Construction method and application of skin injury cell model

The skin lesions cell model was constructed by combining menaquinone induction and ultraviolet light stimulation, which solved the shortcomings of single simulated skin aging in the prior art, and achieved a more realistic skin lesions simulation and compound anti-wrinkle effect evaluation.

CN120519368APending Publication Date: 2025-08-22NANJING AURORA BOREALIS QUALITY INSPECTION TECH SERVICE CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510480710.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

The existing skin lesions cell models only simulate exogenous or endogenous aging from a single aspect, and fail to fully simulate the comprehensive mechanism of human skin aging and damage, resulting in inaccurate anti-wrinkle effect of evaluating compounds.

Method used

HSF cells were treated with a combination of menaquinone induction and ultraviolet light stimulation to simulate the physiological state of human skin sagging and wrinkles. By induced oxidative stress and ultraviolet light irradiation, a skin injury cell model was constructed.

Benefits of technology

This method more accurately evaluates the anti-wrinkle efficacy of the compounds, significantly reduces collagen content through synergistic effects, increases matrix metalloproteinase expression, synergistically inhibits elastin gene expression, simulates the human skin aging process, and provides a more realistic damage model.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005362635290000011
    Figure HDA0005362635290000011
  • Figure HDA0005362635290000012
    Figure HDA0005362635290000012
  • Figure HDA0005362635290000021
    Figure HDA0005362635290000021
Patent Text Reader

Abstract

The invention discloses a construction method and application of a skin injury cell model, and relates to the technical field of cell models. The cell model disclosed by the invention applies the combined action of menadione-induced oxidative stress and ultraviolet radiation, is more in line with the action mechanism of human skin injury, has better effects of reducing the activity of skin fibroblasts and reducing the secretion of collagen, and has a synergistic effect of reducing the content of cell collagen; in the aspect of gene expression, the menadione + illumination group can obviously reduce I-type collagen in cells, increase the gene expression quantity of matrix metalloproteinase-1 in the cells, and synergistically reduce the gene expression quantity of elastin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of cell models, and in particular to a method for constructing a skin injury cell model and applications thereof. Background Art

[0002] The skin is composed of the epidermis, dermis, and subcutaneous tissue. The epidermis primarily provides protection; the subcutaneous tissue, composed of a large number of fat cells and connective tissue, contains numerous nerves and blood vessels, and primarily provides nutrition; the dermis is primarily composed of elastic fibers, hyaluronic acid, and fibroblasts. Fibroblasts make up over 95% of all cells in the dermis. In addition to synthesizing and secreting collagen, elastic fibers, and other matrix components, maintaining skin elasticity, they also possess chemotaxis and adhesion properties, playing a crucial role in maintaining skin elasticity and toughness. A decrease in the number of fibroblasts is a major cause of wrinkles.

[0003] The skin is susceptible to environmental influences, and its aging proceeds in tandem with the aging of the body. It is the result of the combined effects of endogenous aging (natural aging) and exogenous aging (photoaging). Common factors associated with endogenous aging are free radicals, which act on DNA, lipids, and proteins, causing oxidative stress, accelerating cellular aging, causing skin sagging, and the appearance of wrinkles. Exogenous skin aging is primarily caused by environmental factors, such as ultraviolet radiation, air pollutants, extreme ambient temperature and humidity, and unhealthy lifestyle habits. These generate reactive oxygen species (ROS), leading to oxidative stress, collagen degradation, and mitochondrial damage, disrupting the skin's barrier function, causing skin sagging and wrinkle formation.

[0004] Collagen plays a very important supporting role in the skin. Collagen precursor molecules (procollagen) are synthesized by dermal fibroblasts and secreted into the extracellular matrix (ECM), where they are enzymatically processed into mature collagen. Mature collagen spontaneously forms fibrils and is stabilized by cross-linking. Human dermal fibroblasts are responsible for the synthesis and degradation of extracellular matrix proteins. Collagen, elastin, and proteoglycans are the three major categories of dermal extracellular matrix proteins. In human skin, type I collagen (COL1A1) accounts for 80% to 90% of total collagen, while type III accounts for 8% to 12% and type V accounts for less than 5%. The skin contains 2-5% elastin, which is used to support the collagen network. As we age, elastin is lost faster than collagen.

[0005] Matrix metalloproteinases (MMPs) are primarily produced by epidermal keratinocytes and dermal fibroblasts and are responsible for degrading proteins in the extracellular matrix (ECM). Aging fibroblasts produce more reactive oxygen species (ROS), further increasing the expression of MMPs. MMP-1 is primarily involved in the degradation of type I and type III collagen. When overexpressed, MMP-1 specifically degrades ECM components, disrupting the normal structure of collagen and elastin fibers and leading to the appearance of wrinkles and fine lines.

[0006] Currently available modeling methods mostly involve ultraviolet irradiation to simulate exogenous skin aging, hydrogen peroxide-induced oxidative stress to simulate intrinsic skin aging, and cell treatment with inflammatory factors to induce inflammatory responses, increase MMP expression, and degrade collagen. These modeling methods each induce cell damage from a single source, whereas human skin aging and damage result from the combined effects of exogenous and endogenous factors. Summary of the Invention

[0007] The purpose of the present invention is to address the deficiencies of the existing technology and provide a method for constructing a skin damage cell model to simulate the physiological state of human skin sagging and wrinkle formation, so as to evaluate whether a compound has anti-wrinkle efficacy.

[0008] In a first aspect, the present invention provides a method for constructing a skin injury cell model, which utilizes a combination of menadione induction and ultraviolet light stimulation to treat HSF cells.

[0009] In some embodiments, the menadione concentration is less than 20 μM.

[0010] In some embodiments, the construction method comprises treating HSF cells with less than 20 μM menadione, culturing them for a period of time, switching to a phenol red-free medium, and then irradiating them with ultraviolet light. After the irradiation, the cells are collected for subsequent indicator detection.

[0011] In some embodiments, the menadione concentration is 5-15 μM.

[0012] In some embodiments, before treating HSF cells with menadione, HSF cells are seeded into 6-well plates and cultured with basal medium.

[0013] In some embodiments, the HSF cells are cultured in a 6-well plate at a volume concentration of 1*10 3 -1*10 7 cells / mL, preferably 1*10 4 -1*10 6 cells / mL.

[0014] In some embodiments, the volume per well is 1-3 mL.

[0015] In some embodiments, the basal medium culture time is 6-72 hours, preferably 12-36 hours.

[0016] In some embodiments, the cell confluence after culture is ≥30%, preferably greater than 40%, and more preferably 50-80%.

[0017] In some embodiments, the incubation time after adding menadione is 6-72 hours, preferably 12-36 hours.

[0018] In some embodiments, the ultraviolet light source is one or both of UVA and UVB.

[0019] In some embodiments, the intensity of the UV light is 1-30 J / cm 2 , preferably 5-15J / cm 2 .

[0020] In some embodiments, the UV irradiation time is 0.1-10 h, preferably 0.5-2 h.

[0021] In some embodiments, the indicators include collagen content, collagen gene expression, elastin gene expression, and matrix metalloproteinase expression.

[0022] In some embodiments, collagen includes, but is not limited to, one or a combination of type I collagen, type III collagen, and type IV collagen.

[0023] In some embodiments, the relative collagen content is detected using picrosirius red.

[0024] In some embodiments, the matrix metalloproteinase includes but is not limited to one or a combination of matrix metalloproteinase-1, matrix metalloproteinase-2, matrix metalloproteinase-3, matrix metalloproteinase-7, matrix metalloproteinase-9, and matrix metalloproteinase-14.

[0025] In a second aspect, the present invention provides a skin damage cell model constructed by the above-mentioned skin damage cell model construction method.

[0026] In a third aspect, the present invention provides the use of the skin damage cell model in screening and preparing medicines and cosmetics for repairing skin damage.

[0027] In some embodiments, the skin damage is specifically one or a combination of skin sagging, dryness, roughness, wrinkles, aging, and pigmentation.

[0028] Beneficial effects:

[0029] 1. The cell model described in the present invention uses menadione-induced oxidative stress and ultraviolet radiation to act together, which is more consistent with the mechanism of action of human skin damage and can better evaluate whether the compound has anti-wrinkle efficacy.

[0030] 2. Under the combined action of menadione-induced oxidative stress and ultraviolet irradiation, the effect of reducing skin fibroblast activity and collagen secretion was better, and there was a synergistic effect in reducing cellular collagen content. In terms of gene expression, the menadione + light group significantly reduced intracellular type I collagen, increased the gene expression of intracellular matrix metalloproteinase-1, and synergistically reduced the expression of elastin gene. This may be because the two significantly increased intracellular ROS levels through different pathways, breaking the clearance threshold of the cellular antioxidant system (such as SOD and GSH), exacerbating oxidative damage, and then synergistically inhibiting collagen synthesis and elastin gene (ELN). BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a graph showing the cell viability of HSF cells after stimulation with different concentrations of menadione.

[0032] Figure 2 This is the Sirius red staining of HSF cells after treatment with different groups.

[0033] Figure 3 This is a graph showing the relative content of collagen in different groups after treatment.

[0034] Figure 4 Experimental results of gene expression after treatment in different groups. DETAILED DESCRIPTION

[0035] In order to facilitate understanding by those skilled in the art, the present invention will be further described below with reference to the embodiments. The contents mentioned in the embodiments are not intended to limit the present invention.

[0036] Example 1 Menadione and UV-induced skin damage cell model

[0037] In some embodiments, human skin fibroblasts (HSF cells) in logarithmic growth phase are cultured at a rate of 1*10 5 cells / mL were seeded into 6-well plates with a volume of 2 ml per well. The cells were cultured with basal medium for 24 h until the cell confluence reached 60% to 70%. 10 μM menadione was added to each well and cultured for 24 h. The culture medium was then changed to phenol red-free medium and the HSF cells were irradiated with UVA light at an intensity of 10 J / cm 2 After the irradiation, cells from each group were collected for subsequent index detection.

[0038] Detection indicators: collagen staining (picrosirius red) and content detection, related gene expression levels (type I collagen (COL1A1), elastin (ELASTIN) and matrix metalloproteinase-1 (MMP-1)).

[0039] Example 2 Menadione and UV-induced skin damage cell model

[0040] In some embodiments, human skin fibroblasts (HSF cells) in logarithmic growth phase are cultured at a rate of 1*10 4 cells / mL were seeded into 6-well plates with a volume of 3 ml per well. The cells were cultured with basal medium for 12 h until the cell confluence reached 50% to 60%. 5 μM menadione was added to each well and cultured for 36 h. The culture medium was then changed to phenol red-free medium and the HSF cells were irradiated with UVB light at an intensity of 5 J / cm 2 After the irradiation, cells from each group were collected for subsequent index detection.

[0041] Detection indicators: collagen staining (picrosirius red) and content detection, related gene expression levels (type I collagen (COL1A1), elastin (ELASTIN) and matrix metalloproteinase-1 (MMP-1)).

[0042] Example 3: Skin damage cell model induced by menadione and ultraviolet light

[0043] In some embodiments, human skin fibroblasts (HSF cells) in logarithmic growth phase are cultured at a rate of 1*10 6 cells / mL were seeded into 6-well plates with a volume of 1 ml per well and cultured in basal medium for 36 h until the cell confluence reached 70% to 80%. 15 μM menadione was added to each well and cultured for 12 h before switching to phenol red-free medium. HSF cells were irradiated with UVA light at an intensity of 15 J / cm 2 After the irradiation, cells from each group were collected for subsequent index detection.

[0044] Detection indicators: collagen staining (picrosirius red) and content detection, related gene expression levels (type I collagen (COL1A1), elastin (ELASTIN) and matrix metalloproteinase-1 (MMP-1)).

[0045] Example 4 Menadione and UV-induced skin damage cell model

[0046] 1. Experimental Methods

[0047] Human skin fibroblasts (HSF cells) in logarithmic growth phase were cultured at a rate of 1*10 5Cells / mL were seeded in 6-well plates with a volume of 2 ml per well and cultured in basal medium for 24 hours until the cell confluence reached 60% to 70%. 10 μM menadione was added to each well of the model group, while the normal control group was cultured with medium only without menadione. After 24 hours of co-culture, the medium was changed to phenol red-free medium, and all groups were irradiated with UVA light at an intensity of 10 J / cm 2 After the illumination period, cells from each group were collected for subsequent parameter testing. The groups were: normal control group, menadione group, illumination group, and menadione + illumination group.

[0048] Detection indicators: collagen staining (picrosirius red) and content detection, related gene expression levels (type I collagen (COL1A1), elastin (ELASTIN) and matrix metalloproteinase-1 (MMP-1)).

[0049] 1.1 Experimental steps for Sirius red staining and collagen relative content detection

[0050] Sirius red is an anionic dye (sulfonated azo compound), the sulfonic acid group (-SO3 - ) carries a negative charge and specifically binds to collagen through electrostatic attraction (positive and negative charges). Under a standard optical microscope, collagen fibers appear bright red against a yellow background (the background color of picric acid), and the depth of the color reflects the amount of collagen present.

[0051] HSF cells in logarithmic growth phase were cultured at a rate of 1*10 5 cells / mL were seeded in 6-well plates with a volume of 2 ml per well and cultured in basal medium for 24 hours until the cell confluence reached 60% to 70%. 10 μM menadione was added to each well of the model group, while the normal control group was cultured with medium only without menadione. After 24 hours of culture, the medium was changed to phenol red-free medium, and all groups were irradiated with UVA light at an intensity of 10 J / cm 2, irradiation time 1h. After the illumination is over, take the cells out of the incubator, wash once with PBS buffer, add 2mL of Bouin solution to each well, and fix at room temperature for 60min. After fixation, aspirate and discard the Bouin solution, add 2mL of ultrapure water to each well for washing, remove the washing solution, immerse the entire 6-well plate in tap water, and rinse with running water for 15min until no yellow color can be seen with the naked eye. Be careful not to wash away the cells. Then turn the 6-well plate wells upward, remove the 6-well plate cover and dry it overnight at room temperature until there is no water stain to the naked eye. On the second day, add 2mL of modified Sirius red staining solution to each well, place it on a shaker and mix at the lowest speed (about 30rpm), and stain at room temperature for 4h. After the staining is completed, use 0.01N hydrochloric acid solution to wash away the unbound dye, add 2mL to each well, and wash 3 times until no obvious red color is seen. Remove the cleaning solution and add 1mL of 0.01N hydrochloric acid solution to each well. Take photos under an inverted microscope (remove the aperture, adjust the light intensity, select automatic contrast, left: 0.1%, right: 0.1%). After the photo is taken, add 1mL of 0.5N sodium hydroxide solution to each well to dissolve the bound dye. Place on a shaker at the lowest speed (about 30rpm) to mix thoroughly and dissolve at room temperature for 30 minutes. Transfer the liquid from each well to a 96-well plate, 200uL per well, set up three replicates, and measure the absorbance of each well at 540nm using a microplate reader. The higher the absorbance, the more bound dye there is and the higher the relative collagen content.

[0052] 1.2 Experimental steps for gene expression assay

[0053] After the cells were treated with light according to the same steps as above, they were removed from the incubator and washed once with PBS buffer. Cellular mRNA was extracted according to the instructions of the Cell RNA Extraction Kit (RC112-01, Novagens). Reverse transcription was then performed according to the instructions of the Reverse Transcription Kit (R312-01, Novagens). The obtained cDNA was used for qPCR experiments, using GAPDH as the internal reference gene to detect the gene expression levels of Col1α1, MMP-1, and ELASTIN. After the experiment, data were analyzed and processed based on the Ct values. The primer sequences designed are shown in Table 1:

[0054] Table 1

[0055] Gene Primer Sequence(5’-3’) GAPDH Forward Primer GTCTCCTCTGACTTCAACAGCG GAPDH Reverse Primer ACCACCCTGTTGCTGTAGCCAA COL1A1 Forward Primer GATTCCCTGGACCTAAAGGTGC COL1A1 Reverse Primer AGCCTCTCCATCTTTGCCAGCA MMP1 Forward Primer ATGAAGCAGCCCAGATGTGGAG MMP1 Reverse Primer TGGTCCACATCTGCTCTTGGCA ELASTIN Forward Primer GGTTGTGTCACCAGAAGCAGCT ELASTIN Reverse Primer CCGTAAGTAGGAATGCCTCCAAC

[0056] 2 Experimental results

[0057] 2.1 Menadione concentration screening

[0058] HSF cells in logarithmic growth phase were cultured at 1.5*10 5cells / mL were inoculated into 96-well plates, with 3 replicates per group and 100 μL per well. The plates were cultured in a 37°C, 5% CO2 incubator. The culture medium was aspirated after 12 hours, and 100 μL of different concentrations (0.3125 μM, 0.625 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM, 20 μM, and 40 μM) of menadione were added to each well of the experimental group. At the same time, a normal control group was set up, and an equal amount of culture medium was added to the normal control group. The plates were cultured in a 37°C, 5% CO2 incubator for 24 hours.

[0059] Cell viability detection: After adding menadione and continuing to culture for 24 hours, the original culture medium in the 96-well plate was discarded, and 100 μL of phenol red-free culture medium containing 10% CCK-8 reagent was added to each well. The cells were incubated in a 37°C, 5% CO2 incubator for 1 hour. The absorbance at a wavelength of 450 nm was detected using a microplate reader, and the cell viability was calculated using the formula (absorbance value of the experimental group - absorbance value of the blank well) / (absorbance value of the normal control group - absorbance value of the blank well) × 100%.

[0060] The experimental results are as follows Figure 1 As shown in the results, when the concentration of menadione exceeded 10 μM, the viability of HSF cells decreased significantly. When the concentration of menadione was 20 μM and 40 μM, the cell viability was less than 50%, and the cells were severely damaged and not suitable for subsequent experiments. When the concentration of menadione was 10 μM, although menadione had some damage to the cells, the cell viability could still be maintained at about 80%, which can be used as the subsequent modeling concentration.

[0061] 2.2 Collagen staining and content detection results

[0062] The experimental results show that compared with the normal control group cells, light stimulation alone or menadione induction alone can reduce the activity of skin fibroblasts and reduce the secretion of collagen. The modeling effect of light combined with menadione stimulation is better than that of single factors, and has a synergistic effect on reducing the content of cell collagen. Figure 2 and Figure 3 .

[0063] 2.3 Results of relative quantitative PCR experiments on gene expression

[0064] The experimental results show that compared with the normal control group cells, the model induced by menadione alone can reduce the gene expression of type I collagen and elastin in cells, and increase the gene expression of matrix metalloproteinase-1 in cells. The modeling effect of light stimulation alone is weaker than that of menadione alone, and cannot significantly reduce the gene expression level of elastin. The combination of menadione induction and light stimulation is better than a single modeling factor, and can more significantly reduce type I collagen in cells, increase the gene expression of matrix metalloproteinase-1 in cells, and synergistically reduce the gene expression of elastin. For details, seeFigure 4 .

[0065] It should be understood that the detailed description of the technical solutions of the present invention using the preferred embodiments above is illustrative and not restrictive. A person skilled in the art, after reading the present specification, may modify the technical solutions described in the embodiments or replace some of the technical features therein with equivalents; such modifications or replacements do not deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a skin injury cell model, characterized in that: HSF cells were treated with a combination of menadione induction and UV light stimulation.

2. The method according to claim 1, characterized in that The menadione concentration was less than 20 μM.

3. The method according to claim 2, characterized in that The construction method comprises treating HSF cells with menadione, culturing them for a period of time, switching to a phenol red-free culture medium, and then irradiating them with ultraviolet light. After the irradiation, the cells are collected for subsequent indicator detection.

4. The method according to claim 3, characterized in that Before treating HSF cells with menadione, HSF cells were seeded in 6-well plates and cultured with basal medium.

5. The method according to claim 4, characterized in that The cell confluence after culture was ≥30%.

6. The method according to claim 3, characterized in that The ultraviolet light source is one or both of UVA and UVB.

7. The method according to claim 6, characterized in that The intensity of UV light is 1-30J / cm 2 .

8. The method according to claim 3, characterized in that The indicators include collagen content, collagen gene expression, elastin gene expression and matrix metalloproteinase expression.

9. A skin damage cell model, characterized in that: The skin damage cell model is constructed by the method for constructing the skin damage cell model according to any one of claims 1 to 8.

10. Use of the skin damage cell model according to claim 9 in screening and preparing medicines and cosmetics for repairing skin damage.

11. The use according to claim 10, wherein the skin damage is one or more of skin sagging, dryness, roughness, wrinkles, aging, and pigmentation.