Application of the Vesicle-Associated Membrane Protein 714 Encoding Gene GhVAMP714 in Regulating Radicle Length in Cotton Seeds

By locating the GhVAMP714 gene related to the length of cotton seed radicle through GWAS and regulating its expression using genetic engineering, the problem of regulating the length of cotton seed radicle was solved and seed vitality was improved.

CN120519507BActive Publication Date: 2025-09-30HAINAN RES INST OF ZHEJIANG UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511013505.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-23
Publication Date
2025-09-30
Estimated Expiration
2045-07-23

AI Technical Summary

Technical Problem

In the existing technology, the genetic regulation mechanism of cotton seed radicle length is still unclear, which affects seed germination and seedling growth, making it difficult to improve seed vigor through molecular breeding.

Method used

Through genome-wide association analysis (GWAS), the gene encoding vesicle-associated membrane protein 714, GhVAMP714, was located. Genetic engineering was used to overexpress the GhVAMP714 gene in Arabidopsis or silence it in cotton to regulate seed radicle length.

Benefits of technology

Significantly increased or decreased the radicle length of cotton and Arabidopsis seeds, verified the correlation between genes and traits, provided a theoretical basis for molecular marker-assisted breeding, and enhanced seed vigor.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519507B_ABST
    Figure CN120519507B_ABST
Patent Text Reader

Abstract

The present invention provides the use of the gene encoding vesicle-associated membrane protein 714, GhVAMP714, in regulating cotton seed radicle length, belonging to the field of molecular breeding technology. Through GWAS mapping analysis, the present invention discovered a gene encoding vesicle-associated membrane protein 714, GhVAMP714, associated with cotton seed radicle length. The cDNA sequence of the gene is shown as SEQ ID NO. 1, and the genomic sequence is shown as SEQ ID NO. 2. Gene expression is positively correlated with cotton seed radicle length. Silencing GhVAMP714 expression in cotton significantly reduces cotton seed radicle length. Overexpressing GhVAMP714 in Arabidopsis promotes radicle elongation and improves germination rate. The present invention's research found that the gene encoding vesicle-associated membrane protein 714, GhVAMP714, in cotton can regulate seed radicle length, demonstrating that this gene, GhVAMP714, can be used to identify, screen, cultivate, or improve high-vigor seed cotton varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the application of the endovesicle-associated membrane protein 714 encoding gene GhVAMP714 in regulating the radicle length of plant seeds, and in particular to the application of related encoding genes in regulating the radicle length of cotton seeds, belonging to the field of molecular breeding technology. Background Art

[0002] Cotton (Gossypium hirsutum L.), a globally important cash crop, holds a central position in the textile and agricultural economies. It not only provides high-quality natural fiber raw materials for the textile industry, but its seeds are also rich in oil and protein, making them an important source of edible oil and feed. Radicle length phenotype during early seed germination is a key morphological indicator of seed viability, directly reflecting the root's elongation capacity and environmental adaptability. Studies have shown that seed radicle length is significantly correlated with seedling establishment efficiency, water absorption capacity, and later plant stress resistance (Masubelele NH, Dewitte W, MengesM, Maughan S, Collins C, Huntley R, Nieuwland J, Scofield S, Murray JA. D-type cyclins activate division in the root apex to promote seed germination in Arabidopsis. Proc Natl Acad Sci US A. 2005 Oct 25;102(43):15694-9. pii:0507581102. doi: 10.1073 / pnas.0507581102. PubMed PMID: 16227434.). In cotton production, the dynamics of radicle length during the early stages of seed germination directly affect the field emergence rate and early growth potential of seedlings. Long primary roots promote rapid water and nutrient absorption, enhancing seedling survival under adverse conditions such as drought and low temperature (Weitbrecht K, Müller K, Leubner-Metzger G. First off the mark: early seedgermination. J Exp Bot. 2011 Jun;62(10):3289-309. pii: err030. doi: 10.1093 / jxb / err030. PubMed PMID: 21430292.). With the promotion of mechanized cotton production and the intensification of climate change, the demand for rapid seed germination and efficient root system establishment is becoming increasingly urgent. In-depth research on the genetic regulatory mechanisms of radicle length phenotype and its interaction with the environment will not only help to understand the formation mechanism of cotton's early adaptability, but also provide a theoretical basis for molecular marker-assisted breeding of high-vigor cotton varieties, which is of great significance for achieving high and stable cotton yields and efficient resource utilization.

[0003] Genome-wide association studies (GWAS) are highly efficient analytical methods based on population genetic diversity. By statistically associating molecular markers such as single nucleotide polymorphisms (SNPs) across the genome with target trait phenotypes, GWAS can rapidly locate chromosomal segments or candidate genes that influence trait variation. Compared to traditional quantitative trait loci (QTL) mapping, GWAS eliminates the need for pre-defined candidate genes and offers higher detection accuracy and throughput. GWAS has successfully identified multiple loci associated with key agronomic traits in crops such as rice, soybeans, and cotton. With the development of high-throughput sequencing and bioinformatics technologies, GWAS has become an important tool for analyzing the genetic basis of complex traits such as cotton fiber quality and seed vigor, providing a theoretical basis for molecular design breeding. Si et al. (2022) and Li et al. (2023) revealed key SNPs / genes (such as Gh_A11G0176 and Ghir_A09G002730) and their metabolic networks (such as glutathione and ABA / GA balance) that regulate cotton seed germination through genome-wide association studies (GWAS), providing important evidence for analyzing the genetic basis of seed vigor differences.

[0004] Vesicle-associated membrane protein 714 (VAMP714) is a key member of the SNARE protein family, with specific functions in higher plants. As a key protein mediating vesicle trafficking and membrane fusion, VAMP714 forms a four-helix bundle complex with other SNARE proteins through its typical SNARE domain and C-terminal transmembrane region. It plays multiple important roles in plant immune defense, maintaining cell membrane integrity, and regulating growth and development. This protein not only participates in plant immune responses and helps defend against pathogen infection, but also maintains plasma membrane integrity and cell viability under adverse conditions, significantly enhancing plant adaptability. Furthermore, VAMP714 profoundly influences plant growth and development by regulating fundamental physiological processes such as cell wall formation and hormone transport. Arabidopsis thaliana VAMP714 (AT5G22360) encodes a vesicle-associated membrane protein, a member of the SNARE protein family, that plays a key role in H₂O₂ vesicle trafficking and membrane fusion. This gene is highly expressed during the germination stage of Arabidopsis seeds, and its loss-of-function mutants exhibit significantly enhanced salt stress tolerance (Leshe et al., 2006). Tang et al. (2022) used chromatin immunoprecipitation sequencing (ChIP-Seq) to discover that VAMP714 negatively regulates salt stress tolerance. AtSRT2 inhibits VAMP714 expression through histone deacetylation, reducing H₂O₂ accumulation and promoting seed germination. Huang et al. (2007) found that rice OsVAMP714 may be involved in oxidative stress response, but its specific function has not yet been determined (Huang et al., 2007). Shao et al. (2017) found that wheat TaVAMP7 is associated with drought tolerance and may enhance stress adaptation by regulating vacuolar trafficking (Shao et al., 2017). Zhang et al. (2016) found that maize ZmVAMP72 is involved in exocytosis, affecting cell wall formation and root development (Zhang et al., 2016). Wang et al. (2018) studied how soybean GmVAMP727 regulates vesicle transport during symbiotic nitrogen fixation, affecting nodule formation (Wang et al., 2018). This suggests that different VAMP genes have distinct functions. However, no relevant reports have been found regarding the function of GhVAMP714 in cotton. Summary of the Invention

[0005] In response to the above problems, the present invention provides an application of a vesicle-associated membrane protein 714 encoding gene GhVAMP714 in regulating the radicle length of cotton seeds.

[0006] To achieve the above objectives, the technical solution of the present invention is: the use of the vesicle-associated membrane protein 714 encoding gene GhVAMP714 in regulating plant seed vigor, the cDNA sequence of the gene GhVAMP714 is shown in SEQ ID NO.1, and the genomic sequence is shown in SEQ ID NO.2; the amino acid sequence of the protein encoded by the gene GhVAMP714 is shown in SEQ ID NO.3.

[0007] Furthermore, the application is to overexpress the GhVAMP714 gene in Arabidopsis thaliana to promote the radicle elongation of Arabidopsis thaliana seeds.

[0008] Furthermore, the application is to silence or knock out the GhVAMP714 gene in cotton to inhibit the radicle elongation of cotton seeds during germination; overexpressing the GhVAMP714 gene in cotton can promote the radicle elongation of cotton seeds during germination.

[0009] The invention relates to the use of a biological material for improving the expression of the GhVAMP714 gene in increasing the radicle length of Arabidopsis seeds, wherein the biological material comprises: a) an expression cassette capable of significantly increasing the expression of the GhVAMP714 gene; b) a recombinant vector having the function described in a); and c) a recombinant bacterium having the function described in a) or the recombinant vector described in b).

[0010] The invention relates to the use of a biological material for reducing the expression of the GhVAMP714 gene in reducing the radicle length of cotton seeds, wherein the biological material comprises: a) an expression cassette capable of significantly downregulating the GhVAMP714 gene to gene silencing; b) a recombinant vector having the function described in a); and c) a recombinant bacterium having the function described in a) or the recombinant vector described in b).

[0011] The invention relates to an application of a biological material for improving the expression of the GhVAMP714 gene in increasing the radicle length of cotton seeds. The biological material comprises: a) an expression cassette capable of significantly increasing the expression of the GhVAMP714 gene; b) a recombinant vector having the function described in a); and c) a recombinant bacterium having the function described in a) or the recombinant vector described in b).

[0012] The use of the above-mentioned encoding gene GhVAMP714 in identifying, screening, breeding or improving plant varieties with plant seed vigor.

[0013] Furthermore, the plant is cotton.

[0014] The application of the SNP site located on the above-mentioned coding gene GhVAMP714 in identifying, screening, cultivating or improving plant varieties for plant seed vigor, wherein the SNP site is the 494th base of the sequence shown in SEQ ID NO.1. When the base at the SNP site is A, the cotton seed radicle length is long, and when the base is G, the cotton seed short radicle length is short.

[0015] Furthermore, the primer pair for identifying the SNP site is: the upstream primer sequence is shown in SEQ ID NO.19, and the downstream primer sequence is shown in SEQ ID NO.20.

[0016] The beneficial effects of the application of the vesicle-associated membrane protein 714 encoding gene GhVAMP714 of the present invention in regulating the radicle length of cotton seeds are:

[0017] The present invention identified the GhVAMP714 gene, which is significantly associated with cotton radicle length, through GWAS mapping analysis. Transcriptome analysis showed that GhVAMP714 expression in the radicle gradually increased with seed germination time, further confirming its correlation with seed radicle length.

[0018] In this study, cotton plants in which the GhVAMP714 gene was silenced exhibited significantly shorter radicle lengths than control plants at 48 hours post-germination. Arabidopsis plants overexpressing the GhVAMP714 gene exhibited significantly longer radicle lengths than control plants at 72 hours post-germination. These results not only validate the association between genes and traits but also provide a reliable gene for molecular marker-assisted breeding. Modulating GhVAMP714 expression through genetic engineering methods (such as overexpression or gene knock-in) can effectively promote cotton radicle elongation and enhance seed vigor, possessing important application value in breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0020] Figure 1 This is the GWAS and eQTL co-localization analysis of cotton radicle length and germination rate traits;

[0021] Figure 2 is the relationship diagram between GhVAMP714 gene expression and SNP typing;

[0022] Figure 3 This is a statistical graph of the gene expression levels of GhVAMP714 in different tissues and developmental stages of cotton;

[0023] Figure 4 is the germination phenotype and gene expression of silencing GhVAMP714 in cotton seeds;

[0024] Figure 5 The germination phenotype and gene expression of overexpressed GhVAMP714 in Arabidopsis thaliana. DETAILED DESCRIPTION

[0025] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings in the embodiments of the present invention. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0026] Example 1

[0027] Mining of the gene GhVAMP714 encoding vesicle-associated membrane protein 714 associated with cotton seed vigor:

[0028] Reference Figure 1 and Figure 2 As shown, seeds from 356 different cotton varieties were used for imbibition and germination experiments. Phenotypic data related to seed size within 24 hours of seed imbibition and phenotypic data related to germination and radicle length development within 120 hours were collected. The sequencing data were aligned to the genome sequence of the TM-1 (V2.1) genetic standard line of cotton, and genome-wide single nucleotide polymorphism markers (SNPs) were identified using Samtools software. A total of multiple high-quality SNPs (minimum gene frequency > 0.05) were mined for subsequent analysis. Genome-wide association analysis was performed with phenotypes using EMMAx software, and the results were analyzed based on P < 1×10 -6 Screening for SNP-associated signal loci revealed 541 candidate loci with strong correlations with radicle length and germination rate during seed germination. Among these, a SNP located on chromosome A08 (A08:710720) showed a strong correlation with both radicle length and germination rate. The candidate gene within the LD block region where this locus resides is GhVAMP714 (GH_A08G0099), encoding vesicle-associated membrane protein 714. To further pinpoint genes closely associated with phenotypic traits, transcriptome sequencing was performed on radicles of seeds germinated for 36 hours. Finally, GH_A08G0099 (GhVAMP714) was found to be closely associated with both radicle length and germination rate in cotton seeds.

[0029] Example 2

[0030] Obtaining the vesicle-associated membrane protein 714 encoding gene GhVAMP714:

[0031] The cDNA and genomic sequences of GhVAMP714, as well as the amino acid sequence of the protein encoded by it, were obtained from the genomic sequence of the upland cotton genetic standard line TM-1. The cDNA sequence of GhVAMP714 (654 bp) is shown in SEQ ID NO. 1; the genomic sequence of GhVAMP714 (2996 bp) is shown in SEQ ID NO. 2; and the amino acid sequence of the protein encoded by GhVAMP714 (SEQ ID NO. 3) (217 aa) is shown in SEQ ID NO. 3.

[0032] The primers F1: (5'-3') ATGGCGATTCTTTACGCCGTGGTG (SEQ ID NO. 4) and R1: (5'-3') TCAGGATCTGCATGATGGTAGAGT (SEQ ID NO. 5) were designed based on the gene cDNA to clone the full-length gene.

[0033] The PCR reaction procedure was as follows: initial denaturation at 98°C for 5 minutes; 34 cycles of denaturation at 98°C for 10 seconds, annealing at 57°C for 5 seconds, and extension at 68°C for 10 seconds; and a final extension at 68°C for 5 minutes. The PCR amplified product was then sequenced and compared with a reference cDNA sequence to confirm the accuracy of the cloned sequence. Successful sequence alignment confirmed the identification of the gene encoding vesicle-associated membrane protein 714, GhVAMP714.

[0034] Example 3

[0035] Analysis of the expression level of gene GhVAMP714 in different tissues and developmental stages of cotton:

[0036] This experiment used RNA samples from different cotton tissues and developmental stages for transcriptome sequencing. Sample materials included roots, stems, leaves, seeds, cotyledons, and ovules. Furthermore, root, stem, and leaf samples were collected at the four-leaf stage; seed samples included samples taken at 0, 5, and 10 hours of imbibition and germination; cotyledon growth and root elongation samples were collected at 24, 48, 72, and 120 hours; and ovule tissue samples were collected 3 and 1 days before flowering, on the day of flowering, and from 1 to 35 days after flowering.

[0037] The results show (such as Figure 3 ): The expression of gene GhVAMP714 in the radicle gradually increased with the increase of seed germination time, indicating that this gene is related to the seed vigor trait.

[0038] Example 4

[0039] Application of silencing GhVAMP714 gene in reducing cotton radicle length traits:

[0040] (1) Construction of cotton GhVAMP714 gene pTRV2 silencing vector

[0041] A silenced gene fragment was designed. The nucleotide sequence of the silenced gene fragment is shown in SEQ ID NO: 6. Gene primers for amplifying the sequence were designed based on the nucleotide sequence of the silenced gene fragment. At the same time, the primers were added with sequences containing specific restriction enzyme sites corresponding to the silencing vector (restriction sites are EcoRI and XBaI). The gene silencing primers are as follows:

[0042] Upstream primer F2: 5'-gtgagtaaggttaccgaattcTTTTCATACTTGGAGGATATTCACAT (SEQ IDNO:7)

[0043] Downstream primer R2: 5'-tccccatggaggccttctagaACAGCAAGCAGCAATTATTAGGTAGA (SEQ IDNO: 8)

[0044] The pTRV2 silencing vector was selected, with restriction enzymes EcoRI and XBaI, and the plasmid was double-digested. The CDS fragment of the gene was used as a template and amplified using silencing primers containing restriction enzyme sequences. The amplified product was purified, ligated by homologous recombination, transformed into DH5α competent cells, and screened for kanamycin resistance. Positive clones were tested using universal primers, and the recombinant plasmid pTRV2-GhVAMP714 with the correct sequence was selected for subsequent experiments.

[0045] Universal primers:

[0046] Upstream universal primer F3: TTGTTACTCAAGGAAGCACGAT (SEQ ID NO: 9)

[0047] Downstream universal primer R3: TCCCCTATGGTAAGACAATGAG (SEQ ID NO: 10)

[0048] The PCR reaction program was as follows: pre-denaturation at 98°C for 5 min; 35 cycles of denaturation at 98°C for 10 sec, annealing at 58°C for 5 sec, and extension at 68°C for 10 sec; and a final extension at 68°C for 5 min.

[0049] (2) Agrobacterium transformation

[0050] The recombinant plasmid was transferred into GV3101 competent cells by freeze-thaw method, and the kanamycin / rifampicin dual antibody screening was performed. The above universal primers were used for positive detection, and the correct monoclonal bacterial solution was selected for subsequent experiments.

[0051] (3) Preparation of Agrobacterium infection solution

[0052] Agrobacterium containing pTRV2, pTRV2-GhVAMP714, and pTRV1 were inoculated into LB medium containing antibiotics and cultured at 28°C with shaking until the logarithmic phase. The cells were collected by centrifugation and resuspended in buffer (10 mM MgCl2, 10 mM MES, 200 μM acetosyringone) to an OD of 600 = 2.0, and incubate in the dark for 3 h. Mix equal volumes of pTRV1 bacterial suspension with pTRV2-GhVAMP714 or pTRV2 bacterial suspension for subsequent infection.

[0053] (4) Cotton VIGS infection treatment

[0054] Seeds were sterilized with 75% ethanol (30 seconds), 10% sodium hypochlorite (10 minutes), and then rinsed five times with sterile water. Germination was performed at 28°C until the radicle (approximately 1 mm) appeared white. Germinated seeds (radicles breaking through the seed coat) were immersed in an Agrobacterium suspension (OD600 = 1.5) for one day and then transferred to moist vermiculite for culture. Plants containing pTRV1+pTRV2-GhVAMP714 were GhVAMP714-silenced cotton plants, while plants containing the pTRV1+pTRV2 plasmids served as controls (pTRV2:00). (Methods refer to A newly established virus-induced gene silencing method via seed imbibition for functional genomics.)

[0055] (5) Identification of gene silencing efficiency and radicle length traits

[0056] Radicles were collected 36 hours after infection, and RNA was extracted using the SpectrumPlant kit. After reverse transcription, GhHis3 was used as an internal reference. Gene expression was detected using quantitative primers (SEQ ID NOs: 11-12, as described below) (SYBR Green assay, 40 cycles). Specific primers for qRT-PCR analysis of the target gene were designed using Oligo 6.0 software. The quantitative primers are as follows:

[0057] F4: 5' - TGATGAGTTCTCACGGGTATTG (SEQ ID NO: 11)

[0058] R4: 5' - TCCAAAGTGCTTGACGAAGG (SEQ ID NO: 12)

[0059] Use 2-△△CT The relative expression of the target gene was calculated using the method to determine the expression level of the GhVAMP714 gene before and after silencing. The results are shown in Figure 2. Figure 4 As shown, in the pTRV2:GhVAMP714 individual, the expression of the GhVAMP714 gene was significantly lower than that in the pTRV2:00 individual, indicating that the GhVAMP714 gene was effectively silenced in pTRV2:GhVAMP714.

[0060] Identify the changes in cotton radicle length after silencing treatment: Photograph individual cotton plants with silenced genes and controls, such as Figure 4 As shown in the figure, pTRV2:00 exhibited a longer radicle length overall, while the radicle length of pTRV2:GhVAMP714 was significantly shorter than that of pTRV2:00, indicating that the radicle length of pTRV2:GhVAMP714 with GhVAMP714 silenced was significantly reduced.

[0061] Example 5

[0062] Application of overexpression of GhVAMP714 gene in improving radicle length traits in Arabidopsis thaliana:

[0063] (1) Construction of cotton GhVAMP714 gene pBI121 expression vector

[0064] The gene fragment of the expression vector was designed to be the aforementioned SEQ ID NO: 1. Gene primers for amplification were designed based on the gene nucleotide sequence. At the same time, the primers were added with a sequence containing specific restriction enzyme sites corresponding to the pBI121 expression vector (double restriction enzymes XbaI and XmaI). The gene expression primers are as follows:

[0065] Upstream primer F5: 5'- gagaacacgggggactctagaATGGCGATTCTTTACGCCG (SEQ ID NO: 13)

[0066] Downstream primer R5: 5'- ataagggactgaccacccgggTCAGGATCTGCATGATGGTAGAGT (SEQ IDNO: 14)

[0067] The pBI121 expression vector was double-digested with XbaI and XmaI. Amplification was performed using the CDS fragment of the gene as a template using silencing primers containing restriction site sequences. The amplified product was purified, recombined, and transformed as in Example 4. Positive clones were detected using universal primers and sequenced. The recombinant plasmid with the correct sequence, pBI121-GhVAMP714, was selected for subsequent experiments.

[0068] Universal primers:

[0069] Upstream universal primer F6: CCCACTATCCTTCGCAAGACC (SEQ ID NO: 15)

[0070] Downstream universal primer R6: CAATTGCCCGGCTTTCTTG (SEQ ID NO: 16)

[0071] The PCR reaction program was as follows: pre-denaturation at 98°C for 5 min; 35 cycles of denaturation at 98°C for 10 sec, annealing at 58°C for 5 sec, and extension at 68°C for 10 sec; and a final extension at 68°C for 5 min.

[0072] (2) Preparation of Agrobacterium infection solution

[0073] Agrobacterium transformation was the same as in Example 4. The positive bacterial solution was expanded to OD 600 = 1.0, centrifuged and resuspended in transformation buffer (5% sucrose, 0.02-0.05% Silwet L-77, OD 600 =1.0).

[0074] (3) Arabidopsis transformation

[0075] Water the plants that are about to sprout and flower well the day before. Turn the pot upside down and place all inflorescences in the pre-suspended bacterial solution in transformation buffer for about 30 seconds. Remove any excess solution with absorbent paper. Repeat the transformation process seven days later. Store mature seeds (T0 generation seeds) in a paper bag.

[0076] (4) Screening of transgenic Arabidopsis

[0077] Seed disinfection: 70% ethanol (1 min), 7% sodium hypochlorite (10 min), and then rinse five times with sterile water. Resistance screening: Seeds were sown on 1 / 2 MS medium containing 50 μg / mL kanamycin and vernalized at 4°C for 48 h before incubation (20-22°C, 16 h light / 8 h dark). Positive seedling identification: T1 seedling leaves were verified by PCR. Positive lines (T2 generation) were used for subsequent experiments.

[0078] (5) Identification of gene expression efficiency and radicle length traits

[0079] Plant tissue RNA extraction: Tissues of the positive seedlings and control seedlings at the same growth cycle were sampled using the same method as in Example 4.

[0080] The reverse transcription reaction and qRT-PCR quantitative fluorescence method were the same as in Example 4.

[0081] Oligo 6.0 software was used to design specific primers for qRT-PCR analysis of target genes. The quantitative primers are as follows:

[0082] F7: 5' - TGATGAGTTCTCACGGGTATTG (SEQ ID NO: 17)

[0083] R7: 5' - TCCAAAGTGCTTGACGAAGG (SEQ ID NO: 18)

[0084] Use 2 -△△CT The relative expression of the target gene was calculated by the method, and the expression level of the GhVAMP714 gene was determined. The results are shown in Figure 2. Figure 5 As shown, in the pBI121: GhVAMP714 single plant, the expression of the GhVAMP714 gene was significantly higher than that of the wild-type single plant, indicating that the GhVAMP714 gene was effectively expressed in pBI121: GhVAMP714.

[0085] Identifying changes in radicle length after overexpression: Individual Arabidopsis plants overexpressing the gene and controls were photographed. As shown in Figure 5, pBI121:GhVAMP714 exhibits longer radicle length overall, while the wild-type plant exhibits significantly shorter radicle length than pBI121:GhVAMP714. This indicates that pBI121:GhVAMP714 overexpressing GhVAMP714 exhibits significantly improved radicle length.

[0086] The above results demonstrate that the GhVAMP714 gene has significant research value in developing new cotton varieties with increased radicle length. On the one hand, molecular markers based on the GhVAMP714 gene can be designed to effectively identify cotton radicle length traits, thus having significant application value in the breeding of cotton varieties with enhanced radicle length. On the other hand, using genetic engineering as an example, the GhVAMP714 gene could be introduced into cotton varieties to increase radicle length, thereby enhancing seed vigor and cultivating new cotton varieties with increased radicle length. Among them, genotyping was performed according to the SNP (A08:710720, specifically at position 494 of the sequence shown in SEQIDNO.1) of the regulatory gene GhVAMP714. Based on the position of the SNP on the chromosome, amplification primers were designed at both ends thereof. The primer sequences were F8 (SEQ ID NO.19): (5'-3') ATTGAGCTTCTTGTTGACAA and R8 (SEQID NO.20): (5'-3') TACCACCACAGCAAGCAGCAAT. This pair of primers was used to perform PCR amplification and sequencing in the population varieties. There is a non-synonymous mutation SNP site in the GhVAMP714 sequence in the population. The corresponding position on the transcribed cDNA changes from A to G, causing the amino acid to change from Asp to Gly. Specifically, the 356 varieties of cotton materials described in Example 1 were sequenced, and the results are as follows. Figure 2 As shown, 176 varieties of cotton have an AA genotype and longer seed radicle length, 163 varieties of cotton have a GG genotype and shorter seed radicle length, and the rest are hybrid gene cotton varieties.

[0087] Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

Claims

1. Application of the vesicle-associated membrane protein 714 encoding gene GhVAMP714 in promoting radicle elongation of Arabidopsis seeds, characterized in that: The application is to overexpress the GhVAMP714 gene in Arabidopsis thaliana to promote the radicle elongation of Arabidopsis thaliana seeds. The cDNA sequence of the gene GhVAMP714 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The genomic sequence of the gene GhVAMP714 is shown as SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The amino acid sequence of the protein encoded by the gene GhVAMP714 is shown in SEQ ID NO.

3.

4. The use of the silencing vesicle-associated membrane protein 714 encoding gene GhVAMP714 in inhibiting the radicle elongation of cotton seeds during germination, characterized in that: The cDNA sequence of the gene GhVAMP714 is shown in SEQ ID NO.

1. The gene GhVAMP714 is silenced by infecting Agrobacterium infection solution containing pTRV2-GhVAMP714 and pTRV1. The pTRV2-GhVAMP714 contains the silencing fragment shown in SEQ ID NO:

6.

5. The use according to claim 4, characterized in that The genomic sequence of the gene GhVAMP714 is shown as SEQ ID NO.

2.

6. The use according to claim 4, characterized in that The amino acid sequence of the protein encoded by the gene GhVAMP714 is shown in SEQ ID NO.

3.

7. Use of a biomaterial for increasing the expression of the vesicle-associated membrane protein 714 encoding gene GhVAMP714 in increasing the radicle length of Arabidopsis seeds, characterized in that: The biological material is selected from: a) an expression cassette containing the GhVAMP714 gene; b) a recombinant vector containing a) the expression cassette; c) a recombinant bacterium having a) the expression cassette or b) the recombinant vector; the cDNA sequence of the gene GhVAMP714 is shown in SEQ ID NO.

1.

8. Use of a primer pair for detecting a SNP site on the vesicle-associated membrane protein 714 encoding gene GhVAMP714 in identifying or screening cotton varieties with high seed radicle length, characterized in that: The SNP site is located at position 494 of the sequence shown in SEQ ID NO.1, and the SNP site has an A / G polymorphism; if the genotype of the SNP site is AA, the seed radicle length is longer, and if the genotype is GG, the seed radicle length is shorter; the primer pair is: the upstream primer sequence is shown in SEQ ID NO.19, and the downstream primer sequence is shown in SEQ ID NO.20.