Preparation method and application of magnetic silicon dioxide microspheres based on cDNA modification

Abstract

The invention discloses a preparation method and application of magnetic silicon dioxide microspheres based on cDNA modification, and belongs to the technical field of biological medicines.The preparation method comprises the steps that 1, an emulsion polymerization method is adopted for preparing SiO2-Fe3O4, and amino groups are modified on the surfaces of the SiO2-Fe3O4; (2) coating rhodamine 6G in the amino-modified SiO2 coated Fe3O4, and constructing a biological logic gate by using a cDNA (complementary deoxyribonucleic acid) coupling technology; and (3) coupling an aptamer on the cDNA to construct the gating structure based on the response of the hepatitis pathogen marker. According to the method, the high-sensitivity quantitative detection on the hepatitis pathogen marker in a complex matrix is realized by combining the SiO2-Fe3O4 and cDNA coupling technology and the biological gating technology, and the method has the advantages of high anti-interference performance, better repeatability and low cost, and is suitable for early screening and early treatment of hepatitis viruses.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a preparation method and application of magnetic silica microspheres based on cDNA modification. Background Art

[0002] There are over 90 million people infected with hepatitis B in my country, with the number of new cases remaining stable at around 1 million per year. Especially in rural areas, one in every 11 people is infected. Therefore, my country urgently needs a low-cost, highly stable hepatitis early treatment and screening monitoring system. Currently, the main tests for hepatitis are colloidal gold and enzyme-linked immunosorbent assay (ELISA). Colloidal gold is often used for home testing, but its test results are less accurate and quantitative testing is difficult to achieve. The current testing method in hospitals is mostly enzyme-linked immunosorbent assay (ELISA). Although the test results are accurate, the test time is long and the test cost is high, making it unsuitable for the downstream market.

[0003] Magnetic microchannel silica spheres (SiO2@Fe3O4) are considered ideal smart carrier materials for controlled-release systems due to their unique pore structure, large loading capacity, excellent chemical and thermal stability, and good dispersibility in aqueous solutions. Furthermore, amino-modified mesoporous silica nanoparticles (MSNs) can effectively promote their binding to biomolecules.

[0004] The technology of using cDNA as a connecting bridge or functional unit to achieve specific intermolecular binding or signal transduction (referred to as cDNA coupling technology) is highly specific, selective, and stable, and is often used in molecular biology research, clinical testing, and treatment. However, to date, this technology has not yet formed a low-cost and highly stable quantitative detection system for hepatitis pathogen markers. There is an urgent need to prepare a cDNA-modified magnetic silica microsphere for the quantitative detection of hepatitis pathogen markers. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a method for preparing and applying cDNA-modified magnetic silica microspheres. By coupling magnetic microchannel silica microspheres with cDNA, cDNA@SiO2@R6G@Fe3O4 is prepared for the quantitative detection of hepatitis pathogen markers in samples, addressing the need for quantitative detection of hepatitis pathogen markers in complex samples.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The present invention provides a method for preparing magnetic silica microspheres based on cDNA modification, comprising the following steps:

[0008] (1) SiO2@Fe3O4 was prepared by emulsion polymerization and amino groups were modified on the surface. This gave it good biocompatibility, structural stability, and controllable pore size, providing a platform for the storage of chromogenic substances and the loading of cDNA.

[0009] (2) Rhodamine 6G (R6G) was encapsulated within amino-modified SiO2@Fe3O4, and a biological logic gate was constructed using cDNA coupling technology. This structure provided a platform for aptamer coupling. This method not only stably encapsulated R6G but also significantly enhanced the anti-interference ability of the silica sphere.

[0010] (3) Aptamers are coupled to cDNA to construct a gated structure based on the response to hepatitis pathogen markers. The working principle of this structure is to utilize the specific binding of hepatitis pathogen markers and aptamers, and the hepatitis pathogen marker is regarded as a key, the aptamer is regarded as a lock, and the cDNA is a biological logic gate. When the lock and key match each other, the lock is opened and falls off the door, causing the door to open and the R6G coated inside the door to be released. Due to the specific action of the hepatitis pathogen marker aptamer, the detection selectivity is greatly improved, which is suitable for quantitative detection of complex samples.

[0011] Specifically, the present invention provides a method for preparing magnetic silica microspheres based on cDNA modification, comprising the following steps:

[0012] Step 1: Preparation of microchannel SiO2@Fe3O4;

[0013] Dissolve triethanolamine (TEA) in pure water and stir. Then add sodium salicylate (NaSal) and cetyltrimethylammonium bromide (CTAB) and continue stirring. Then add magnetic fluid and tetraethyl silicate (TEOS) and continue stirring. After the reaction is completed, centrifuge and wash the product with water and ethanol to remove residual reactants. The resulting product is calcined at high temperature in a muffle furnace to remove the surfactant and form a microporous structure, resulting in SiO2@Fe3O4.

[0014] Step 2: Surface modification of SiO2@Fe3O4 by amination;

[0015] Disperse SiO2@Fe3O4 in toluene and reflux with 3-aminopropyltriethoxysilane (APTES). Collect the product by centrifugation, wash it 2-3 times with ethanol, and then dry it under vacuum to obtain amino-modified SiO2@Fe3O4.

[0016] Step 3: Preparation of cDNA@SiO2@Fe3O4;

[0017] Step 3.1: Activate the carboxyl functional groups on the cDNA;

[0018] Prepare an ultrapure aqueous solution containing 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS), add cDNA, and vigorously stir at room temperature for 20-30 minutes to activate the carboxyl functional groups on the cDNA;

[0019] Step 3.2: Ligation of cDNA and SiO2@Fe3O4;

[0020] Add SiO2@Fe3O4 modified with amino groups, stir the reaction at room temperature, centrifuge, and collect the product to obtain cDNA@SiO2@Fe3O4;

[0021] Step 4: Connect the aptamer and encapsulate R6G through cDNA coupling technology;

[0022] A 10 mM PBS solution containing the aptamer and R6G was prepared, and cDNA@SiO2@Fe3O4 was dispersed into it. The mixture was shaken at room temperature, centrifuged, washed with PBS, and the product was collected to obtain aptamer-cDNA@SiO2@R6G@Fe3O4. The resulting aptamer-cDNA@SiO2@R6G@Fe3O4 was resuspended in 10 mM PBS (pH 7.0) at a concentration of 10 mg / mL-20 mg / mL and stored below 4°C.

[0023] In the step 1, tetraethyl silicate is added after the magnetic fluid is added, and is slowly added dropwise to the reaction system. After the reaction is completed, the product is centrifuged at 20,000 rpm for 10-15 minutes.

[0024] In the step 1, the product is calcined at a high temperature of 600° C. to 650° C. in a muffle furnace for 4 to 5 hours to remove the surfactant and form a microporous structure.

[0025] In the step 2, 10 mM 3-aminopropyltriethoxysilane (APTES) is refluxed at 80° C.-85° C. for 10 h-12 h.

[0026] In the step 3.2, SiO2@Fe3O4 modified with amino groups is added, the reaction is stirred at room temperature for 10 h to 12 h, and the mixture is centrifuged at 12000 g for 10 min to 15 min to collect the product.

[0027] In step 4, the mixture is shaken at room temperature for 10 to 12 hours, and then centrifuged at 12,000 g for 10 to 15 minutes.

[0028] In step 4, the aptamers include: hepatitis B surface antigen aptamer (Apt-HBsAg), hepatitis B e antigen aptamer (Apt-HBeAg), hepatitis B core antigen aptamer (Apt-HBcAg), hepatitis C virus core antigen aptamer (Apt-HCVcAg), hepatitis C virus envelope protein aptamer (Apt-HCV E1 / E2), hepatitis A virus aptamer (Apt-HAV), hepatitis D virus aptamer (Apt-HDV), hepatitis B virus antibody aptamers (Apt-HBsAb, Apt-HBeAb, Apt-HBcAb), hepatitis C virus antibody aptamer (Apt-HCV-Ab), hepatitis A virus antibody aptamer (Apt-HAV-Ab), and hepatitis D virus antibody aptamer (Apt-HDV-Ab).

[0029] The cDNA-modified magnetic silica microspheres prepared by the method of the present invention can be used to prepare a detection kit for hepatitis pathogen markers. The hepatitis pathogen markers used for detection include hepatitis A, B, C, and D virus markers. Specifically, they include hepatitis B surface antigen (HBsAg), hepatitis B e antigen (HBeAg), hepatitis B core antigen (HBcAg), hepatitis C virus core antigen (HCVcAg), hepatitis C virus envelope protein (HCV E1 / E2), hepatitis A virus (HAV), hepatitis D virus (HDV), hepatitis B virus antibodies (HBsAb, HBeAb, HBcAb), hepatitis C virus antibodies (HCV-Ab), hepatitis A virus antibodies (HAV-Ab), and hepatitis D virus antibodies (HDV-Ab).

[0030] The hepatitis pathogen marker detection kit provided by the present invention is used to detect serum samples. The specific method includes:

[0031] (1) Mixed serum samples and aptamer-cDNA@SiO2@R6G@Fe3O4;

[0032] The serum sample to be tested was mixed with the aptamer-cDNA@SiO2@R6G@Fe3O4 dissolved in PBS at a volume ratio of 1:1. After 1-5 minutes, the magnetic silica balls were sucked out using a magnet.

[0033] (2) Quantitative detection;

[0034] The concentration information is obtained by comparing with the standard colorimetric card.

[0035] The key points of the present invention are:

[0036] The present invention aims to overcome the shortcomings of existing technologies in terms of selectivity, interference resistance, and cost by providing a method for preparing cDNA-modified magnetic silica microspheres for the quantitative detection of hepatitis pathogen markers. By combining SiO2@Fe3O4, cDNA coupling, and bio-gating technologies, this method achieves highly sensitive quantitative detection of hepatitis pathogen markers in complex matrices. This method exhibits high interference resistance, good reproducibility, and low cost, making it suitable for early screening and treatment of hepatitis viruses.

[0037] Beneficial effects of the present invention:

[0038] The sample to be tested is mixed with the magnetic microchannel silica ball. The hepatitis pathogen marker in the sample specifically binds to the aptamer, causing the aptamer to separate from the aptamer-cDNA@SiO2@R6G@Fe3O4, activating the biological gating structure and releasing R6G ( Figure 3 The grayscale value after RGB channel separation can be used to assess the expression of hepatitis pathogen markers, and the grayscale value is directly proportional to the concentration of hepatitis pathogen markers. The detection range of the present invention is 20pg / mL to 200pg / mL, with a detection limit of 6pg / mL, and it exhibits strong anti-interference ability in complex mechanisms such as undiluted serum.

[0039] The aptamer cDNA@SiO2@R6G@Fe3O4 prepared by this method is suitable for highly selective quantitative detection of hepatitis pathogen markers in complex samples, making it particularly well-suited for early screening and treatment in township health centers in areas with high hepatitis prevalence. Due to the stability of the microchannel silica structure and the high selectivity of the aptamer, the monitoring system has the potential for long-term use and can also be applied in clinical and family health management self-examination. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Electron micrographs of cDNA-modified magnetic microchannel silica spheres prepared by the method of the present invention; A is a SEM image; B is a TEM image;

[0041] Figure 2 The release of R6G from cDNA-modified magnetic microchannel silica spheres prepared by the method of the present invention at different hepatitis virus concentrations; A is the absorbance change of samples with different concentrations (from 20 pg / mL to 200 pg / mL) at different wavelengths; B is the standard curve between absorbance and concentration;

[0042] Figure 3 Diagram of the gating principle of the cDNA-modified magnetic microchannel silica sphere prepared by the method of the present invention. DETAILED DESCRIPTION

[0043] To more clearly illustrate the objectives, technical solutions, and advantages of the present invention, the technical solutions of the present invention will be described in detail below. Obviously, the embodiments described are only some examples of the present invention, not all examples. Based on these embodiments, all other examples obtained by a person of ordinary skill in the art without engaging in creative work should be considered as within the scope of protection of the present invention.

[0044] Specific techniques or conditions not specifically noted in the examples were performed using conventional methods or according to techniques or conditions described in the literature in the field, or according to product specifications. Reagents and instruments used, for which the manufacturer is not indicated, are all conventional products that can be purchased through regular channels.

[0045] Example 1

[0046] A method for preparing magnetic silica microspheres based on cDNA modification comprises the following steps:

[0047] Step 1: Preparation of microchannel SiO2@Fe3O4;

[0048] 0.068 g of triethanolamine (TEA) was dissolved in 25 mL of pure water at 80°C under magnetic stirring and stirred for 0.5 h. 168 mg of sodium salicylate (NaSal) and 380 mg of cetyltrimethylammonium bromide (CTAB) were added and stirred for 1 h. 150.0 μL of magnetic fluid (EMG 707, average particle size approximately 10 nm, from Ferrotec) was added, followed by the addition of 4 mL of tetraethyl silicate (TEOS) dropwise at 300 rpm and continued stirring for 2 h. The product was centrifuged at 20,000 rpm for 15 min and washed with water and ethanol multiple times to remove residual reactants. The resulting product was calcined in a muffle furnace at 600°C for 4 h to remove the surfactant and form a microporous structure, yielding SiO2@Fe3O4.

[0049] Step 2: Surface modification of SiO2@Fe3O4 by amination;

[0050] 500 mg of SiO2@Fe3O4 was dispersed in 50 mL of toluene and refluxed with 2 mL of 10 mM 3-aminopropyltriethoxysilane (APTES) at 80°C for 12 hours. The product was collected by centrifugation at 8000 rpm for 5 minutes, washed three times with ethanol, and then dried under vacuum at 60°C for 12 hours to obtain amino-modified SiO2@Fe3O4.

[0051] Step 3: Preparation of cDNA@SiO2@Fe3O4;

[0052] Step 3.1: Activate the carboxyl functional groups on the cDNA;

[0053] Prepare 200 μL of ultrapure water solution containing 10 mg / mL 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and 10 mg / mL N-hydroxysuccinimide (NHS), add 100 μL of 120 μM cDNA (Sangon Biotech (Shanghai) Co., Ltd.), and stir vigorously at room temperature for 30 min;

[0054] cDNA sequence: 5'-COOH-CCAAGCTTGCATGCCTGCAG-3', shown in SEO ID NO: 1;

[0055] Step 3.2: Ligation of cDNA and SiO2@Fe3O4;

[0056] Add 10 mg of amino-modified SiO2@Fe3O4 and stir the reaction at room temperature for 10 h. Centrifuge at 12000 g for 10 min and collect the product to obtain cDNA@SiO2@Fe3O4.

[0057] Step 4: Connect the aptamer and encapsulate R6G through cDNA coupling technology;

[0058] Prepare 1 mL of PBS solution (10 mM, pH = 7.4) containing 100 μM hepatitis B surface antigen aptamer (Apt-HBsAg) (Shanghai Sangon Biotech Co., Ltd.) and 2.0 M R6G (excess), and disperse 50 mg of cDNA@SiO2@Fe3O4 into it. Oscillate on a shaker at room temperature for 12 hours. Centrifuge at 12,000 g for 10 minutes and wash several times with PBS solution. Collect the product to obtain Apt-HBsAg-cDNA@SiO2@R6G@Fe3O4, as shown in Figure 2. Figure 1 As shown, the microspheres exhibited a relatively regular spherical morphology with a particle size of approximately 100 nm. The microspheres were evenly distributed within the microspheres and had a relatively smooth surface, demonstrating good dispersibility. The resulting Apt-HBsAg-cDNA@SiO2@R6G@Fe3O4 was resuspended in 1.0 mL of PBS solution (10 mM, pH = 7.0) at a concentration of 10 mg / mL and stored below 4°C. The DNA sequence of Apt-HBsAg is: 5'-GGGAATTCGAGCTCGGTACCGGCACAAGCATATGGACTCCTCTGAACCTACGATGTAGT ACCTGCAGGCATGCAAGCTTGG-3', as shown in SEO ID NO: 2.

[0059] According to the method of Example 1, the hepatitis B surface antigen aptamer (Apt-HBsAg) in step 4 is replaced by the hepatitis B e antigen aptamer (Apt-HBeAg), the hepatitis B core antigen aptamer (Apt-HBcAg), the hepatitis C virus core antigen aptamer (Apt-HCVcAg), the hepatitis C virus envelope protein aptamer (Apt-HCV E1 / E2), hepatitis A virus aptamer (Apt-HAV), hepatitis D virus aptamer (Apt-HDV), hepatitis B virus antibody aptamer (Apt-HBsAb, Apt-HBeAb, Apt-HBcAb), hepatitis C virus antibody aptamer (Apt-HCV-Ab), hepatitis A virus antibody aptamer (Apt-HAV-Ab), hepatitis D virus antibody aptamer (Apt-HDV-Ab), then the corresponding aptamer for detecting other hepatitis virus markers - cDNA@SiO2@R6G@Fe3O4 can be obtained.

[0060] Example 2

[0061] This Example 2 aims to demonstrate the application of the aptamer-cDNA@SiO2@R6G@Fe3O4 prepared by the present invention in the quantitative detection of hepatitis pathogen markers in serum samples.

[0062] Step 1: Mix serum sample with Apt-HBsAg-cDNA@SiO2@R6G@Fe3O4;

[0063] Take 5 mL of the serum sample to be tested and mix it with Apt-HBsAg-cDNA@SiO2@R6G@Fe3O4 prepared in Example 1 and dissolved in PBS solution at a volume ratio of 1:1. Wait for 2 minutes to allow the hepatitis B surface antigen (HBsAg) in the sample to fully combine with Apt-HBsAg.

[0064] Step 2: Quantitative detection;

[0065] Magnetic separation of unbound Apt-HBsAg-cDNA@SiO2@R6G@Fe3O4.

[0066] The supernatant was collected and the absorbance was detected using a UV-visible spectrometer.

[0067] The absorbance data of different concentrations of hepatitis pathogen markers were obtained by measuring the absorbance using a UV-visible spectrometer. The concentration of the hepatitis pathogen marker in the sample was calculated based on a standard curve of absorbance and hepatitis pathogen marker concentration.

[0068] in conclusion:

[0069] The Apt-HBsAg-cDNA@SiO2@R6G@Fe3O4 prepared in Example 1 of the present invention can effectively and quantitatively detect hepatitis pathogen markers in serum samples. Figure 2 As shown in A, the detection range is 20pg / mL to 200pg / mL, and the detection limit is 6pg / mL, which meets the needs of clinical testing. Figure 2 The linear equation in B is y = 0.00503x - 0.03886 and R2 = 0.99536, indicating that there is a good linear relationship between absorbance and concentration.

[0070] The method of the present invention has high sensitivity, high specificity and good repeatability, and is suitable for the rapid quantitative detection of hepatitis pathogen markers.

[0071] This example verifies the effectiveness and reliability of the product of the present invention in detecting hepatitis pathogen markers, and provides a new detection kit for the clinical diagnosis of hepatitis pathogen markers.

Claims

1. A method for preparing magnetic silica microspheres based on cDNA modification, characterized in that: The following steps are involved: (1) SiO2@Fe3O4 was prepared by emulsion polymerization and amino groups were modified on the surface; (2) Encapsulating rhodamine 6G in amino-modified SiO2@Fe3O4 and constructing biological logic gates using cDNA coupling technology; (3) Adaptors were coupled to cDNA to construct a gating structure based on the response to hepatitis pathogen markers.

2. The method for preparing magnetic silica microspheres based on cDNA modification according to claim 1, characterized in that: The specific steps include: Step 1: Preparation of microchannel SiO2@Fe3O4; Dissolve triethanolamine in pure water and stir, then add sodium salicylate and cetyltrimethylammonium bromide, continue stirring, then add magnetic fluid and tetraethyl silicate, continue stirring. After the reaction is complete, centrifuge, wash the product with water and ethanol to remove residual reactants, and calcine the resulting product at high temperature in a muffle furnace to remove the surfactant and form a microporous structure to obtain SiO2@Fe3O4; Step 2: Surface modification of SiO2@Fe3O4 by amination; SiO2@Fe3O4 was dispersed in toluene and refluxed with 3-aminopropyltriethoxysilane. The product was collected by centrifugation, washed with ethanol, and then dried under vacuum to obtain SiO2@Fe3O4 modified with amino groups. Step 3: Preparation of cDNA@SiO2@Fe3O4; Step 3.1: Activate the carboxyl functional groups on the cDNA; Prepare an ultrapure aqueous solution containing 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and N-hydroxysuccinimide, add cDNA, and vigorously stir at room temperature for 20-30 minutes to activate the carboxyl functional groups on the cDNA; Step 3.2: Ligation of cDNA and SiO2@Fe3O4; Add SiO2@Fe3O4 modified with amino groups, stir the reaction at room temperature, centrifuge, and collect the product to obtain cDNA@SiO2@Fe3O4; Step 4: Connect the aptamer and encapsulate R6G through cDNA coupling technology; A PBS solution containing the aptamer and R6G was prepared, and cDNA@SiO2@Fe3O4 was dispersed therein. The solution was shaken at room temperature, centrifuged, and washed with PBS solution. The product was collected to obtain aptamer-cDNA@SiO2@R6G@Fe3O4. The obtained aptamer-cDNA@SiO2@R6G@Fe3O4 was resuspended in PBS solution at a concentration of 10 mg / mL-20 mg / mL and stored below 4°C.

3. The method for preparing magnetic silica microspheres based on cDNA modification according to claim 2, characterized in that: In the step 1, tetraethyl silicate is added after the magnetic fluid is added, and the tetraethyl silicate is added to the reaction system in a slow dropwise manner.

4. The method for preparing magnetic silica microspheres based on cDNA modification according to claim 2, characterized in that: In the step 1, the product is calcined at a high temperature of 600° C. to 650° C. in a muffle furnace for 4 to 5 hours to remove the surfactant and form a microporous structure.

5. The method for preparing magnetic silica microspheres based on cDNA modification according to claim 2, characterized in that: In the step 2, 10 mM 3-aminopropyltriethoxysilane is refluxed at 80° C.-85° C. for 10 h-12 h.

6. The method for preparing magnetic silica microspheres based on cDNA modification according to claim 2, characterized in that: In step 4, the aptamers include: hepatitis B surface antigen aptamer, hepatitis B e antigen aptamer, hepatitis B core antigen aptamer, hepatitis C virus core antigen aptamer, hepatitis C virus envelope protein aptamer, hepatitis A virus aptamer, hepatitis D virus aptamer, hepatitis B virus antibody aptamer, hepatitis C virus antibody aptamer, hepatitis A virus antibody aptamer, and hepatitis D virus antibody aptamer.

7. A magnetic silica microsphere based on cDNA modification, characterized in that: The method is prepared according to any one of claims 1 to 6.

8. Use of the cDNA-modified magnetic silica microspheres according to claim 7 in preparing a detection kit for hepatitis pathogen markers.

9. The use according to claim 8, characterized in that The hepatitis pathogen markers used for detection include hepatitis B surface antigen, hepatitis B e antigen, hepatitis B core antigen, hepatitis C virus core antigen, hepatitis C virus envelope protein, hepatitis A virus, hepatitis D virus, hepatitis B virus antibody, hepatitis C virus antibody, hepatitis A virus antibody, and hepatitis D virus antibody.

Images