A NeuC mutant, a host cell containing the NeuC mutant, and a method for producing sialic acid by fermentation

By constructing a NeuC mutant and combining it with E. coli genetic modification and optimized fermentation conditions, the production of sialic acid was increased, solving the problem of insufficient production in existing technologies and achieving low-cost and efficient production.

CN120519441BActive Publication Date: 2025-10-03ZENO FUTURE BIOTECHNOLOGY (QINGDAO) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511026068.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-24
Publication Date
2025-10-03
Estimated Expiration
2045-07-24

AI Technical Summary

Technical Problem

The production of sialic acid in existing technologies is insufficient, resulting in high production costs and unable to meet the needs of industrial applications such as food and cosmetics.

Method used

By constructing a NeuC mutant and fusing it with the NeuB, glmU and glmS* genes, combined with genetic modification of Escherichia coli C43, knocking out the nanATEK, nagB and pgi genes, optimizing fermentation conditions, and using specific culture media and fermentation processes, the production of sialic acid was increased.

Benefits of technology

High-density fermentation of sialic acid was achieved in a 3L fermenter, with a yield of 61g/L, significantly reducing production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519441B_ABST
    Figure CN120519441B_ABST
Patent Text Reader

Abstract

A NeuC mutant, a host cell containing the NeuC mutant, and a method for fermenting sialic acid. The present invention discloses a NeuC mutant, its encoding nucleic acid, a vector, a host cell containing the vector, and a method for fermenting sialic acid using the host cell. Compared to wild-type NeuC, the NeuC mutant can significantly increase sialic acid production. After 60 hours of high-density fermentation in a 3L fermentor, sialic acid production can reach 61 g / L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of fermentation engineering, and in particular to a NeuC mutant, a host cell containing the NeuC mutant, and a method for producing sialic acid by fermentation. Background Art

[0002] Sialic acid (SA) is a naturally occurring nine-carbon monosaccharide derivative found in human and animal tissues. Its most common structure is N-acetylneuraminic acid (Neu5Ac). It is widely distributed in cell membrane glycoproteins, glycolipids, and mucus, with particularly high concentrations found in brain tissue, gangliosides, and breast milk. The carboxyl group in the sialic acid molecule imparts negative charge, enabling it to play a key role in physiological processes such as cell recognition, immune regulation, and neural signaling. In recent years, sialic acid, due to its unique health benefits, has shown broad application prospects in food, cosmetics, and pharmaceuticals, all of which have a strong demand for low-cost, high-quality sialic acid.

[0003] Sialic acid is present in low concentrations in food, and naturally extracted sialic acid cannot meet the cost requirements of industrial applications such as food and cosmetics. Sialic acid, also known as bird's nest acid, is the main functional component of bird's nests, accounting for 7-12% of the dry matter. Common foods, such as milk and eggs, each contain approximately 0.04% sialic acid. Due to the complex structure of sialic acid, chemical synthesis and enzymatic methods are ineffective in reducing production costs. Microbial fermentation is the primary production method, offering high yield, low cost, and minimal environmental pollution. Some wild or mutant microbial strains can produce polysialic acid, which can be obtained through hydrolysis, isolation, and purification. However, hydrolysis increases the complexity of the production process, reducing economic benefits, and these microbial strains also have low yields. Therefore, using genetically modified Escherichia coli to directly synthesize sialic acid within its entire cell has become the most ideal production method.

[0004] Mingli Zhao et al. (J. Agric. Food Chem. 2023, 71, 10701-10709) reported a method for engineering Escherichia coli to efficiently produce N-acetylneuraminic acid (NeuAc). They introduced NeuC, a uridine diphosphate-N-acetylglucosamine 2-epimerase, and NeuB, a NeuAc synthase, from Campylobacter jejuni, into E. coli BL21(DE3) to construct a NeuAc synthesis pathway. Uridine 5′-diphosphate-N-acetylglucosamine (UDP-GlcNAc) is generated endogenously by the cell upon introduction of glycerol or glucose. NeuC catalyzes the conversion of N-acetylmanosamine (ManNAc), which is then catalyzed by the exogenously introduced NeuB to NeuAc. Competitive inhibition of precursor synthesis was blocked, inactivating the nanK, nanT, and nagB genes. Among them, nanA reversibly hydrolyzes NeuAc into ManNAc and pyruvate, nanT transports NeuAc into cells, reducing extracellular accumulation, nanK catalyzes the irreversible conversion of ManNAc to ManNAc-6-phosphate, reducing ManNAc supply, and nagB catalyzes the conversion of glucosamine-6-phosphate to fructose-6-phosphate, thereby reducing UDP-GlcNAc supply. Enhancing the expression of the UDP-GlcNAc synthesis pathway genes glmS, glmM, and glmU enhanced UDP-GlcNAc supply. Selecting NeuC and NeuB from Neisseria meningitidis further improved NeuAc production. Furthermore, glycerol as the sole carbon source was found to be more favorable for NeuAc synthesis than glucose or a mixture of glycerol and glucose. The resulting engineered strain produced 7.02 g / L of NeuAc in shake flasks. This yield was increased to 46.92 g / L in a 5-L fed-batch reactor, with a production rate of 0.82 g / L / h.

[0005] There is still a need to further increase sialic acid production to reduce production costs. Summary of the Invention

[0006] To solve the above problems existing in the prior art, the present invention provides a NeuC mutant, a host cell comprising the NeuC mutant, and a method for producing sialic acid by fermentation, so as to increase sialic acid production and reduce production costs.

[0007] In a first aspect, the present invention provides a NeuC mutant, the amino acid sequence of which is shown in SEQ ID NO: 22.

[0008] In a second aspect, the present invention provides a fusion protein comprising, from N-terminus to C-terminus, a Sumo tag, a (GGGGS)2 flexible linker, and a NeuC mutant; the amino acid sequence of the Sumo tag is shown in SEQ ID NO: 26.

[0009] In a third aspect, the present invention provides a nucleic acid encoding the NeuC mutant or fusion protein as described above.

[0010] In a fourth aspect, the present invention provides a vector comprising the nucleic acid as described above.

[0011] In a fifth aspect, the present invention provides a host cell comprising the vector described above.

[0012] Preferably, the host cell is Escherichia coli.

[0013] Preferably, the host cell is Escherichia coli C43, and compared with wild-type C43, the nanATEK gene cluster, nagB gene and pgi gene are knocked out.

[0014] More preferably, the host cell overexpresses the NeuB gene, the glmU gene, the glmS* mutant gene, and the glmM gene, the nucleotide sequence of the NeuB gene is shown in SEQ ID NO: 4, the nucleotide sequence of the glmU gene is shown in SEQ ID NO: 8, the nucleotide sequence of the glmS* mutant gene is shown in SEQ ID NO: 6, and the nucleotide sequence of the glmM gene is shown in SEQ ID NO: 9.

[0015] More preferably, the host cell contains a nucleic acid encoding the fusion protein described above.

[0016] In a sixth aspect, the present invention provides the use of the aforementioned NeuC mutant, fusion protein, nucleic acid, vector, and host cell in the fermentative production of sialic acid.

[0017] In a seventh aspect, the present invention provides a method for producing sialic acid by fermentation, comprising fermenting and culturing the host cell as described above in a culture medium.

[0018] Preferably, the culture medium comprises: 20-30 g / L glycerol, 4.5 mg / L thiamine, 13.5 g / L potassium dihydrogen phosphate, 4.0 g / L diammonium hydrogen phosphate, 1.4 g / L magnesium sulfate heptahydrate, 1.7 g / L citric acid, and 10% (v / v) trace element solution. The pH value of the culture medium is adjusted to 6.8 and then sterilized by high pressure. The formula of the trace element solution is 25.0 g / L FeCl36H2O, 2.3 g / L CaCl2·2H2O, 2.6 g / L ZnCl2, 2.0 g / L CuSO4·5H2O, 2.5 g / LMnSO4·H2O, 2.6 g / L Na2MoO4·2H2O, 0.7 g / L H3BO3, pH 6.9.

[0019] Based on the above technical solution, the present invention provides a new NeuC mutant, and uses it to construct an engineered bacterium capable of industrially fermenting and producing sialic acid. After high-density fermentation culture for 60 hours in a 3L fermentor, the sialic acid yield can reach 61g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The 72h shake flask yield of the host bacteria containing NeuC mutants M1-M5 of the present invention (the control is the NeuC wild type);

[0021] Figure 2 This is the 72h shake flask yield after adding different water-soluble tags to the N-terminus of M3 in the present invention (the control is M3 without tags);

[0022] Figure 3 The parameter changes of the engineered bacteria finally constructed in the present invention during the high-density fermentation culture of 60 hours in a 3L fermenter. DETAILED DESCRIPTION

[0023] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0024] Example 1 Construction of the chassis strain C43ΔnanATEKΔnagBΔpgi

[0025] In this example, the nanATEK gene cluster (gene sequence shown in SEQ ID NO: 1), the nagB gene (gene sequence shown in SEQ ID NO: 2), and the pgi gene (gene sequence shown in SEQ ID NO: 3) were sequentially knocked out in Escherichia coli C43 (DE3) (purchased from the China Industrial Microorganism Culture Collection Center) to construct the starting strain C43ΔnanATEKΔnagBΔpgi that metabolizes and synthesizes sialic acid.

[0026] The specific process construction includes:

[0027] 1. Knockout of the nanATEK gene cluster

[0028] The upstream homology arm was amplified using the primer pair SY-ATEK-F / R with the C43 genome as a template, and the downstream homology arm was amplified using the primer pair XY-ATEK-F / R with the C43 genome as a template. The upstream and downstream homology arms were then overlap-PCRed using the SY-ATEK-F / XY-ATEK-R primers to obtain the complete donor DNA: ATEK-upper-downper.

[0029] The N20 sequence was designed on the website and amplified using the ptargerF-ATEK-F / ptargerF-R primer pair and the blank ptargerF (purchased from Addgene) plasmid as a template to obtain a linearized vector with the N20 sequence. Ligase was used for blunt-end ligation to obtain the plasmid ptargerF-ATEK.

[0030] The plasmid ptargerF-ATEK and the fragment ATEK-up-down were co-electroporated into the C43 / pCas chassis bacteria containing the pCas plasmid (purchased from Addgene) (arabinose was added for induction during the preparation of the competent state). After verification and identification, the nanATEK knockout strain C43△nanATEK / pCas / ptargerF-ATEK was obtained.

[0031] IPTG was added to induce and the strain was cultured overnight to eliminate the ptargerF-ATEK plasmid, and the strain C43△nanATEK / pCas was obtained.

[0032] 2. Knockout of the nagB gene

[0033] The upstream homology arm was amplified using the primer pair SY-nagB-F / R with the C43 genome as a template, and the downstream homology arm was amplified using the primer pair XY-nagB-F / R with the C43 genome as a template. The upstream and downstream homology arms were then overlap-PCRed using the SY-nagB-F / XY-nagB-R primers to obtain the complete donor DNA: nagB-upper-lower.

[0034] The N20 sequence was designed on the website and amplified using the ptargerF-nagB-F / ptargerF-R primer pair and the blank ptargerF plasmid as a template to obtain a linearized vector with the N20 sequence. Ligase was used for blunt-end ligation to obtain the plasmid ptargerF-nagB.

[0035] The plasmid ptargerF-nagB and the fragment nagB-up-down were co-electroporated into the C43△nanATEK / pCas chassis bacteria containing the pCas plasmid (arabinose was added for induction during the preparation of the competent state). After verification and identification, the nagB knockout strain C43△nanATEK△nagB / pCas / ptargerF-nagB was obtained.

[0036] IPTG was added to induce and the strain was cultured overnight to eliminate the ptargerF-nagB plasmid, and the strain C43△nanATEK△nagB / pCas was obtained.

[0037] 3. Knockout of the pgi gene

[0038] The upstream homology arm was amplified using the primer pair SY-pgi-F / R with the C43 genome as a template, and the downstream homology arm was amplified using the primer pair XY-pgi-F / R with the C43 genome as a template. The upstream and downstream homology arms were then overlap-PCRed using the SY-pgi-F / XY-pgi-R primers to obtain the complete donor DNA: pgi-upper-lower.

[0039] Design the N20 sequence on the website and amplify using the ptargerF-pgi-F / ptargerF-R primer pair and the blank ptargerF plasmid as a template to obtain a linearized vector with the N20 sequence. Use ligase for blunt-end ligation to obtain the plasmid ptargerF-pgi.

[0040] The plasmid ptargerF-pgi and the fragment pgi-up-down were co-electroporated into the C43△nanATEK△nagB / pCas chassis bacteria containing the pCas plasmid (arabinose was added for induction during the preparation of the competent state). After verification and identification, the pgi-knockout strain C43△nanATEK△nagB△pgi / pCas / ptargerF-nagB was obtained.

[0041] IPTG was added to induce and the strain was cultured overnight to eliminate the ptargerF-pgi plasmid, and then cultured overnight at 42°C to eliminate the pCas plasmid to obtain strain C43△nanATEK△nagB△pgi.

[0042] Example 2 Construction of recombinant bacteria producing sialic acid

[0043] Overexpression plasmids pETDuet-neuB-neuC and pACDuet-glmU-glmS*-glmM were constructed and introduced into the bacterial strain constructed in Example 1 to obtain the recombinant strain C43ΔnanATEKΔnagBΔpgi / pETDuet-neuB-neuC / pACYCDuet-kanR-glmU-glmS*-glmM capable of producing sialic acid. pETDuet-neuB-neuC was expressed using the T7lac-inducible promoter, while the pACYCDuet-kanR-glmU-glmS*-glmM vector was constitutively expressed using J23111 and J23107.

[0044] The construction process of the overexpression plasmid pETDuet-neuB-neuC is as follows:

[0045] NeuB (gene sequence shown in SEQ ID NO: 4, amino acid sequence shown in SEQ ID NO: 14) and NeuC (gene sequence shown in SEQ ID NO: 5, amino acid sequence shown in SEQ ID NO: 15) are derived from Neisseria. After artificial synthesis (Sangon Biotech Co., Ltd.), neuB was ligated into pETDuet-1 (vector purchased from Addgene) at the Xba I / not I restriction sites (endonuclease and T4 ligase purchased from Tankla) using double restriction ligation to generate the overexpression plasmid pETDuet-neuB. NeuC was then ligated into the Nde I / Kpn I restriction sites using pETDuet-neuB as the vector to generate the overexpression plasmid pETDuet-neuB-neuC.

[0046] The overexpression plasmid pACYCDuet-kanR-glmU-glmS*-glmM was constructed as follows:

[0047] pACYCDuet-1 (vector purchased from Addgene) was modified in our laboratory by replacing the chloramphenicol resistance gene with the kanamycin resistance gene to obtain the blank vector pACYCDuet-kanR.

[0048] An artificially synthesized glmS* mutant gene (Sangon Biotechnology Co., Ltd., gene sequence shown in SEQ ID NO: 6, and the expressed amino acid sequence shown in SEQ ID NO: 16) contains four mutations, E15K, D387V, S450P, and E525G, compared to glmS from Escherichia coli C43 (wild-type glmS, gene sequence shown in SEQ ID NO: 7, and the expressed amino acid sequence shown in SEQ ID NO: 17).

[0049] The glmU-F / glmU-R primer pair was used to amplify the E. coli C43 genome as a template to obtain the glmU gene fragment (sequence shown in SEQ ID NO: 8, amino acid sequence shown in SEQ ID NO: 18) with the homology arms required for subsequent overlap PCR. The glmS*-F / glmS*-R primer pair was used to amplify the glmS* gene fragment with the homology arms required for subsequent overlap PCR and the J23111 promoter sequence from the pETDuet-glmS* plasmid (Sangon Biotech Co., Ltd.). Overlap PCR was performed using the glmU and glmS* gene fragments obtained in the above two steps and the glmS* primer pair glmS*-F / glmU-R to obtain the J23111-glmS*-glmU linear fragment.

[0050] The glmM gene fragment (gene sequence shown in SEQ ID NO: 9, amino acid sequence shown in SEQ ID NO: 19) with homology arms and promoter J23107 sequence was amplified using the glmM-F / glmM-R primer pair and the Escherichia coli C43 genome as a template.

[0051] The pAC-F() / R() blank vector pACYCDuet-kanR was used as a template for amplification to obtain a linearized pACYCDuet-kanR fragment with the subsequent required homology arm sequence.

[0052] The glmU-glmS* and glmM fragments were ligated into the pACYCDuet-kanR vector using the Gibson assembly (Novagen kit), and the original double T7lac promoter of the vector was replaced with the J23111 promoter and the J23107 promoter to obtain the overexpression plasmid pACYCDuet-kanR-glmU-glmS*-glmM.

[0053] The above-mentioned overexpression plasmids pETDuet-neuB-neuC and pACYCDuet-kanR-glmU-glmS*-glmM were co-electroporated into the chassis bacteria C43△nanATEK△nagB△pgi described in Example 1 to preliminarily construct the sialic acid-producing recombinant strain C43△nanATEK△nagB△pgi / pETDuet-neuB-neuC / pACYCDuet-kanR-glmU-glmS*-glmM, which served as the initial engineered bacteria.

[0054] Example 3: Shake flask culture of recombinant bacteria

[0055] Genetically engineered Escherichia coli cells were cultured overnight in 5 mL of LB medium containing appropriate antibiotics at 37°C and 200 rpm. A 10% (volume) seed culture was then inoculated into GD medium (Glycerol Defined Media) for shake flask cultivation. GD medium consists of: 20 g / L glycerol; 4.5 mg / L thiamine; 13.5 g / L potassium dihydrogen phosphate; 4.0 g / L diammonium phosphate; 1.4 g / L magnesium sulfate heptahydrate; 1.7 g / L citric acid; and 10% (volume) trace element solution. The medium was adjusted to a pH of 6.8 and sterilized by autoclave. The formula of trace element solution is 25.0 g / L FeCl3 6H2O, 2.3 g / L CaCl2·2H2O, 2.6 g / L ZnCl2, 2.0 g / L CuSO4·5H2O, 2.5 g / L MnSO4·H2O, 2.6 g / L Na2MoO4·2H2O, 0.7 g / L H3BO3, pH 6.9.

[0056] When the culture reached an OD600 of 0.8, IPTG was added to a final concentration of 0.1 mM. Simultaneously, the culture temperature was lowered to 25°C and cultured for another 72 hours. Samples were taken at 72 hours of fermentation and sialic acid production was analyzed using high-performance liquid chromatography.

[0057] The results showed that after 72 hours of culture in GD medium, the sialic acid shake flask production of the initial engineered bacteria reached 9.2 g / L.

[0058] Example 4: Construction of a recombinant strain of a UDP-N-acetylglucosamine epimerase (NeuC) mutant

[0059] To improve the sialic acid production capacity of the recombinant strain, computer-assisted sequence alignment was used to identify highly conserved residues and calculate ΔΔGFold to predict potential sites that could improve protein stability. Combining this with protein structure analysis, five amino acid residues with negative ΔΔGFold values ​​or positive mutation trends in multiple sequence alignment were selected as mutation sites.

[0060] Table 1: Five mutation sites identified by computer aided

[0061] Serial number Mutation site Wild-type amino acid Mutated amino acid Abbreviation <![CDATA[ΔΔG Fold (kcal / mol)]]> M1 50 K P K50P -0.48 M2 61 Y W Y61W -0.08 M3 149 N G N149G -0.84 M4 192 Y V Y192V -0.35 M5 221 Y G Y221G -0.34

[0062] Construction of Single-Point Mutant Plasmids: The single-point mutants to be constructed include: K50P, Y61W, N149G, Y192V, and Y221G (designated M1 to M5, with amino acid sequences as SEQ ID NOs: 20-24). Mutations were introduced using primer-based PCR. The amino acid sequence of the mutated NeuC gene is shown below. Sequencing results confirmed the absence of random mutations beyond the desired mutation site, indicating successful construction of the mutant plasmid.

[0063] The mutant plasmids were electroporated into Escherichia coli C43△nanATEK△nagB△pgi, and the obtained recombinant strains were named C43△nanATEK△nagB△pgi / pETDuet-neuB-neuC / pACYCDuet-kanR-glmU-glmS*-glmM-M1 ~M5.

[0064] The sialic acid production of the five recombinant bacteria was measured using the method of Example 3, and the initial engineered bacteria were used as a control. The results are as follows: Figure 1 As shown in Figure 3, after NeuC was mutated, the sialic acid production of mutant M3 (N149G) was significantly increased to 12.4 g / L.

[0065] Example 5: Addition of a water-soluble tag to NeuC mutations

[0066] To improve water solubility, different water-soluble tags (NT11, Sumo, GST, and CBM66, whose gene sequences are shown in SEQ ID NOs: 10-13, and whose amino acid sequences are shown in SEQ ID NOs: 25-28, respectively, and are designated L1-L4) were added to the N-terminus of the amino acid sequence of NeuC mutant M3 (N149G). A flexible linker consisting of a double repeat sequence of four glycines and one serine (GGGGS) was placed between the tags and NeuC mutant M3. These tags were linked to NeuC mutant M3 using a seamless cloning kit.

[0067] The mutant plasmid containing the water-soluble tag was electroporated into Escherichia coli C43△nanATEK△nagB△pgi, and the obtained recombinant strains were named C43△nanATEK△nagB△pgi / pETDuet-neuB-neuC / pACYCDuet-kanR-glmU-glmS*-glmM-M3-L1 ~ L4.

[0068] The sialic acid production of the four recombinant bacteria was measured using the method of Example 3 for 72 h, and the untagged recombinant bacteria C43ΔnanATEKΔnagBΔpgi / pETDuet-neuB-neuC / pACYCDuet-kanR-glmU-glmS*-glmM-M3 was used as a control. The results are as follows: Figure 2 As shown in Figure 3, after the water-soluble tag L2 (Sumo) was attached to NeuC mutant M3, the sialic acid production increased to 15.5 g / L.

[0069] Example 6: 3L fermenter culture

[0070] C43ΔnanATEKΔnagBΔpgi / pETDuet-neuB-neuC / pACYCDuet-kanR-glmU-glmS*-glmM-M3-L2 was selected as the engineered strain for high-density fermentation of sialic acid in a 3L fermentor. The initial culture medium was the GD medium from Example 3, with the glycerol concentration adjusted to 30 g / L. The feed medium contained 600 g / L glycerol, 20 g / L MgSO4·7H2O, and 0.2 g / L thiamine. After 60 hours of high-density fermentation, sialic acid production reached 61 g / L.

[0071] The primer sequences used in the above examples are shown in the following table:

[0072] Primer SEQ ID NO Sequence (5’-3’) glmU-F 29 GTTAAGTATAAGAAGGAGATATACATatgttgaataatgctatgagcgtagtgatcc glmU-R 30 accgggttagccggccagaatcactttttctttaccggacga [[ID= 31 ​ ​ 32 ​ ​ 33 ​ ​ 34 ​ ​ 35 ​ ​ 36 ​ ​ 37 ​ ​ 38 ​ ​ 39 ​ ​ 40 ​ ​ 41 ​ ​ 42 ​ ​ 43 ​ ​ 44 ​ ​ 45 ​ ​ 46 ​ ptargerF-nagB-F 47 TGTACCAACACCGACAGTCAgttttataggctagaaatagcaag SY-pgi-F 48 ctgcgtattttccgaataaacaacg SY-pgi-R 49 ttctaacgtcgatgggactcctccgttcagcctgggtg XY-pgi-F 50 cacccaggctgaacggaggagtcccatcgacgttagaa XY-pgi-R 51 ccaacgcagaccgctgcct ptargerF-pgi-F 52 ttctaccagctgatccaccagttttagagctagaaatagcaagttaaaataagg 50_F 53 gcacctatccagaagtgacccgcgaaaac 50_R 54 ttctggataggtgcggccataggttttcatc 61_F 55 gcatacctggctgtttagcaatcagattcaagg 61_R 56 cagccaggtatgctgatagttttcgcgggtc 149_F 57 gtggcgggcgaacaagcggtgac 149_R 58 gttcgcccgccaccagatgaatatggctc 192_F 59 gaatatgttggcctgccgtatgaaaactatgg 192_R 60 caggccaacatattctttcacttcttccagg 221_F 61 cggcgcagggttttaaagcgctggaac 221_R 62 aaaccctgcgccgcatactgcggcatc

[0073] The specific description of the above embodiments cannot be understood as limiting the scope of protection of the present invention. Any non-essential improvements and adjustments made by those skilled in the art to the present invention based on the contents of the above invention shall fall within the scope of protection of the present invention.

Claims

1. A NeuC mutant, the amino acid sequence of which is shown in SEQ ID NO:

22.

2. A fusion protein comprising, from N-terminus to C-terminus, a Sumo tag, a (GGGGS)2 flexible linker, and the NeuC mutant of claim 1; the amino acid sequence of the Sumo tag is shown in SEQ ID NO:

26. 3 . A nucleic acid encoding the NeuC mutant according to claim 1 or the fusion protein according to claim 2 . A vector comprising the nucleic acid according to claim 3 . A host cell comprising the vector according to claim 4 .

6. The host cell according to claim 5, characterized in that: The host cell is Escherichia coli.

7. The host cell according to claim 5, characterized in that: The host cell is Escherichia coli C43, and compared with the wild type C43, the nanATEK gene cluster, nagB gene and pgi gene are knocked out.

8. The host cell according to claim 7, characterized in that: The host cell overexpresses the NeuB gene, the glmU gene, the glmS* mutant gene, and the glmM gene, the nucleotide sequence of the NeuB gene is shown in SEQ ID NO: 4, the nucleotide sequence of the glmU gene is shown in SEQ ID NO: 8, the nucleotide sequence of the glmS* mutant gene is shown in SEQ ID NO: 6, and the nucleotide sequence of the glmM gene is shown in SEQ ID NO:

9.

9. The host cell according to any one of claims 5 to 8, characterized in that: The host cell contains a nucleic acid encoding the fusion protein according to claim 2.

10. Use of the NeuC mutant according to claim 1, the fusion protein according to claim 2, the nucleic acid according to claim 3, the vector according to claim 4, and the host cell according to any one of claims 5 to 9 in fermentative production of sialic acid.

11. A method for producing sialic acid by fermentation, characterized in that: The host cell according to any one of claims 5 to 9 is fermented and cultured in a culture medium.

Citation Information

Patent Citations

  • Construction method and application of recombinant escherichia coli with high yield of N-acetylneuraminic acid

    CN116555147A

  • Mutant of uridine 5 '-diphosphate-N-acetylglucosamine 2 epimerase and application thereof

    CN119876092A