aptamer-coupled drug SM (Sgc8c-MMAE) coupled with MMAE at the 3' end with a yield of about 75%. After desalting, freeze-dry for use. Mass spectrometry is shown in FIG. Figure 1 As shown, SM: Calculated: 14147.1 (Found: 14147).

[0117] This example also uses different PTK7-targeting aptamers JHG35-2A (ATAACGGATTGCCACGCCGCCGGGTTTTCTTCGTACGGGTCGTTAT, SEQ ID No. 2) and CJH-C4 (GTTCGTGGTGTGCTGGATGTCCCGGGGGGGGCTTGTCGGTTTTCCAGGGGTGGGAGTGACACATCCAGCAGCACGA, SEQ ID No. 3). According to the same method provided in this example, VcMMAE was coupled at the 3-end to construct JHG35-2AM and CJH-C4M, and the successful preparation was verified by mass spectrometry.

[0118] Example 2: Preparation of PTK7-targeted nucleic acid aptamer 5-terminus-coupled drug MS

[0119] In this example, a PTK7 (sgc8c: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) nucleic acid aptamer-drug MS with a VcMMAE drug coupled to the 5-terminus was prepared. MS was synthesized using a thiol maleimide chemical reaction, as shown in the following reaction formula:

[0120]

[0121] Among them, the ribbon with thiol is a nucleic acid aptamer, DMTr is a dimethoxytrityl protecting group, It is a solid phase carrier.

[0122] The preparation process is as follows:

[0123] (1) Preparation of thiol-modified PTK7 aptamer aqueous solution:

[0124] Controlled-pore glass (CPG) beads were used as a solid-phase support for the synthesis reaction. The synthesis reagents required rigorous dehydration and deoxygenation during the reaction. The nucleic acid sequence (sgc8c: 5'-3': ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA) (SEQ ID No. 1) was input into the solid-phase synthesizer control software. Bases were coupled sequentially from the 3' to the 5' end, and a thiol phosphoramidite monomer was introduced at the 5' end to modify the target oligonucleotide chain. After synthesis, the solid-phase support was rinsed with acetonitrile and dried. The oligonucleotide chain was then treated with 30% concentrated ammonia to remove protecting groups and hydrolyze it from the support. After heating, the reaction mixture was cooled, and 10% by volume of 3M sodium chloride solution (based on the volume of ammonia added) was added. After mixing, anhydrous ethanol (2.5 times the volume of ammonia added) was added. Mixing again resulted in a white, flocculent precipitate, representing the crude product. The supernatant was removed by centrifugation and dried to a minimum, then reconstituted with purified water. The crude product was filtered and purified using HPLC, with the corresponding fractions collected. The thiol groups of the aptamer product were now disulfide-protected and reduced using 20 equivalents of TCEP. After desalting to remove small molecules, an aqueous solution of the 5-terminal thiol-modified PTK7 aptamer was obtained.

[0125] (2) Preparation of nucleic acid aptamer-drug conjugate MS:

[0126] A 5'-terminal thiol-modified PTK7 nucleic acid aptamer aqueous solution (1 equivalent) and a mixed solution of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) of an auristatin microtubule inhibitor VcMMAE with a Vc linker (2-30 equivalents, preferably 3 equivalents) were added to a centrifuge tube. The temperature was maintained at 4-40°C, preferably 25°C, and the reaction was stirred for 2-24 hours, preferably 12 hours. Purification was performed on a reverse phase preparative column and freeze-dried to obtain the 5'-terminal MMAE-coupled PTK7 nucleic acid aptamer-drug MS (MMAE-Sgc8c) with a yield of about 70%. The product was desalted and freeze-dried for later use. The mass spectrometry was as follows. Figure 2 As shown, MS: Calculated: 14147.1 (Found: 14147).

[0127] Example 3. Preparation of ApDC coupled with different drugs

[0128] In this example, two nucleic acid aptamer-drug conjugates (SDs) were prepared, one of which was PTK7 (sgc8c, a publicly available sequence) coupled to the GGFG-Dxd (Deruxtecan) drug at its 3-terminus. SDs were synthesized using a thiolmaleimide chemical reaction, and the reaction formulas are as follows:

[0129]

[0130] (1) The preparation process of the thiol-modified PTK7 nucleic acid aptamer aqueous solution is shown in Example 1.

[0131] (2) Preparation of nucleic acid aptamer-coupled drug SD:

[0132] Add an aqueous solution of PTK7 nucleic acid aptamer modified with 3'-thiol group (1 equivalent), a mixed solution of DNA topoisomerase I inhibitor Deruxtecan (CAS No.: 1599440-13-7, purchased from Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) in acetonitrile / water (1 / 5-3 / 1, preferably 1 / 1) (2-30 equivalents, preferably 3 equivalents) to a centrifuge tube, maintain the temperature at 4-40°C, preferably 25°C, and stir the reaction for 2-24 hours, preferably 12 hours. Purify by reverse phase preparative column and freeze-dry to obtain PTK7 nucleic acid aptamer-coupled drug SD (Sgc8c-Deruxtecan) with 3'-end coupled to Deruxtecan, with a yield of about 75%. After desalting, freeze-dry for use. Mass spectrometry is shown in FIG. Figure 3 As shown, SD: Calculated: 13778 (Found: 13778).

[0133] Example 4. Comparison of Plasma Stability of Drugs Conjugated to Different Sites of Aptamers

[0134] This example uses the SM of a three-terminal drug and the MS of a five-terminal drug prepared in Example 1 and Example 2, respectively, for comparative experiments on the in vitro plasma stability of drugs. The specific process is as follows:

[0135] SM and MS were added to mouse plasma at a final concentration of 20 μM, respectively, and incubated in a constant temperature shaker at 37°C and 200 rpm for 5 different time points (0h, 0.5h, 1h, 2h, 4h). The nucleic acids in the incubated samples were separated by 10% denaturing PAGE, and blank mouse plasma, SM pure chain and MS pure chain were set as control groups. The electrophoresis conditions were: 160V, 60min, and the sample loading amount was 2μM. After the electrophoresis, 1×Gel Red was used to stain in the dark for 5 minutes. After the staining, the gel was washed two to three times, and the Cy3 channel was selected for gel imaging. Image Quant was used for data processing to further analyze the amount of nucleic acid fragmentation of SM and MS at different time points after incubation in mouse plasma in vitro. The results are shown in the figure. Figure 4 As shown in the figure, the amount of nucleic acid fragmentation in SM at different time points of incubation in mouse plasma in vitro was higher than that in MS, and MS showed almost complete fragmentation after 4 hours of incubation. This indicates that the stability of the Sgc8 aptamer with a 3-terminal drug conjugation is significantly improved compared to the 5-terminal drug conjugation, indicating that the 3-terminal drug-modified ApDC has higher stability. Higher drug stability can prevent drug degradation during in vivo transport when administered via intravenous injection, thereby enhancing drug efficacy. Therefore, it can be inferred that SM also has better efficacy than MS.

[0136] Example 5: SPR Characterization of Different PTK7 Aptamer-Drug Conjugates

[0137] In this comparative example, the binding of SM prepared in Example 1 and two other PTK7 aptamer-drug conjugates, JHG35-2AM and CJH-C4M, to human PTK7 protein was characterized by SPR experiments.

[0138] The specific process is as follows:

[0139] Human PTK7 protein was fixed on the CM5 chip using pH 4.5 NaAC buffer, where His protein was used as a control protein and ethanolamine solution was used to block unreacted carboxyl groups in the chip. SM, JHG35-2AM, and CJH-C4M samples diluted with mobile phase (DPBS solution containing 5mM MgCl2) were then passed through the chip surface in descending order of concentration, with 180s of binding and 180s of dissociation at a flow rate of 30μL / min. Finally, after each cycle, 1.5M NaCl solution was used for regeneration at a flow rate of 30μL / min for 30s. The equilibrium dissociation constant Kd was obtained by analysis with Biacore Insight Evaluation software, as shown in the following figure. Figure 5 、 6 、7. Figure 5 It can be seen that SM binds most strongly to human PTK7 protein, with a Kd value of 2.97nM. Figure 6 It was found that the binding ability of JHG35-2AM to human PTK7 protein was similar to that of SM, with a Kd value of 7.48nM. Figure 7 As shown, CJH-C4M binds relatively weakly to the human PTK7 protein, with a Kd value of 34.2 nM. Its slow binding and rapid dissociation result in a higher Kd value. This suggests that the aptamer in SM has a better affinity for the target human PTK7 protein, resulting in a more targeted effect and contributing to improved efficacy.

[0140] Example 6: Comparison of cytotoxicity of different drugs: SM, SD, and SE

[0141] HT-29 cells were seeded into 96-well plates (3000 cells per well), cultured at 37°C, 5% carbon dioxide for 24 hours, and PTK7 nucleic acid aptamer drugs SM (Sgc8c-MMAE) (prepared in Example 1), SD (Sgc8c-Dxd) (prepared in Example 3), and SE (prepared in Example 20) of the same concentration but different conjugated drugs were added. After culturing at 37°C, 5% carbon dioxide for 24 hours, the drug-containing culture medium was discarded and replaced with a drug-free culture medium for a further 96 hours. After a total of 120 hours, the inhibitory effect of the drug was determined using a CCK8 kit. The results are as follows: Figure 8 As shown. Figure 8 It can be seen that the inhibitory effects of aptamer-coupled drugs SM, SD, and SE on colorectal HT-29 cells gradually increase with the increase of drug concentration, and the inhibitory activity is SE>SM>SD, among which the IC50 of SE is about 60nM, the IC50 of SM is about 250nM, and the IC50 of SD is about 2500nM.

[0142] Example 7: Effect of Aptamer-Drug Conjugates on the Inhibition of Malignant Cell Proliferation

[0143] In this example, the SM prepared in Example 1 was used in proliferation inhibition experiments on human colorectal cancer HT-29, human lung cancer NCI-H1975, human ovarian cancer SKOV3, human breast cancer SUM159, and osteosarcoma Saos-2 cells. The specific process is as follows:

[0144] HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells were seeded into 96-well plates (3000 cells per well) and cultured at 37°C, 5% CO2 for 24 hours. Different concentrations of the PTK7 aptamer drug SM (Sgc8c-MMAE) were then added. After 24 hours of culture at 37°C, 5% CO2, the drug-containing medium was discarded and replaced with drug-free medium for an additional 96 hours (SUM159 cells were cultured for 48 hours). After a total of 120 hours (72 hours for SUM159 cells), the inhibitory effect of the drug was determined using a CCK8 assay.

[0145] This example investigates the results of SM's inhibition of cell proliferation on HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells. Figure 9-12 The results of SM's inhibition of HT-29, NCI-H1975, SKOV3, and SUM159 cell proliferation are shown. Figure 9 The results of SM's inhibition of HT-29 cell proliferation are as follows: Figure 9 It can be seen that SM has a good inhibitory effect on human colorectal cancer HT-29 cells, with an IC50 value of 250nM. Figure 10The results of SM inhibition on NCI-H1975 cell proliferation are as follows: Figure 10 It can be seen that SM has a good inhibitory effect on human lung cancer NCI-H1975 cells, with an IC50 value of 131nM. Figure 11 The results of SM's inhibition of SKOV3 cell proliferation are as follows: Figure 11 It can be seen that SM has a good inhibitory effect on human ovarian cancer SKOV3 cells, with an IC50 value of 500nM. Figure 12 The results of SM's inhibition of SUM159 cell proliferation are as follows. Figure 12 It can be seen that SM has a good inhibitory effect on human breast cancer SUM159 cells, with an IC50 value of 105nM.

[0146] In this example, the inhibitory effect of MS on the proliferation of HT-29, NCI-H1975, SKOV3, SUM159, and Saos-2 cells was also investigated under the same conditions. The results were compared with those of SM in Table 1. A lower IC50 value indicates a higher activity in inhibiting tumor cells.

[0147] Table 1. Results of SM and SM inhibition on tumor cell proliferation

[0148]

[0149] As shown in Table 1, with the exception of osteosarcoma Saos-2, the SMs prepared from aptamers with 3-terminal drug conjugation exhibited significantly better inhibition of tumor cell proliferation than the MSs prepared from PTK7 aptamers with 3-terminal drug conjugation, with significantly lower IC50 values. This difference was particularly pronounced, with the IC50 value for human breast cancer SUM159 cells reduced by over 50%. This suggests that conjugating drugs to the 3-terminal end of aptamers can enhance the inhibitory effect on tumor cell proliferation.

[0150] Example 8: Effect of Aptamer-Drug Conjugates on Tumor Inhibition of Colorectal Cancer HT-29

[0151] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a colorectal cancer HT-29 xenograft tumor model. The specific process is as follows:

[0152] A colorectal cancer cell HT-29 cell-bearing mouse model was established with a tumor volume of 100-200 mm 324 mice were randomly divided into 6 groups. SM was divided into different dose groups of 3.5 mg / kg (0.25 μmol / kg), 7 mg / kg (0.5 μmol / kg), and 10.5 mg / kg (0.75 μmol / kg), different dosing times, and different dosing intervals. The Saline group and the SM group were administered by tail vein every four days, for a total of 5, 7, and 8 times, respectively. The SM group was administered by tail vein every 7 days, for a total of 5 times. The weight of the mice, the length (a) and the width (b) of the tumor were measured and recorded at each injection. The calculation formula for tumor volume (V) is: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 13-14 As shown, compared with the Saline group, the tumors of mice in the SM group were effectively inhibited. The inhibition rate of the SM 3.5mg / kg q4d×8 group was 42%, the inhibition rate of the SM 7mg / kg q7d×5 group was 68%, the inhibition rate of the SM 7mg / kg q4d×5 group was 98%, the inhibition rate of the SM 7mg / kg q4d×7 group was 94.5%, and the inhibition rate of the SM 10.5mg / kgq7d×5 group was 96%. At the same time, the body weight of the mice was observed, and the results are shown as follows: Figure 15-16 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group. Therefore, the most preferred group was the SM 7 mg / kg q4d×5 group, which was administered via tail vein every four days for a total of 5 doses.

[0153] Compared with the tumor inhibitory effect of SE in the HT-29 tumor model in Example 21, although SE had higher cytotoxicity than SM at the same concentration in Example 6, SM (0.5 μmol / kg) showed better in vivo tumor inhibitory effect at a lower dose than SE (2 μmol / kg), indicating that MMAE is a more preferred drug molecule that can be coupled to the nucleic acid aptamer sgc8c.

[0154] This example further examined the inhibitory effect of the MS prepared in Example 2 on a colorectal cancer HT-29 xenograft tumor model. Relative to the Saline group, the inhibition rates of the MS 7 mg / kg q4d x 5 group were 76.5%, the MS 7 mg / kg q4d x 7 group were 75.8%, and the MS 10.5 mg / kg q7d x 5 group were 75.6%. This indicates that the 3-terminal aptamer-drug conjugated SM significantly enhances the inhibitory activity of colorectal cancer HT-29 cells, making it suitable as a therapeutic agent for the treatment of colorectal cancer HT-29.

[0155] Example 9: Effect of Aptamer-Drug Conjugates on Tumor Inhibition in Human Lung Cancer NCI-H1975

[0156] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human lung cancer NCI-H1975 xenograft tumor model. The specific process is as follows:

[0157] Take the human lung cancer cell NCI-H1975 cell tumor-bearing mouse model, the tumor volume is 100-200mm 3 Twelve mice were randomly divided into three groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE equivalent to the tail vein every four days, for a total of five times. The Paclitaxel group was administered with 10 mg / kg intraperitoneally every four days, for a total of four times. The body weight of the mice, the length (a) and the width (b) of the tumor were measured and recorded at each injection. The formula for calculating the tumor volume (V) is: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 17-18 As shown, compared with the Saline group, the paclitaxel group had a tumor inhibition rate of 60%, and the SM group achieved a 99% objective response rate and complete remission of the tumor. Figure 19-20 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0158] This example further examined the inhibitory effect of the MS prepared in Example 2 on the human lung cancer NCI-H1975 xenograft tumor model. The results showed that, compared to the Saline group, the inhibition rate of the MS 7 mg / kg q4d x 5 group was only 76.5%, significantly lower than that of the SM group. This indicates that the 3-terminal aptamer-drug conjugated SM significantly enhances the inhibitory activity of human lung cancer NCI-H1975 cells, making it suitable for use as a therapeutic agent against human lung cancer.

[0159] At the same time, this example also examined the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on human lung cancer NCI-H1975 xenograft tumor models, and found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0160] Example 10: Effect of Aptamer-Drug Conjugates on Tumor Inhibition of Human Ovarian Cancer SKOV3

[0161] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human ovarian cancer SKOV3 xenograft tumor model. The specific process is as follows:

[0162] Take the human ovarian cancer cell SKOV3 cell tumor-bearing mouse model, the tumor volume is 100-200mm 3 Six mice were randomly divided into two groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE via tail vein every four days for a total of five doses. The body weight, tumor length (a) and tumor width (b) of the mice were measured and recorded at each injection. The tumor volume (V) was calculated as follows: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figure 21-22 As shown in Figure 2, compared with the Saline group, the SM group had a tumor inhibition rate of 96%. At the same time, the weight of the mice was observed, and the results were as follows: Figure 23-24 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0163] This example further examined the inhibitory effect of MS prepared in Example 2 on a human ovarian cancer xenograft model (SKOV3). The MS 7 mg / kg dose, q4d x 5, demonstrated a 98.2% inhibition rate compared to the Saline group, slightly higher than the SM group. This suggests that the aptamer-drug 5-terminus conjugated MS is more effective in enhancing the inhibitory activity of human ovarian cancer SKOV3 cells and is therefore more suitable as a therapeutic agent against human ovarian cancer.

[0164] At the same time, this example also investigated the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on human ovarian cancer SKOV3 xenograft tumor models, and found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0165] Example 11: Effect of Aptamer-Drug Conjugated Drugs on Tumor Inhibition in Human Breast Cancer SUM159

[0166] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human breast cancer SUM159 xenograft tumor model. The specific process is as follows:

[0167] Take the human breast cancer cell SUM159 cell tumor-bearing mouse model, the tumor volume is 100-200mm 325 mice were randomly divided into 5 groups. SM was divided into different dose groups of 5.25 mg / kg (0.375 μmol / kg), 7 mg / kg (0.5 μmol / kg), and 10.5 mg / kg (0.75 μmol / kg). The Saline group, 5.25 mg / kg SM group, and 7 mg / kg SM group were administered by tail vein every four days, for a total of 5 times. The 7 mg / kg SM and 10.5 mg / kg SM groups were administered by tail vein every 7 days, for a total of 4 times. The body weight of the mice, the length (a) and the width (b) of the tumor were measured and recorded at each injection. The calculation formula of tumor volume (V) is: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figures 25-26 As shown in the figure, compared with the Saline group, SM in the dose range of 5.25-10.5 mg / kg can significantly inhibit mouse tumors, among which SM 7 mg / kgq4d×5 and SM 10.5 mg / kgq7d×4 have the strongest tumor inhibition effect, with a tumor inhibition rate of more than 70%. At the same time, the weight of the mice was observed, and the results are as follows Figures 27-28 As shown, there was no significant difference in the body weight of mice in each SM dose group compared with the Saline group, indicating that SM has good biosafety within the dose range of 5.25-10.5 mg / kg.

[0168] This example further examined the inhibitory effect of the MS prepared in Example 2 on a human breast cancer SUM159 xenograft tumor model. The results showed that, compared to the Saline group, the inhibition rates of the MS 7 mg / kg q4 days × 5 group and the MS 7 mg / kg q7 days × 5 group were significantly lower than those of the SM 7 mg / kg q4 days × 5 group and the SM 7 mg / kg q7 days × 5 group. This indicates that the 3-terminal aptamer-drug SM can significantly enhance the inhibitory activity of human breast cancer SUM159 cells, making it more suitable as a therapeutic agent against human breast cancer.

[0169] Example 12: Effect of Aptamer-Drug Conjugates on Tumor Inhibition of Human Pancreatic Cancer MIA PaCa-2

[0170] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human pancreatic cancer MIA PaCa-2 xenograft tumor model. The specific process is as follows:

[0171] A human pancreatic cancer cell MIA PaCa-2 tumor-bearing mouse model was established with a tumor volume of 100-200 mm 3Ten mice were randomly divided into two groups. Saline and SM were injected into the tail vein every four days, with a dose of 0.36 mg / kg (0.5 μmol / kg) of MMAE equivalent, for a total of five doses. The body weight, tumor length (a) and tumor width (b) of the mice were measured and recorded at each injection. The tumor volume (V) was calculated as follows: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figures 29-30 As shown, compared with the Saline group, the tumors in the SM group mice achieved a 99% objective response rate and complete remission. At the same time, the weight of the mice was observed, and the results were as follows Figures 31-32 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0172] This example further investigated the inhibitory effect of the MS prepared in Example 2 on a human pancreatic cancer MIA PaCa-2 xenograft tumor model. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was only 51.5%, which was significantly lower than that of SM. This shows that the aptamer 3-terminal conjugated drug SM can significantly enhance the inhibitory activity of human pancreatic cancer MIA PaCa-2 cells, reaching 99% and achieving almost complete inhibition. Therefore, SM is more suitable as a therapeutic drug against human pancreatic cancer.

[0173] At the same time, this example also investigated the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on human pancreatic cancer MIA PaCa-2 xenograft tumor models, and found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0174] Example 13: Effect of Aptamer-Drug Conjugates on Tumor Inhibition of Human Lung Cancer A549

[0175] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a human lung cancer A549 xenograft tumor model. The specific process is as follows:

[0176] A549 human lung cancer cell-bearing mouse model was used, with a tumor volume of 100-200 mm 3Twelve mice were randomly divided into three groups. The Saline group and the SM group were administered with MMAE equivalent to 0.36 mg / kg (0.5 μmol / kg) via tail vein every four days for a total of five times. The Cisplatin group was administered with 2.5 mg / kg via intraperitoneal injection every seven days for a total of two times. The body weight, tumor length (a) and tumor width (b) of the mice were measured and recorded at each injection. The formula for calculating tumor volume (V) is: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figures 33-34 As shown in Figure 2, compared with the Saline group, the inhibition rate of the cisplatin group on mouse tumors was 10%, while the inhibition rate of the SM group on mouse tumors reached 62%. At the same time, the weight of the mice was observed, and the results were as follows. Figures 35-36 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0177] This example further examined the inhibitory effect of the MS prepared in Example 2 on a human non-small cell lung cancer A549 xenograft tumor model. The MS 7 mg / kg dose, q4d x 5, group exhibited a 60% inhibition rate compared to the Saline group, slightly lower than the SM group. This suggests that the 3-terminal conjugation of the aptamer-drug SM can enhance the inhibitory activity of human non-small cell lung cancer A549 cells, making it more suitable as a therapeutic agent against human non-small cell lung cancer.

[0178] However, when targeting human lung cancer NCI-H1975, the effects of SM and MS on the therapeutic effect are more obvious, while when targeting non-small cell lung cancer A549, the effects of SM and MS on the therapeutic effect are somewhat reduced. This shows that the connection method of nucleic acid aptamer-drug conjugates has different effects on different types of lung cancer.

[0179] Example 14: Effect of Aptamer-Drug Conjugated Drugs on Pancreatic Cancer PDX Tumor Inhibition

[0180] The SM prepared in Example 1 was used for a tumor inhibition experiment in a pancreatic cancer PDX xenograft tumor model. The specific process was as follows:

[0181] Pancreatic cancer PDX tumor blocks were taken and implanted using a trocar. After 19 days, the tumor volume reached 100-200 mm 3 , take pancreatic cancer PDX model tumor volume between 100-200mm 3Ten mice were randomly divided into two groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE via tail vein every four days for a total of six doses. The body weight, tumor length (a), and tumor width (b) of the mice were measured and recorded at each injection. The tumor volume (V) was calculated as follows: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experiment was terminated when the mice lost more than 15% of their body weight or the weight of the mice decreased by 15%. Figures 37-38 As shown in Figure 2, compared with the Saline group, the tumors in the SM group were effectively inhibited, with an inhibition rate of 92%. At the same time, the weight of the mice was observed, and the results were as follows: Figures 39-40 As shown, there was no significant difference in body weight between the mice in the SM group and the Saline group.

[0182] This example further investigated the inhibitory effect of the MS prepared in Example 2 on pancreatic cancer PDX xenograft tumor models. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×6 group was 57%, which was significantly lower than that of SM. This shows that the nucleic acid aptamer 3-terminal conjugated drug SM can significantly enhance the inhibitory activity of human pancreatic cancer PDX cells and is more suitable as a therapeutic drug against human pancreatic cancer.

[0183] Example 15: Effect of Aptamer-Drug Conjugates on Tumor Inhibition in MDA-MB-468 Breast Cancer Cells

[0184] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a breast cancer MDA-MB-468 xenograft tumor model. The specific process is as follows:

[0185] Take the breast cancer cell MDA-MB-468 cell tumor-bearing mouse model, the tumor volume is 100-200mm 3 Fifteen mice were randomly divided into three groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE equivalent to the tail vein every four days, for a total of three times. The Paclitaxel group was administered with 10 mg / kg intraperitoneally every four days, for a total of three times. The body weight of the mice, the length (a) and the width (b) of the tumor were measured and recorded at each injection. The formula for calculating the tumor volume (V) is: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figures 41-42As shown in the figure, compared with the Saline group, the inhibition rate of the paclitaxel group on mouse tumors was 60%, and the SM group achieved a 100% objective response rate and complete remission of mouse tumors. Figures 43-44 As shown, there was no significant difference in body weight between the mice in the SM group and the Saline group.

[0186] This example further examined the inhibitory effect of the MS prepared in Example 2 on a breast cancer xenograft tumor model of MDA-MB-468. It was found that compared to the Saline group, the inhibition rate of the MS 7 mg / kg q4d × 3 group was 89%, which was significantly lower than that of the SM group. SM was able to achieve an inhibition rate of 100%, indicating that SM is particularly suitable for preparing drugs against breast cancer MDA-MB-468.

[0187] This example also examined the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on breast cancer MDA-MB-468 xenograft tumor models, and found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0188] Example 16: Effect of Aptamer-Drug Conjugates on Ovarian Cancer OVCAR3 Tumor Inhibition

[0189] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in an ovarian cancer OVCAR3 xenograft tumor model. The specific process is as follows:

[0190] Take the ovarian cancer cell OVCAR3 cell tumor-bearing mouse model, the tumor volume is 100-200mm 3 9 mice were randomly divided into 3 groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE equivalent to the tail vein every four days, for a total of 5 times. The Paclitaxel group was administered with 10 mg / kg intraperitoneally every four days, for a total of 5 times. The body weight of the mice, the length (a) and the width (b) of the tumor were measured and recorded at each injection. The formula for calculating the tumor volume (V) is: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figures 45-46 As shown in Figure 2, compared with the Saline group, the inhibition rate of the paclitaxel group on mouse tumors was 33%, and the inhibition rate of the SM group on mouse tumors was 98.5%. Figures 47-48 As shown, there was no significant difference in body weight between the mice in the SM group and the Saline group.

[0191] This example further examined the inhibitory effect of MS prepared in Example 2 on an ovarian cancer xenograft model. The results showed that, compared to the Saline group, the MS 7 mg / kg q4d x 5 group had an inhibition rate of 82.5%, lower than the inhibitory effect of SM. This indicates that the aptamer 3-terminus-coupled drug SM significantly enhances the inhibitory activity of OVCAR3 cells, making it more suitable as a therapeutic agent for the treatment of ovarian cancer.

[0192] At the same time, this example also investigated the inhibitory effects of SD (Sgc8c-Dxd) (prepared in Example 3) and SE (prepared in Example 20) on the ovarian cancer OVCAR3 xenograft tumor model, and found that the tumor inhibition rate of the SM group was significantly higher than that of the SD group and the SE group.

[0193] Example 17: Effect of Aptamer-Drug Conjugates on Pancreatic Cancer BxPC3 Tumor Inhibition

[0194] This example uses the SM prepared in Example 1 for a tumor inhibition experiment in a pancreatic cancer BxPC3 xenograft tumor model. The specific process is as follows:

[0195] Take the pancreatic cancer cell BxPC3 cell tumor-bearing mouse model, the tumor volume is 100-200mm 3 Nine mice were randomly divided into three groups. The Saline group and the SM group were administered with MMAE equivalent to 0.36 mg / kg (0.5 μmol / kg) via tail vein every four days, for a total of five times. The Gemcitabine group was administered with 80 mg / kg via intraperitoneal injection every seven days, for a total of three times. The body weight, tumor length (a) and tumor width (b) of the mice were measured and recorded at each injection. The formula for calculating tumor volume (V) is: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figures 49-50 As shown in Figure 2, compared with the Saline group, the gemcitabine group did not inhibit the growth of mouse tumors, while the SM group had an inhibition rate of 87%. Figures 51-52 As shown, there was no significant difference in the body weight of mice in the SM group compared with the Saline group, indicating that SM has good biosafety at this dose.

[0196] This example further investigated the inhibitory effect of the MS prepared in Example 2 on pancreatic cancer BxPC3 xenograft tumor models. It was found that compared with the Saline group, the inhibition rate of the MS 7 mg / kg q4d×5 group was 56%, which was significantly lower than that of the SM group.

[0197] Example 18: Nucleic acid aptamer-drug conjugated SM with a non-cleavable linker coupled to the 3 ends

[0198] In this example, a PTK7 (sgc8c, a public sequence) nucleic acid aptamer-drug conjugated to a Mc-MMAE drug at its three ends was prepared. SM was synthesized using a thiolmaleimide chemical reaction, as shown in the following reaction formula:

[0199]

[0200] Among them, the ribbon with thiol group is nucleic acid aptamer, and DMTr is dimethoxytrityl protecting group.

[0201] The preparation process is as follows:

[0202] (1) The preparation process of the thiol-modified PTK7 nucleic acid aptamer aqueous solution is shown in Example 1.

[0203] (2) Preparation of nucleic acid aptamer-drug conjugate SM:

[0204] To a centrifuge tube, add an aqueous solution of a 3'-terminally thiol-modified PTK7 aptamer (1 equivalent) and a mixture of acetonitrile / water (1 / 5-3 / 1, preferably 1 / 2) containing a maleimidohexanamide-protecting auristatin-type tubulin inhibitor, Mc-MMAE (CAS: 863971-24-8, purchased from Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) (2-30 equivalents, preferably 3 equivalents). Maintain the temperature at 4-40°C, preferably 25°C, and stir for 2-24 hours, preferably 12 hours. Purify with a reverse-phase preparative column and freeze-dry to obtain the PTK7 aptamer-drug conjugate, SM (Sgc8c-Mc-MMAE), with a 3'-terminus coupled to Mc-MMAE. The yield is approximately 60%. After desalting, the product is lyophilized for later use. SM: Calculated: 13741.1 (Found: 13741).

[0205] Example 19: Effect of 3-terminal coupling with different linkers to construct aptamer-drug conjugates

[0206] This example was constructed using the method provided in Example 1, wherein the linkers on MMAE were cleavable maleimide VC linker SM and non-cleavable maleimidocaproyl linker SM, respectively. The construction method of VcMMAE was as described in Example 1, and the construction method of the non-cleavable maleimidocaproyl linker SM was as described in Example 18. Following the method provided in Example 16, the inhibitory effects of different linker drugs SM and SM on human pancreatic cancer MIA PaCa-2 cells were investigated. The results showed that the PTK7 aptamer-conjugated drug SM constructed using the Vc linker was significantly superior to the non-cleavable linker drug SM, with an IC50 value reduced by more than 30%. This may be because the non-cleavable linker limits the activity of the MMAE drug. Therefore, the Vc linker is the most preferred linker.

[0207] Example 20: Preparation of PTK7-targeted nucleic acid aptamer 3-terminus coupled drug SE

[0208] In this example, a PTK7 (sgc8c, a public sequence) nucleic acid aptamer-drug conjugate SE with MC-VA-PAB-Exatecan conjugated to the 3-terminus was prepared. SE was synthesized using a thiolmaleimide chemical reaction, as shown in the following reaction formula:

[0209]

[0210] Among them, the ribbon with thiol group is nucleic acid aptamer, and DMTr is dimethoxytrityl protecting group.

[0211] The preparation process is as follows:

[0212] (1) The preparation process of the thiol-modified PTK7 nucleic acid aptamer aqueous solution is shown in Example 1.

[0213] (2) Preparation of nucleic acid aptamer-drug SE:

[0214] A 3'-terminally thiol-modified PTK7 aptamer (1 equivalent) in water and a mixture of 2-30 equivalents, preferably 3 equivalents, of the DNA topoisomerase I inhibitor exitecan (CAS: 2680543-57-9, purchased from Shanghai Haoyuan Biopharmaceutical Technology Co., Ltd.) with a MC-VA-PAB linker in DMSO / water (1 / 5-3 / 1, preferably 1 / 1) were added to a centrifuge tube. The reaction was stirred at 4-40°C, preferably 25°C, for 2-24 hours, preferably 12 hours. Purification was performed on a reverse-phase preparative column and freeze-dried to obtain the 3'-terminally exatecan-coupled PTK7 aptamer-drug conjugate SE (Sgc8c-EXA) in approximately 60% yield. The product, SE, was characterized by mass spectrometry: Calculated: 13778.1 (Found: 13778).

[0215] Example 21: Effect of Nucleic Acid Aptamer-Drug Conjugated SE on Colorectal Cancer HT-29 Tumor Inhibition

[0216] This example uses the SE prepared in Example 20 for a tumor inhibition experiment in a colorectal cancer HT-29 xenograft tumor model. The specific process is as follows:

[0217] A colorectal cancer cell HT-29 cell-bearing mouse model was established with a tumor volume of 100-200 mm 3 Eight mice were randomly divided into two groups. Saline group and SE group were administered 27.6 mg / kg (dose 2 μmol / kg) via tail vein every four days for a total of five doses. The body weight, tumor length (a) and tumor width (b) of the mice were measured and recorded at each injection. The tumor volume (V) was calculated as follows: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experimental endpoint was that the mice lost more than 15% of their body weight, and the experiment was terminated by euthanasia. Figures 53-54 As shown in Figure 2, compared with the Saline group, the tumor inhibition rate of the SE group was only 26.7%. At the same time, the weight of the mice was observed, and the results were as follows: Figures 55-56 As shown, there was no significant difference in the body weight of mice in the SE group compared with the Saline group, indicating that SE has good biosafety at this dose.

[0218] Example 22: Effect of Aptamer-Drug Conjugates on Other Tumor Inhibition Effects

[0219] This example uses the SM prepared in Example 1 to perform tumor inhibition experiments on soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central nervous system tumor ONS-76 cell xenograft models. The specific process is as follows:

[0220] Soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neuroblastoma ONS-76 cell-bearing mouse models were selected, with tumor volumes ranging from 100 to 200 mm. 3 Nine mice were randomly divided into three groups. The Saline group and the SM group were administered with 0.36 mg / kg (0.5 μmol / kg) of MMAE via tail vein every four days for a total of five doses. The body weight, tumor length (a), and tumor width (b) of the mice were measured and recorded at each injection. The tumor volume (V) was calculated as follows: V = (a × b 2 ) / 2. Tumor volume exceeds 1500mm 3 The experiment was terminated by euthanasia when the mice lost more than 15% or their body weight decreased, as the experimental endpoint. The inhibitory effect of SM on soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central nervous system tumor ONS-76 cell-bearing mouse models was calculated. This example also employed the same method to investigate the inhibitory effect of the MS prepared in Example 2 on soft tissue sarcoma SW872, osteosarcoma Saos-2, thymic carcinoma Ty-82, and central nervous system tumor ONS-76 xenograft models. The test results are shown in Table 2.

[0221] Table 2. Results of inhibition of tumor cell proliferation by SM and SM

[0222]

[0223] As shown in Table 2, with the exception of soft tissue sarcoma SW872, the MS prepared by PTK7 aptamers with 5-terminal drug conjugation showed significantly better inhibition of tumor cell proliferation than the SM prepared by PTK7 aptamers with 3-terminal drug conjugation, with significant differences. In particular, the inhibitory effect of SM on thymic carcinoma Ty-82 cells was reduced by over 34%. This indicates that conjugating drugs to the 5-terminus of aptamers helps improve the inhibition of osteosarcoma Saos-2, thymic carcinoma Ty-82, and central neuroblastoma ONS-76 cell proliferation. However, for soft tissue sarcoma SW872, there was no significant difference in the effect of using MS or SM. This suggests that for different tumors, the higher the stability of the aptamer-conjugated drug, the better the tumor inhibition effect, and specific tumor cell analysis is required.

[0224] Example 23: Effect of Aptamer-Drug Conjugates on Scaber Inhibition of Bladder Cancer

[0225] This example uses the SM prepared in Example 1 for bladder instillation experiments in a Scaber bladder cancer xenograft model. The specific process is as follows:

[0226] The mouse bladder was inoculated with 200,000 bladder cancer Scaber cells / 10 μL to establish a tumor-bearing mouse model. The tumor fluorescence intensity reached 10 7 The mice were randomly divided into 6 groups, with 8 mice in each group. Each group received intravesical instillation once a week, with the doses of SM being 0.25, 0.5, and 1 nmol / kg, and sgc8 and VC-MMAE being 1 nmol / kg, for a total of 4 doses. The body weight of the mice and the fluorescence intensity of the tumor site were measured and recorded before each administration. The experiment was terminated when the weight loss exceeded 15%. Figure 57 As shown, compared with the Saline group, the SM group had an inhibition rate of 75-100% on mouse tumors, and the 1 nmol / kg SM group of mouse tumors could achieve a 100% objective response rate and complete remission.

[0227] This example further investigated the inhibitory effect of the MS prepared in Example 2 on a Scaber bladder cancer xenograft tumor model. It was found that, compared with the Saline group, at the same concentration, the inhibition rate of the MS group was also 75-100%. This indicates that, for Scaber bladder cancer cells, there is no significant difference in the inhibitory effect of the aptamer targeting PTK7 coupled to the 3' end compared to the aptamer coupled to the 5' end.

[0228] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the scope defined by the claims.

Claims

1. A nucleic acid aptamer-drug conjugate targeting PTK7, characterized in that: The nucleic acid aptamer-coupled drug comprises a nucleic acid aptamer targeting PTK7 and a drug containing a linker, and the drug containing the linker is coupled to the 3 ends of the nucleic acid aptamer.

2. The nucleic acid aptamer-drug conjugate according to claim 1, wherein The PTK7-targeting nucleic acid aptamer has a sequence as shown in SEQ ID No. 1 in the sequence listing.

3. The nucleic acid aptamer-drug conjugate according to claim 2, wherein The drug is the auristatin microtubule inhibitor MMAE.

4. The nucleic acid aptamer-drug conjugate according to claim 3, wherein The linker is a Vc linker, and the linker-containing drug has the following structural formula:

5. The nucleic acid aptamer-drug conjugate according to claim 4, wherein The structural formula of the PTK7-targeting aptamer-drug conjugate is shown below: The ribbon with thiol groups is a nucleic acid aptamer targeting PTK7.

6. Use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving plasma stability, characterized in that: The nucleic acid aptamer-coupled drug comprises a nucleic acid aptamer targeting PTK7 and a drug containing a linker, and the drug containing the linker is coupled to the 3 ends of the nucleic acid aptamer.

7. Use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving tumor inhibition effect, characterized in that: The nucleic acid aptamer-coupled drug comprises a nucleic acid aptamer targeting PTK7 and a drug containing a linker, and the drug containing the linker is coupled to the 3 ends of the nucleic acid aptamer.

8. The use according to claim 7 or 6, characterized in that The PTK7-targeting nucleic acid aptamer has a sequence as shown in SEQ ID No. 1 in the sequence table; and the drug is an auristatin-type microtubule inhibitor.

9. The use according to claim 8, characterized in that The tumor includes any one or more of colorectal cancer, lung cancer, ovarian cancer, breast cancer, and pancreatic cancer.

10. The use according to claim 7 or 6, characterized in that: The linker is a Vc linker, and the linker-containing drug has the following structural formula:

11. The use according to claim 10, characterized in that The structural formula of the PTK7-targeting aptamer-drug conjugate is shown below: The ribbon with thiol groups is a nucleic acid aptamer targeting PTK7.

12. A use of a PTK7-targeting aptamer-drug conjugate for preparing a reagent for improving tumor inhibition effect, characterized in that: The aptamer-drug conjugate includes a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 5-end of the aptamer, and the PTK7-targeting aptamer has a sequence as shown in SEQ ID No. 1 in the sequence table; the drug is an auristatin-type microtubule inhibitor MMAE, and the linker is a Vc linker; the tumor includes any one or more of osteosarcoma, thymic carcinoma, and central neurocytoma.

13. Use of a PTK7-targeting aptamer-drug conjugate for preparing a tumor-suppressing agent, characterized in that: The aptamer-coupled drug comprises a PTK7-targeting aptamer and a linker-containing drug, wherein the linker-containing drug is coupled to the 3' end or 5' end of the aptamer, and the PTK7-targeting aptamer has a sequence as shown in SEQ ID No. 1 in the sequence table; the drug is an auristatin-type microtubule inhibitor MMAE, and the linker is a Vc linker; the tumor comprises soft tissue sarcoma or bladder cancer.

14. Use of sgc8c for preparing a reagent for improving the targeting of aptamer-coupled drugs targeting PTK7, characterized in that: The sgc8c has the sequence shown in SEQ ID No. 1 in the sequence listing.

15. Use of MMAE with a Vc linker for preparing a reagent for improving the efficacy of a nucleic acid aptamer-coupled drug targeting PTK7, characterized in that: The drug containing a Vc linker has the structural formula shown below:

Images