Construction method and application of lupus susceptible animal model

The MTCH2 gene was knocked out through CRISPR Cas9 technology to construct an animal model of lupus erythematosus, which solved the problem of lack of specific knockout in the existing technology, and achieved in-depth research on the mechanism of lupus disease and screening of therapeutic drugs.

CN120519461AActive Publication Date: 2025-08-22BEIJING HOSPITAL
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510720888.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-08-22
Estimated Expiration
2045-05-30

AI Technical Summary

Technical Problem

The prior art is difficult to effectively build an animal model of lupus, used to study the pathogenesis and treatment methods of lupus, and there is a lack of specific knockout technology for MTCH2 gene.

Method used

The MTCH2 gene was knocked out by using CRISPR Cas9 technology, and a specific gRNA was designed and introduced into the receptor cells using recombinant vectors were used to establish an animal model of lupus erythematosus. Homozygous Mtch2fl/fl animals were obtained and hybridized with Cre animals to construct a specific tissue-specific lupus model.

Benefits of technology

Systemic and B cell specific knockout was achieved, and the multi-tissue level function of lupus disease was deeply explored, which verified the important role of MTCH2 molecules in the progression of lupus disease, and provided new ideas for disease mechanism research and drug screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519461A_ABST
    Figure CN120519461A_ABST
Patent Text Reader

Abstract

The invention discloses a construction method and application of a lupus susceptible animal model. According to the application, the method for constructing the lupus erythematosus animal model by utilizing MTCH2 knockout is proposed for the first time, the lupus erythematosus animal model is constructed from multiple tissue levels (whole body knockout and B cell specific knockout), and a series of functions of apoptosis, activation, mitochondrial membrane potential difference, oxidative stress, oxidative phosphorylation, antibody generation and the like of lupus B cells are deeply explored by utilizing the model; the important effect of the MTCH2 molecule on the progress of the lupus erythematosus disease is verified, and a new thought is provided for research on the mechanism of the lupus erythematosus disease and screening of therapeutic drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to a method for constructing a lupus susceptibility animal model and its application. Background Art

[0002] Systemic lupus erythematosus (SLE) is an autoimmune disease with a complex pathogenesis, characterized by the production of large amounts of autoantibodies and persistent chronic inflammation, which can cause damage to multiple tissues and organs throughout the body. SLE is characterized by the development of an immune response against nuclear autoantigens, such as nucleic acids and histones.

[0003] Laboratory animals are indispensable tools in biomedical research, playing a crucial role in exploring the underlying functions of genes, exploring the pathogenesis of diseases, and preclinical drug screening. Providing an animal model for lupus is crucial for studying its pathogenesis and achieving effective treatment. Summary of the Invention

[0004] To overcome the deficiencies of the prior art, the present invention provides a method for constructing a lupus susceptibility animal model and its application.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] A first aspect of the present invention provides a gRNA targeting the MTCH2 gene, wherein the sequence of the gRNA is shown in any one of SEQ ID NOs: 1-4.

[0007] Furthermore, the gRNA also includes biological materials related to the gRNA.

[0008] Furthermore, the biomaterial is selected from any one of the following:

[0009] (1) a nucleic acid molecule encoding the gRNA;

[0010] (2) an expression cassette containing the nucleic acid molecule described in (1);

[0011] (3) a recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2);

[0012] (4) A recombinant cell containing (1) the nucleic acid molecule, (2) the expression cassette, or (3) the recombinant vector.

[0013] The second aspect of the present invention provides a product, which includes the gRNA described in the first aspect of the present invention.

[0014] Furthermore, the product includes a kit.

[0015] Furthermore, the kit also includes Cas9 mRNA.

[0016] Furthermore, the kit further comprises a donor vector.

[0017] A third aspect of the present invention provides a method for constructing a lupus erythematosus animal model, the method comprising constructing a lupus erythematosus animal model by knocking out the MTCH2 gene.

[0018] Furthermore, the knockout is to knock out the MTCH2 gene using CRISPR Cas9 technology.

[0019] Furthermore, the method specifically includes:

[0020] (1) Introduce gRNA, Cas9 mRNA, and donor vector into recipient cells to obtain F0 generation animals;

[0021] (2) Positive F0 generation animals were mated with wild-type animals to obtain homozygous Mtch2 fl / fl animal;

[0022] (3)Mtch2 fl / fl The animals were crossed with Cre animals and drugs were introduced to obtain a lupus erythematosus animal model;

[0023] Or the method specifically comprises: adoptively transferring spleen cells / CD4+ T cells from BM12 animals into Mtch2 fl / fl The lupus erythematosus animal model was established by crossing the animals with Cre animals.

[0024] Furthermore, the gRNA is the gRNA described in the first aspect of the present invention.

[0025] Furthermore, the animal is a mammal.

[0026] Furthermore, the mammal is selected from rodents.

[0027] Furthermore, the rodent is selected from mice.

[0028] Furthermore, the mice are selected from C57BL / 6J mice.

[0029] Furthermore, the Cre animals include CAGGCre-ER mice and / or Mb1-iCre mice.

[0030] Furthermore, the recipient cell described in (1) is a fertilized egg.

[0031] Furthermore, the introduction method described in (1) is microinjection.

[0032] Furthermore, the drug described in (3) is a lupus erythematosus inducing drug.

[0033] Furthermore, the lupus erythematosus inducing drug is selected from Pristane or Imiquimod.

[0034] Furthermore, the method further comprises maintaining the gene knockout state using a gene knockout activator.

[0035] Furthermore, the gene knockout activator is selected from tamoxifen.

[0036] The fourth aspect of the present invention provides the use of the gRNA described in the first aspect of the present invention or the product described in the second aspect of the present invention in constructing a lupus erythematosus model.

[0037] The fifth aspect of the present invention provides the use of the lupus erythematosus animal model constructed by the method described in the third aspect of the present invention in screening drugs for treating / preventing lupus erythematosus or in studying the disease mechanism / disease target of lupus erythematosus.

[0038] The sixth aspect of the present invention provides a method for screening candidate drugs for treating / preventing lupus erythematosus, the method comprising administering the drug to be tested to the lupus erythematosus animal model constructed by the method described in the third aspect of the present invention, and selecting the drug to be tested that can improve the symptoms of lupus erythematosus.

[0039] A seventh aspect of the present invention provides the use of MTCH2 as a target in screening candidate drugs for treating lupus erythematosus.

[0040] Furthermore, the method for screening a candidate drug for treating lupus erythematosus includes: testing the effect of the candidate drug on the MTCH2 level in a sample obtained from a subject, wherein, after using the candidate drug, an increase in the MTCH2 level indicates that the candidate drug has an effect in treating lupus erythematosus.

[0041] Advantages and beneficial effects of the present invention:

[0042] This application proposes for the first time the use of MTCH2 knockout to construct an animal model of lupus erythematosus. This animal model is constructed from multiple tissue levels (systemic knockout and B cell-specific knockout), and this model is used to conduct in-depth research on a series of functions of lupus B cells, including apoptosis, activation, mitochondrial membrane potential difference, oxidative stress, oxidative phosphorylation, and antibody production. This verifies the important role of MTCH2 molecules in the progression of lupus disease, and provides new ideas for the study of the disease mechanism of lupus erythematosus and the screening of therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1Figure 1 is an analysis of MTCH2 gene expression, where 1A is a cell image of SLE patients and healthy patients, 1B is a graph showing MTCH2 expression in SLE patients with different disease activity levels, and 1C is an analysis of MTCH2 in B cells from SLE patients.

[0044] Figure 2 This is the PCR genotype identification diagram of F1 mice;

[0045] Figure 3 is the Southern blot genotype identification diagram of F1 mice;

[0046] Figure 4 It is Mtch2 fl / fl CAGG Cre / + Mouse construction strategy diagram;

[0047] Figure 5 It is Mtch2 fl / fl Mb1 Cre / + Mouse construction strategy diagram;

[0048] Figure 6 This is a mouse genotype identification diagram, where 6A is Mtch2 fl / fl Mb1 Cre / + Agarose gel electrophoresis gel image of mouse genotype identification, 6A below is its genotype identification result, 6B above is Mtch2 fl / fl CAGG Cre / + Agarose gel electrophoresis gel image of mouse genotype identification, and the image below 6B is the genotype identification result;

[0049] Figure 7 It is Mtch2 fl / fl CAGG Cre / + Lupus phenotype results in mice, where 7A on the left is Mtch2 induced by pristane for 6 months fl / fl and Mtch2 fl / fl CAGG Cre / + Comparison of spleen in mouse lupus model, 7A right is the comparison of its mandibular lymph nodes, 7B is the comparison of Mtch2 induction by pristane for 6 months fl / fl and Mtch2 fl / fl CAGG Cre / + Comparison of urine albumin, anti-dsDNA and antinuclear antibodies (ANA) in the mouse lupus model. 7C on the left shows Mtch2 induced by imiquimod (IMQ) for 6 weeks. fl / fl and Mtch2 fl / fl CAGG Cre / + A comparison of the spleen of a mouse lupus model, 7C right is a comparison of its mandibular lymph nodes, and 7D is a comparison of Mtch2 induced by imiquimod (IMQ) for 6 months. fl / fl and

[0050] Mtch2 fl / fl CAGG Cre / + Comparison of urine protein, anti-dsDNA and antinuclear antibodies (ANA) in the mouse lupus model. 7E is a 6-month pristane-induced Mtch2 fl / fl and Mtch2 fl / fl CAGG Cre / + Immunofluorescence detection of IgG and IgM in the kidneys of a mouse lupus model. 7F is a picture of Mtch2 induced by pristane for 6 months. fl / fl and Mtch2 fl / fl CAGG Cre / + Figure 7G shows the results of kidney HE staining in a mouse lupus model. The results are as follows: fl / fl and Mtch2 fl / fl CAGG Cre / + Figure 1 shows the results of flow cytometry detection of germinal centers in a mouse lupus model;

[0051] Figure 8 It is Mtch2 fl / fl Mb1 Cre / + Figure 8A shows the results of mouse lupus phenotype, where 8A is Mtch2 induced by pristane for 6 months fl / fl and Mtch2 fl / fl Mb1 Cre / + Comparison of spleens in mouse lupus models. 8B is Mtch2 induced by pristane for 6 months. fl / fl and Mtch2 fl / fl Mb1 Cre / + Comparison of urine albumin, anti-dsDNA, and antinuclear antibodies (ANA) in a mouse lupus model. 8C is a graph showing Mtch2 expression in H2-IA BM12 / KhEgJ mice (BM12 mice) induced for 14 days. fl / fl and Mtch2 fl / fl Mb1 Cre / + Comparison of spleens in mouse lupus models. 8D is a BM12 mouse model induced with Mtch2 for 14 days. fl / fl and Mtch2 fl / fl Mb1 Cre / + Comparison of urine albumin, anti-dsDNA and antinuclear antibodies (ANA) in mouse lupus models. 8E is a graph showing Mtch2 expression in mice induced by pristane for 6 months. fl / fl and Mtch2 fl / fl Mb1 Cre / + The flow cytometric analysis of antibody-secreting cells (ASC) and the cell ratio of IgG1-expressing ASC in the spleen of a mouse lupus model is shown in the flow cytometric graph and bar graph. 8F is a graph showing Mtch2 expression in BM12 mice induced for 14 days. fl / fland Mtch2 fl / fl Mb1 Cre / + Comparison of germinal center ratios in spleen flow cytometry of a mouse lupus model;

[0052] Figure 9 MTCH2 aggravates lupus disease progression by affecting mitochondrial function. 9A is a diagram of ROS and mitochondrial ROS (mROS) in B cells of SLE patients, and 9B is a diagram of pristane-induced Mtch2 fl / fl and Mtch2 fl / fl CAGG Cre / + Figure 9C shows the results of mROS and mitochondrial membrane potential difference (TMRM) detection in spleen B cells of lupus mice. fl / fl and Mtch2 fl / fl Mb1 Cre / + The apoptosis ratio of B cells in the spleen of lupus mice was detected by flow cytometry. 9D shows the pristane-induced Mtch2 fl / fl and Mtch2 fl / fl CAGG Cre / + Mitochondrial morphology of splenic B cells in lupus mice. 9D shows pristane-induced Mtch2. fl / fl and Mtch2 fl / fl Mb1 Cre / + Mitochondrial morphology of splenic B cells in lupus mice. 9E shows pristane-induced Mtch2. fl / fl and Mtch2 fl / fl CAGG Cre / + The results of the Seahorse experiment on mitochondrial stress in splenic B cells of lupus mice are shown in Figure 9E. The figure below shows pristane-induced Mtch2. fl / fl and Mtch2 fl / fl Mb1 Cre / + Results of the Seahorse experiment detecting mitochondrial stress in splenic B cells of lupus mice. DETAILED DESCRIPTION

[0053] The following provides definitions of some terms used in this specification. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0054] The present invention provides a gRNA targeting the MTCH2 gene, wherein the sequence of the gRNA is shown in any one of SEQ ID NOs: 1-4, and the gRNA further comprises biological materials related to the gRNA.

[0055] The biological material is selected from any one of the following:

[0056] (1) a nucleic acid molecule encoding the gRNA;

[0057] (2) an expression cassette containing the nucleic acid molecule described in (1);

[0058] (3) a recombinant vector containing the nucleic acid molecule (1) or the expression cassette (2);

[0059] (4) A recombinant cell containing (1) the nucleic acid molecule, (2) the expression cassette, or (3) the recombinant vector.

[0060] In some embodiments, nucleic acid molecule and nucleic acid are used interchangeably. Nucleic acid molecule refers to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). As equivalents, the term also includes DNA or RNA analogs generated from nucleotide analogs and single-stranded (sense strand or antisense strand) and double-stranded polynucleotides when applicable. An isolated nucleic acid molecule refers to a nucleic acid molecule that is identified and separated from at least one contaminating nucleic acid molecule associated therewith in the natural source of the nucleic acid. The isolated nucleic acid molecule is different from when it is found in nature in terms of form and background. Therefore, the isolated nucleic acid molecule is different from the nucleic acid molecule when present in natural cells. However, the isolated nucleic acid molecule includes the nucleic acid molecule contained in the cell that usually expresses the encoded protein, wherein for example, the nucleic acid molecule is in a chromosomal position different from the chromosomal position of natural cells.

[0061] In some embodiments, the expression cassette refers to a DNA capable of expressing the gRNA in a host cell, and the DNA may include not only a promoter for initiating transcription of the gene encoding the gRNA, but also a terminator for terminating transcription of the gene encoding the gRNA.

[0062] The expression cassette may further comprise an enhancer sequence.

[0063] In some embodiments, nucleic acid molecules or expression cassettes can be integrated into recombinant vectors, which are broad terms that include any specific DNA segment designed to move from a carrier to a target DNA. A recombinant vector may be referred to as an expression vector, or a vector system, which is a set of components required to cause DNA to be inserted into a genome or other target DNA sequence (such as an episome, plasmid, or even a viral / phage DNA segment). Vector systems for gene delivery in animals, such as viral vectors (such as retroviruses, adeno-associated viruses, and integrating phage viruses), and non-viral vectors (such as transposons), have two basic components: 1) a vector consisting of DNA (or RNA, which is reverse transcribed into cDNA), and 2) a transposase, recombinase, or other integrase that recognizes both the vector and the DNA target sequence and inserts the vector into the target DNA sequence. A vector most commonly contains one or more expression cassettes comprising one or more expression control sequences, wherein an expression control sequence is a DNA sequence that controls and regulates transcription and / or translation of another DNA sequence or mRNA.

[0064] Many different types of recombinant vectors are known. For example, plasmids and viral vectors (such as retroviral vectors) are known. Mammalian expression plasmids generally have an origin of replication, a suitable promoter and an optional enhancer, as well as any necessary ribosome binding site, a polyadenylation site, a splice donor and acceptor site, a transcription termination sequence, and a 5' flanking non-transcribed sequence. The example of a vector includes: a plasmid (which may also be a carrier of other types of vectors), adenovirus, adeno-associated virus (AAV), a lentivirus (such as modified HIV-1, SIV or FIV), a retrovirus (such as ASV, ALV or MoMLV), and a transposon (such as Sleeping Beauty, P-element, Tol-2, Frog Prince, piggyBac).

[0065] In some embodiments, the recombinant cell is a transgenic non-human animal cell line, including but not limited to a transgenic non-human oocyte, sperm cell, blastocyst, embryo, fetus, donor cell, or cell nucleus. In other embodiments, the transgenic animal cell line includes primordial germ cells, kidney cells, such as PK-15 cells, pancreatic islet cells, beta cells, hepatocytes, or fibroblasts.

[0066] The present invention provides a method for constructing a lupus erythematosus animal model, the method specifically comprising:

[0067] (1) Introduce gRNA, Cas9 mRNA, and donor vector into recipient cells to obtain F0 generation animals;

[0068] (2) Positive F0 generation animals were mated with wild-type animals to obtain homozygous Mtch2fl / fl animal;

[0069] (3)Mtch2 fl / fl The animals were crossed with Cre animals and drugs were introduced to obtain a lupus erythematosus animal model.

[0070] In some embodiments, the introduction method includes but is not limited to microinjection, ultrasound-mediated method, electroporation, sonoporation, photoporation, magnetotransfer, heat shock method, calcium phosphate method, liposome and polymer method, nanoparticle method, and viral transformation method.

[0071] In a specific embodiment, the introduction is by microinjection.

[0072] In some embodiments, the animal is selected from mammals.

[0073] In some embodiments, the mammal is a non-human mammal, including primates (such as rhesus macaques, bear monkeys, and cynomolgus macaques), rodents (such as mice, rats, and hamsters), and rabbits (such as rabbits and New Zealand rabbits).

[0074] In a preferred embodiment, the non-human mammal is selected from rodents.

[0075] In a specific embodiment, the rodent is selected from a mouse.

[0076] In some embodiments, the drug described in (3) is a lupus erythematosus inducing drug. Lupus erythematosus inducing drugs include, but are not limited to, one or more of pristane, imiquimod, peptide, lipopolysaccharide, Campylobacter jejuni, Freund's complete adjuvant, and lymphocyte activated chromatin.

[0077] In a specific embodiment, the lupus erythematosus-inducing drug is selected from Pristane or Imiquimod.

[0078] The method further comprises maintaining the gene knockout state using a gene knockout activator.

[0079] In some embodiments, the gene knockout activator comprises tamoxifen or 4-hydroxytamoxifen.

[0080] In a specific embodiment, the gene knockout activator is selected from tamoxifen.

[0081] The present invention provides the use of the lupus erythematosus animal model constructed by the above method in screening drugs for treating / preventing lupus erythematosus or in studying the disease mechanism / disease target of lupus erythematosus.

[0082] In some embodiments, prevention and / or treatment include prevention and treatment, wherein prevention refers to completely or partially preventing or suppressing the symptoms of the disease or the frequency of such symptoms, or reducing the risk of obtaining a given symptom of the disease. In an embodiment of the present application, the disease is lupus erythematosus. Prevention includes suppressing and / or preventing the relevant symptoms of lupus erythematosus, reducing the severity of lupus erythematosus related symptoms or improving the signs and symptoms related to lupus erythematosus, prevention includes suppressing, preventing or reducing the severity of lupus erythematosus related symptoms, the term includes such effects that occur before the patient begins to suffer from lupus erythematosus or related conditions, i.e., delaying the onset of symptoms related to lupus erythematosus, and / or suppressing or reducing the severity of lupus erythematosus related symptoms; treatment refers to reducing or eliminating the severity of lupus erythematosus symptoms, the frequency of such symptoms, or both, the term includes such effects that occur when the patient suffers from lupus erythematosus or related conditions, i.e., reducing the severity of one or more symptoms of lupus erythematosus related symptoms or the impact.

[0083] In some embodiments, a specific method for screening candidate drugs for treating / preventing lupus erythematosus includes: (1) administering the drug to be tested to the lupus erythematosus model prepared by the above method; (2) detecting whether the lupus erythematosus model has changes in abnormal symptoms related to lupus erythematosus after administering the drug to be tested; (3) when the drug to be tested improves the symptoms of lupus erythematosus / has a therapeutic effect, the drug to be tested is identified as a candidate drug capable of treating / preventing lupus erythematosus.

[0084] In some embodiments, the test drug can be a low molecular weight compound, a protein (e.g., an antibody), a DNA, an RNA, a low molecular weight interfering RNA, or an antisense oligonucleotide. The test drug can be, for example, a drug for treating a disease other than neutropenia. The test drug can be, for example, a mixture of one or more than two. The test drug is preferably a single substance.

[0085] The present invention will be further described below with reference to specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the present invention. The main features of the present invention may be applied to various embodiments without departing from the scope of the present invention.

[0086] Example

[0087] 1. Experimental Materials

[0088] (1) Tamoxifen (sigma: T5648), pristane (sigma: P2870), imiquimod (Aldara), and sunflower oil (Sigma). Tamoxifen preparation method: Dissolve 200 mg of tamoxifen powder in 400 μL of anhydrous ethanol and 19.6 mL of sunflower oil. Shake at 220 rpm in a shaker at 37°C in the dark for 3 h. Remove the solution every 30 min and vortex for 30 s. Once the powder is completely dissolved, aliquot and store at -20°C.

[0089] (2) Red blood cell lysis buffer: Dilute 10× BD Pharm Lyse (555899) to 1× with ultrapure water and store at 4°C.

[0090] Trizma Hydrochloride Solution (Sigma, Cat. No. T2663); Proteinase K (Merck, Cat. No. MK539480); 2×Taq Master Mix (Dye Plus) (Vazyme, P222-C2); Agarose (BIOWESTAGAROSE, REGULAR); DNA Marker (Thermo Scientific GeneRuler 100bp DNA Ladder #SM0242).

[0091] (3) Flow cytometry antibodies: Anti-mouse CD45R / B220-FITC, Anti-mouse CD45R / B220-APC-cy7, Anti-mouse Fas-PE, Anti-mouse GL-7-Percp5.5, Anti-mouse CD138-PE, Anti-mouse IgG1-APC, Anti-mouse CD19-APC-cy7, Annexin V-PE, 7-AAD-Percp5.5 (Biolegend and BD); DCFH-DA-FITC (Thermo Fisher), MitoRed-PE (Thermo Fisher), TMRM-PE (ThermoFisher).

[0092] (4) Agilent Seahorse XFe24 reagents and consumables: Seahorse XFe24 / XF Pro FluxPak Mini, Seahorse XF Cell Mitochondrial Stress Test Kit, XF DMEM Medium, pH 7.4, 500 mL, XF 1.0 M Glucose Solution, 50 mL, XF 100 mM Pyruvate Solution, 50 mL, XF 200 mM Glutamine Solution, 50 mL, stored at -20°C.

[0093] 2. Experimental methods

[0094] All experiments were carried out in compliance with the Regulations on Laboratory Animal Care and were approved by the Ethics Committee (Animal Ethics Number: IOZ-IACUC-2024-280).

[0095] (1)Mtch2 fl / fl CAGG Cre / + Acquisition and breeding of gene knockout animals:

[0096] ① Design and validation of gRNA targeting MTCH2: The genomic sequence of the MTCH2 gene (Gene ID: 56428) and its transcript (NM_019758.3) were obtained from the NCBI or Ensembl databases. Using CRISPR Cas9 technology, loxP sites were inserted upstream of exon 6 and downstream of exon 7 of the mitochondrial vector homolog 2 (MTCH2) gene in C57BL / 6 mice. Guide RNA (gRNA) targeting MTCH2 was designed using online tools (e.g., CRISPR Design Tool, CHOPCHOP). The specific gRNA targeting sequences are shown in Table 1.

[0097] Table 1 gRNA targeting sequences

[0098]

[0099]

[0100] ② Microinjection of fertilized eggs and embryo transfer: C57BL / 6J female mice (superovulation treatment) were selected and mated with C57BL / 6J male mice, and fertilized eggs (pronuclear stage) were collected. First, homologous recombination technology was used, that is, homology arms were designed in the vector to guide the recombination between the vector and the target region in the genome, and loxP sites were inserted to design a gene knockout system. The DNA sequence of the target gene MTCH2 was obtained from the NCBI genome database (see above), and exons 6-7 were determined to be the region to be knocked out (see Figure 4 and Figure 5). 5' and 3' homology arms were designed 1-3 kb upstream and downstream of the target region, and loxp sites were inserted therein; the loxp sequence was ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 21). A multiple cloning site (MCS) was designed in the plasmid, loxP sites were inserted using restriction endonucleases, and loxP sequences were directly introduced when synthesizing homology arms by overlap extension PCR. Cas9 mRNA (100 ng / μL), a donor vector containing loxP sites, and gRNA (50 ng / μL each) were mixed and microinjection buffer was added. The mixture was injected into the pronucleus of the fertilized egg, and the embryos were cultured to the 2-cell stage after injection. The surviving embryos were transplanted into the oviducts of pseudopregnant female mice (ICR or C57BL / 6 background), with 10-15 embryos transplanted in each oviduct to obtain F0 generation mice.

[0101] ③ Screening for Mtch2 fl / fl Parent mouse 1: First, the F0 generation mice were identified, and the F0 generation positive mice were screened by PCR and sequencing analysis, and mated with wild-type mice to verify the germline transmission ability and produce F1 generation. The specific method is to cut the tail of the F0 generation mice at 3 weeks of age to extract genomic DNA, and design primers to amplify the region around the gRNA target (about 500-800bp), and directly perform Sanger sequencing on the PCR products to analyze insertion / deletion mutations. Mice carrying frameshift mutations (Exon 6 / 7 double allele knockout) were selected and backcrossed with wild-type C57BL / 6 mice to obtain F1 generation heterozygotes (Mtch2 fl / + ), F1 generation heterozygous mice were mated to obtain homozygous Mtch2 fl / fl Parental mouse 1. Heterozygous and homozygous loxP mice are viable and fertile. Verified mice were backcrossed with C57BL / 6J mice for at least five generations to ensure a pure genetic background and establish a stable strain for conservation and expansion. Primers for identifying F1 generation mice are shown in Tables 2 and 3.

[0102] Table 2 F1 mouse PCR identification primers

[0103]

[0104] Table 3F1 Mouse Southern Blot Primers

[0105]

[0106]

[0107] ④Use CAGGCre-ER TM mice (JAX:004453) as parental mice 2 (C57BL / 6 background mice), Mtch2 fl / flParental mouse 1 and CAGGCre-ER TM Mice were mated to obtain the FN generation. Homozygous Cre-positive mice (homozygous, Cre+) were mated with homozygous mice to establish a stable genetic line. Homozygous mice were identified by PCR amplification, DNA gel electrophoresis, and sequencing, and primers were designed to detect possible off-target sites. To verify that the target gene MTCH2 was indeed knocked out in mice, liver or spleen tissue was obtained from the mice, and transcript levels were verified by qPCR and MTCH2 protein expression was detected by Western blot.

[0108] ⑤ After hybridization of parent mouse 1 and parent mouse 2, the heterozygous Mtch2 fl / fl Mice and Mtch2 containing the Cre gene fl / fl CAGG Cre / + These knockout mice are viable and fertile. They develop a more severe lupus phenotype after pristane induction and can be used to investigate the role of mitochondrial dysfunction in the pathogenesis of SLE.

[0109] (2)Mtch2 fl / fl CAGG Cre / + Genotyping of knockout animals:

[0110] ①Mtch2 fl / fl CAGG Cre / + The primer sequences for mouse genotype identification are shown in Table 4.

[0111] Table 4Mtch2 fl / fl CAGG Cre / + Mouse genotyping primers

[0112]

[0113] ② Extraction of mouse tail DNA (column extraction method):

[0114] First, add 2-5 mm of mouse tail tissue to a 1.5 ml centrifuge tube. Then, add 180 μL of Buffer GL, 20 μL of Proteinase K, and 10 μL of RNase A (CAUTION: Do not use too much mouse tail tissue). Incubate at 56°C overnight to lyse the tissue. The next day, remove the tube and centrifuge at 12,000 rpm for 2 minutes. Discard the pellet. Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol and mix thoroughly to allow for complete DNA binding. Transfer the mixture to an adsorption column (placed in a collection tube), centrifuge at 12,000 rpm for 2 minutes, and discard the waste. Next, perform two washes. First, add 500 μL of Buffer WA, centrifuge at 12,000 rpm for 1 minute, and discard the waste. Then, add 700 μL of Buffer WB (pre-mixed with anhydrous ethanol before use) and pipette it along the tube wall to remove residual salts. Centrifuge at 12,000 rpm for 1 minute, and discard the waste. Repeat this step once. Centrifuge the adsorption column (placed in a collection tube) at 12,000 rpm for 2 minutes to completely discard the waste liquid. Finally, transfer the adsorption column to a new 1.5 mL centrifuge tube and add 50-200 μL of sterile water or elution buffer to the center of the membrane. Let it sit for 5 minutes (preheating the elution buffer to 65°C will increase the yield). Centrifuge at 12,000 rpm for 2 minutes to collect the DNA. To increase the yield, add the flow-through back to the adsorption column and repeat the elution step.

[0115] ③ Set up the PCR amplification system, conditions, and procedures. The PCR amplification system is shown in Table 5, the PCR amplification conditions are shown in Table 6, and the PCR amplification reagent names and manufacturers are shown in Table 7.

[0116] Table 5 PCR amplification system

[0117] Component ×1 <![CDATA[ddH2O]]> 9.0μL Product primer F 1.0μL Product primer R 1.0μL Premix Taq 12.5μL DNA 1.5 μL Total 25 μL

[0118] Table 6 PCR amplification conditions

[0119]

[0120]

[0121] Table 7 PCR amplification reagent names and manufacturers

[0122]

[0123] (3)Mtch2 fl / fl Mb1 Cre / + Acquisition and breeding of gene knockout animals:

[0124] ①Use Mtch2 built by (1) fl / fl Parent mouse 1;

[0125] ② Using Mb1-iCre mice as parental mice (Product No. C001552, Saiye Bio), Cre recombinase is prominently expressed in lymphoid B cells. This model can be used for tissue-specific studies targeting lymphoid B cells, with good expression specificity. When Mb1-iCre mice are crossed with mice harboring loxP sites, sequence recombination between loxP sites, mediated by Cre recombinase, occurs in the B lymphocytes of the offspring mice, leading to the specific knockout of specific genes in B cells.

[0126] ③ The parental mouse 1 homozygous Mtch2 fl / fl The Mtch2 fl / fl Mb1 Cre / + A stable genetic strain of SLE mice was established. These knockout mice are viable and fertile. They exhibit a more severe lupus phenotype after pristane induction and are used to investigate the role of mitochondrial dysfunction in the pathogenesis of SLE.

[0127] (4)Mtch2 fl / fl Mb1 Cre / + Genotyping of knockout animals:

[0128] ①Mtch2 fl / fl Mb1 Cre / + The primer sequences for mouse genotype identification are shown in Table 8.

[0129] Table 8 Mtch2 fl / fl Mb1 Cre / + Mouse genotype identification sequence

[0130]

[0131] ② Extraction of mouse tail DNA (column extraction method):

[0132] First, add 2-5 mm of mouse tail tissue to a 1.5 ml centrifuge tube. Then, add 180 μL of Buffer GL, 20 μL of Proteinase K, and 10 μL of RNase A (CAUTION: Do not use too much mouse tail tissue). Incubate at 56°C overnight to lyse the tissue. The next day, remove the tube and centrifuge at 12,000 rpm for 2 minutes. Discard the pellet. Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol and mix thoroughly to allow for complete DNA binding. Transfer the mixture to an adsorption column (placed in a collection tube), centrifuge at 12,000 rpm for 2 minutes, and discard the waste. Next, perform two washes. First, add 500 μL of Buffer WA, centrifuge at 12,000 rpm for 1 minute, and discard the waste. Then, add 700 μL of Buffer WB (pre-mixed with anhydrous ethanol before use) and pipette it along the tube wall to remove residual salts. Centrifuge at 12,000 rpm for 1 minute, and discard the waste. Repeat this step once. Centrifuge the adsorption column (placed in a collection tube) at 12,000 rpm for 2 minutes to completely discard the waste liquid. Finally, transfer the adsorption column to a new 1.5 mL centrifuge tube and add 50-200 μL of sterile water or elution buffer to the center of the membrane. Let it sit for 5 minutes (preheating the elution buffer to 65°C will increase the yield). Centrifuge at 12,000 rpm for 2 minutes to collect the DNA. To increase the yield, add the flow-through back to the adsorption column and repeat the elution step.

[0133] ③ Set the PCR amplification conditions and procedures: same as Table 5 PCR amplification system; same as Table 6 PCR amplification conditions; same as Table 7 PCR amplification reagent names and manufacturers.

[0134] (5) Build Mtch2 fl / fl CAGG Cre / + Lupus model and phenotypic identification in gene knockout animals:

[0135] ①Construction of pristane-induced Mtch2 fl / fl CAGG Cre / + Lupus animal model and verification of its phenotype: First, the control group Mtch2 fl / fl and knockout group Mtch2 fl / fl CAGG Cre / + Animals were intraperitoneally injected with tamoxifen (Sigma: T5648) at a dose of 0.8 mg / day (200 μl) for one week after birth. After a week of rest, the knockout state was maintained with weekly injections. Lupus-like phenotypes were induced in mice using intraperitoneal injections of pristane (Sigma: P2870) at a dose of 0.5 ml at 8-10 weeks of age. This method involved a single injection to establish the model.

[0136] Starting from the first month of lupus model establishment, tamoxifen is injected intraperitoneally once a week to maintain the gene knockout state. The dose is 0.8 mg / kg mouse, and 200 microliters are injected intraperitoneally. Urine (about 20 microliters) and peripheral blood are collected once a month, about 200 microliters each time to prepare serum to detect autoantibodies. After isoflurane anesthesia, blood is collected from the orbits to minimize damage to the animals. After the lupus model reaches 6 months, the animals are basically removed for experiments. Starting from the third month of the establishment of the lupus model, the animals may develop varying degrees of ascites and skin lesions. This is the phenotype of the lupus animal model and the clinical appearance of SLE patients (skin lesions). Generally, the lupus modeling is terminated after 6 months for animal experiments.

[0137] ②Construction of Imiquimod-induced Mtch2 fl / fl CAGG Cre / + Lupus animal model and verification of its phenotype: First, the control group Mtch2 fl / fl and knockout group Mtch2 fl / fl CAGG Cre / + Animals were intraperitoneally injected with tamoxifen (Sigma: T5648) at a dose of 0.8 mg / day (200 μL) for one week starting at 5 weeks of age. After a week of rest, the gene knockout state was maintained with weekly injections. The Imiquimod model was established by applying Imiquimod (5% IMQ cream, 1.25 mg per mouse) to the skin on the back of the right ear at 6-8 weeks of age every 3 days for 8 weeks (with supplemental ultraviolet irradiation for 30 minutes starting at the 6th week).

[0138] Starting from the first month of lupus model establishment, tamoxifen is injected intraperitoneally once a week to maintain the gene knockout state. The dose is 0.8 mg / kg mouse, and 200 microliters are injected intraperitoneally. Urine (about 20 microliters) and peripheral blood are collected once a month, about 200 microliters each time to prepare serum to detect autoantibodies. After isoflurane anesthesia, blood is collected from the orbits to minimize damage to the animals. After the lupus model reaches 6 months, the animals are basically removed for experiments. Starting from the third month of the establishment of the lupus model, the animals may develop varying degrees of ascites and skin lesions. This is the phenotype of the lupus animal model and the clinical appearance of SLE patients (skin lesions). Generally, the lupus modeling is terminated after 6 months for animal experiments.

[0139] (6) Building Mtch2 fl / fl Mb1 Cre / + Lupus model and phenotypic identification in gene knockout animals:

[0140] ①Construction of pristane-induced Mtch2 fl / fl Mb1 Cre / +Lupus animal model and verification of its phenotype: intraperitoneal injection of pristane to control Mtch2 fl / fl and knockout group Mtch2 fl / fl Mb1 Cre / + The animals are further induced to have a lupus-like phenotype in mice. The dose is 0.5 ml (sigma: P2870) injected at 8-10 weeks after birth. This method is a one-time injection modeling. Starting from the first month of the establishment of the lupus model, urine (about 20 microliters) and peripheral blood are collected once a month, about 200 microliters each time to prepare serum for autoantibody detection. After isoflurane anesthesia, blood is collected from the orbits to minimize harm to the animals. After the lupus model reaches 6 months, the animals are basically removed for experiments. Starting from the third month of the establishment of the lupus model, the animals may develop varying degrees of ascites and skin lesions. This is a phenotype that appears clinically in lupus animal models and SLE patients (skin lesions). Generally, the lupus modeling is terminated after 6 months for animal experiments.

[0141] ②Utilize H2-Ab1 bm12 Animals undergo spleen cell / CD4 + T cell adoptive transfer to Mtch2 fl / fl Mb1 Cre / + Establish a lupus GVHD model in knockout animals and verify its phenotype: Due to differences in modeling time and modeling principles, in addition to using the above-mentioned pristane-induced lupus mice, this rapid GVHD modeling method was also used. First, the spleen of BM12 mice was taken under sterile conditions and placed in a culture dish containing PBS. Grind the spleen tissue with a syringe piston, filter through a 70μm cell sieve, and collect the cells by centrifugation (300×g, 5min). Add red blood cell lysis buffer (such as ACK buffer), incubate at room temperature for 2min, then centrifuge and wash, and use CD4 + T cell isolation kit (CD4 + T cell sorting magnetic beads, STEMCELL, Catalog #19852) were used for negative sorting according to the instructions to obtain CD4 T cells with a purity of >90%. + T cells, adoptive transfer 5 × 10 6 To establish a GVHD model, 200 μl of urine and peripheral blood were collected weekly to prepare serum for autoantibody testing. Blood was collected from the orbital cavity under isoflurane anesthesia to minimize harm to the animals.

[0142] (7)Mtch2 fl / fl CAGG Cre / + and Mtch2 fl / fl Mb1 Cre / + Other phenotypic assays and mitochondrial function assays in several lupus models using knockout animals:

[0143] ①Measure the size and weight of the spleen and mesenteric lymph nodes, detect the protein content in the urine by ELISA, and determine the pathological changes of the kidneys by HE staining;

[0144] ② Use flow cytometry to detect changes in the proportions of various immune cell subtypes, especially changes in the proportions of germinal center B cells / plasma cells / plasmablasts / memory B cells;

[0145] ③ Use ELISA to detect anti-dsDNA antibodies and ANA antibodies in serum, and use immunofluorescence to detect changes in IgG and IgM.

[0146] Enzyme-linked immunosorbent assay: Mouse serum was diluted 1:100 in assay buffer for detection of anti-dsDNA antibodies and diluted 1:

[0147] Urine protein was detected by diluting the sample at 1000. Mouse anti-dsDNA IgG ELISA kit (5120, Alpha Diagnostic), mouse ANA IgG ELISA kit (5210, Alpha Diagnostic), and urine albumin ELISA kit (E99-134, FRTIS) were used for determination according to the manufacturer's instructions.

[0148] Immunohistochemistry: Kidneys were harvested from mice, fixed in 4% paraformaldehyde, embedded in paraffin, and stained with hematoxylin and eosin (H&E), or IgG and IgM. The results showed that the MTCH2 knockout group had a more severe lupus phenotype.

[0149] 3. Experimental results

[0150] Figure 1 A shows that the expression of MTCH2 gene in B cells of SLE patients is decreased compared with that in healthy subjects (HCs) using the public database GSE148601 dataset analyzed by bioinformatics. In particular, the decrease in MTCH2 in B cells of lupus patients is greater than that in other immune cells. Figure 1 B shows the expression of MTCH2 in SLE patients with different disease activities. It can be seen that as the disease severity worsens, MTCH2 in various B cell subsets decreases significantly. Figure 1 Figure C shows changes in MTCH2 protein levels in B cells. As can be seen, MTCH2 levels in B cells from lupus patients are significantly lower than those in healthy controls (HCs). This suggests that MTCH2 is highly correlated with disease activity in lupus patients and is a key regulator of lupus pathogenesis.

[0151] F1 mice No. 4, 5, 7, and 9 were identified as positive by PCR screening and Southern blot analysis ( Figure 2 , Figure 3 ).

[0152] Figure 4 Gene targeting for MTCH2 conditional knockout mice, and Mtch2 fl / fl CAGG Cre / + Schematic diagram of the mouse hybridization process and whole-body conditional knockout.

[0153] Figure 5 Gene targeting for MTCH2 conditional knockout mice, and Mtch2 fl / fl Mb1 Cre / + Schematic diagram of the mouse hybridization process and B cell-specific knockout.

[0154] Figure 6 A is Mtch2 fl / fl Mb1 Cre / + Mouse genotype identification chart, Figure 6 B is Mtch2 fl / fl CAGG Cre / + Mouse genotype identification diagram, using agarose gel electrophoresis to detect PCR amplification products of offspring mouse tail DNA, used to identify the different genotypes of offspring wild type, heterozygous and homozygous.

[0155] Figure 7 Conditional knockout of Mtch2 fl / fl CAGG Cre / + Mouse and its control Mtch2 fl / fl Phenotypic comparison of mice after pristane-induced lupus. Six months after pristane stimulation, eye blood was collected from mice, and serum was extracted. Anti-self double-stranded DNA antibodies and serum ANA antibody levels were detected by ELISA. Changes in urine albumin levels were also compared. Immunofluorescence experiments were also used to detect renal IgM / IgG deposition. It can be seen that the Mtch2 knockout group fl / fl CAGG Cre / + The mice had higher levels of autoantibodies, higher levels of urine protein, higher proportions of germinal centers, and higher levels of immune complex deposition, indicating that the lupus-induced phenotype in MTCH2 systemic knockout mice was more significant, and that this gene affects the occurrence and development of lupus.

[0156] Figure 8 B cell-specific knockout of Mtch2 fl / fl Mb1 Cre / + Mouse and its control Mtch2 fl / flPhenotypic comparison of mice after pristane-induced lupus. Eyeball blood was collected from mice 6 months after pristane stimulation, and serum was extracted. Anti-self double-stranded DNA antibodies and serum ANA antibody levels were detected by ELISA. At the same time, changes in urine albumin levels were compared. Flow cytometry was used to detect IgG1 expression in spleen antibody secreting cells (ASC), the proportion of germinal centers, and the expression level of MHCII molecules. It can be seen that the knockout group Mtch2 fl / fl Mb1 Cre / + The mice had higher autoantibodies, higher urine protein, higher IgG1+ cell ratio and germinal center ratio, and higher expression of MHCII molecules, indicating that MTCH2-specific knockout mice on B cells (Mtch2 fl / fl Mb1 Cre / + ) have more significant lupus-induced phenotypes, and specific knockout of this gene in B cells affects the occurrence and development of lupus.

[0157] Figure 9 A shows that the production of ROS and mitochondrial ROS (mROS) in B cells of SLE patients is significantly increased compared with HC, indicating that B cells of SLE patients undergo mitochondria-dependent oxidative stress and Figure 9 Pristane-induced Mtch2 in B fl / fl CAGG Cre / + Mtch2 expression in spleen B cells of lupus mice compared with controls fl / fl The mROS produced by mice was higher, and the mitochondrial membrane potential difference TMRM decreased, indicating that the mitochondria of B cells in the MTCH2 knockout group were depolarized and also led to cell apoptosis. Figure 9 C detected the pristane-induced Mtch2 fl / fl Mb1 Cre / + Lupus mice showed Mtch2 expression compared to controls fl / fl The apoptotic proportion of splenic B cells in mice was increased. Figure 9 D examined the mitochondrial morphology of B cells from these four groups of animals using electron microscopy. They found that, regardless of whether MTCH2 was knocked out systemically or specifically in B cells, mitochondria fused, resulting in elongated and slightly swollen mitochondria. Literature review concluded that when cells experience oxidative stress or a surge in energy demand, mitochondria actively fuse to meet increased energy supply and avoid the damage of oxidative stress. Finally, a Seahorse experiment confirmed that oxidative phosphorylation in B cells was significantly increased after MTCH2 knockout, indicating that MTCH2 knockout, whether systemic or specific in B cells, leads to mitochondrial dysfunction in B cells, including oxidative stress imbalance (elevated ROS and mROS), increased apoptosis, increased mitochondrial fusion, and elevated mitochondrial stress.

[0158] This application successfully constructed a lupus erythematosus mouse model and used this model to verify that MTCH2 is an important regulatory factor affecting the mitochondrial function of B cells in SLE patients. Its decrease or absence in B cells can lead to abnormal mitochondrial function of B cells, which in turn causes oxidative stress in B cells, making them prone to apoptosis and activation. Under the conditions of mitochondrial fusion, more energy is generated to drive B cells to produce more autoantibodies, thereby exacerbating the disease progression of lupus.

[0159] The above embodiments are only provided for understanding the method and core concept of the present invention. It should be noted that, without departing from the principles of the present invention, a number of improvements and modifications may be made to the present invention by a person skilled in the art, and such improvements and modifications shall fall within the scope of protection of the claims of the present invention.

Claims

1. A gRNA targeting the MTCH2 gene, characterized in that The sequence of the gRNA is shown in any one of SEQ ID NO: 1-4.

2. The gRNA according to claim 1, wherein The gRNA also includes biological materials related to the gRNA; Preferably, the biological material is selected from any one of the following: (1) a nucleic acid molecule encoding the gRNA; (2) an expression cassette containing the nucleic acid molecule described in (1); (3) a recombinant vector containing the nucleic acid molecule (1) or the expression cassette (2); (4) A recombinant cell containing (1) the nucleic acid molecule, (2) the expression cassette, or (3) the recombinant vector.

3. A product, characterized in that The product comprises the gRNA according to claim 1 or 2; Preferably, the product comprises a kit; Preferably, the kit further comprises Cas9 mRNA; Preferably, the kit further comprises a donor vector.

4. A method for constructing an animal model of lupus erythematosus, characterized in that: The method includes constructing a lupus erythematosus animal model by knocking out the MTCH2 gene; Preferably, the knockout is to knock out the MTCH2 gene using CRISPR Cas9 technology.

5. The method according to claim 4, characterized in that The method specifically includes: (1) Introduce gRNA, Cas9 mRNA, and donor vector into recipient cells to obtain F0 generation animals; (2) Positive F0 generation animals were mated with wild-type animals to obtain homozygous Mtch2 fl / fl animal; (3)Mtch2 fl / fl The animals were crossed with Cre animals and drugs were introduced to obtain a lupus erythematosus animal model; Or the method specifically comprises: adoptively transferring spleen cells / CD4+ T cells from BM12 animals into Mtch2 fl / fl Establish lupus erythematosus animal models by crossing animals with Cre animals; Preferably, the gRNA is the gRNA according to claim 1 or 2.

6. The method according to claim 5, characterized in that The animal is a mammal; Preferably, the mammal is selected from rodents; Preferably, the rodent is selected from mice; Preferably, the Cre animals include CAGGCre-ER mice and / or Mb1-iCre mice; Preferably, the recipient cell described in (1) is a fertilized egg; Preferably, the introduction method described in (1) is microinjection; Preferably, the drug described in (3) is a lupus erythematosus inducing drug; Preferably, the lupus erythematosus inducing drug is selected from Pristane or Imiquimod; Preferably, the method further comprises maintaining the gene knockout state using a gene knockout activator; Preferably, the gene knockout activator is selected from tamoxifen.

7. Use of the gRNA according to claim 1 or 2 or the product according to claim 3 in constructing a lupus erythematosus model.

8. Use of the lupus erythematosus animal model constructed by the method according to any one of claims 4 to 6 in screening drugs for treating / preventing lupus erythematosus or in studying the disease mechanism / disease target of lupus erythematosus.

9. A method for screening candidate drugs for treating / preventing lupus erythematosus, characterized in that: The method comprises administering a drug to be tested to a lupus erythematosus animal model constructed by the method according to any one of claims 4 to 6, and selecting a drug to be tested that can improve lupus erythematosus symptoms.

10. Application of MTCH2 as a target in screening drug candidates for the treatment of lupus erythematosus; Preferably, the method for screening candidate drugs for treating lupus erythematosus comprises: The effect of the candidate drug on the MTCH2 level in a sample obtained from the subject is tested, wherein an increase in the MTCH2 level after administration of the candidate drug indicates that the candidate drug has an effect in treating lupus erythematosus.

Citation Information

Patent Citations

  • Application of MTCH2 in preparation of medicine for treating ferroptosis-related cancer

    CN116474102A

  • Preparation method and application of autoreactive animal model

    CN120519516A

  • Methods of treating diseases related to mitochondrial function

    US20180042994A1