A method for creating corn dwarfing material and its application

Abstract

The present invention belongs to the field of genetic engineering technology, and specifically relates to a method for creating corn dwarfing materials and its application. The present invention discloses a method for creating corn dwarfing materials, specifically using genetic engineering methods to edit specific key sites of the target genes ZmGA20ox3 and / or ZmGA20ox5 in corn, wherein the proteins encoded by the target genes ZmGA20ox3 and / or ZmGA20ox5 after the specific key site editing undergo specific amino acid site mutations, and further cultivation and screening are performed to obtain corn dwarfing materials. The method provided by the present invention can be used to cultivate transgenic corn plants with different plant heights and other agronomic traits, and at the same time provides a new breeding technology solution for creating dwarf corn, reducing corn ear height, reducing corn plant leaf angle, and increasing corn yield; in agriculture, crops can be planted more densely, thereby increasing crop yield per unit area, which has important breeding significance.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for creating corn dwarfing material and application thereof. Background Art

[0002] Corn is an important food crop, and its yield is crucial to human society. While increasing corn planting density per unit area is a key measure for increasing yield, high density also poses the problem of lodging, which, to a certain extent, reduces yield. Therefore, reducing corn plant height to the extent possible can help increase yield. While numerous dwarf corn mutants have been developed in past research and production, their practical application is extremely rare.

[0003] ZmGA20ox3 and ZmGA20ox5 are two genes encoding GA20oxidase in maize (Zea mays). They belong to a family of key enzymes in the gibberellin (GA) biosynthesis pathway. They play an important role in regulating plant growth and development, such as plant height, flowering, and seed germination. However, existing research on the functional sites of ZmGA20ox3 and ZmGA20ox5 is limited.

[0004] Currently, gene editing technology is widely used to create dwarf maize varieties. However, the traditional CRISPR / Cas9 gene editing system still suffers from issues such as low efficiency and off-target effects. CRISPR / CasD gene editing technology can precisely edit specific sites within the genome and has been successfully applied to genome editing in various plant species, accelerating gene function research and molecular genetic improvement of crops. However, the application of this technology in maize breeding still has gaps and deficiencies. The generation of maize dwarf mutants using CRISPR / CasD gene editing technology also holds promise for application in maize breeding. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for creating corn dwarf material and application thereof.

[0006] The present invention provides a method for creating a dwarf corn material, comprising the steps of editing target genes ZmGA20ox3 and / or ZmGA20ox5 in corn at specific key sites by genetic engineering means, wherein proteins encoded by the target genes ZmGA20ox3 and / or ZmGA20ox5 after the editing at the specific key sites undergo mutations at specific amino acid sites, and further cultivation and screening are performed to obtain the dwarf corn material.

[0007] The specific amino acid site mutation of the present invention involves any of the following situations:

[0008] 1) The amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at specific key sites is altered at any of amino acids 8, 11, 15-153, 14, 16, 17, 18, 322, 330, 332, 333, or 334, or amino acids 323-346 are deleted; or

[0009] 2) The amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at specific key sites changes at any of the amino acid positions 224, 225, 408, 419, or 420, or the amino acids 220-225 are deleted; or

[0010] 3) After editing at specific key sites, the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 changed from amino acid position 18, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 changed from amino acid position 225;

[0011] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from amino acids 15 to 153, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from amino acid 225;

[0012] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from the 16th amino acid, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from the 225th amino acid;

[0013] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from the 8th amino acid, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from the 224th amino acid;

[0014] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from the 16th amino acid, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from the 224th amino acid;

[0015] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from the 14th amino acid, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site is deleted from amino acids 215 to 235;

[0016] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site is deleted at amino acids 4-16, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site is deleted at amino acids 215-235;

[0017] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from the 16th amino acid, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from the 215th amino acid;

[0018] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site is deleted at amino acid positions 16-17, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site is changed from amino acid position 225;

[0019] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from amino acid 17, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site is deleted from amino acids 220-225;

[0020] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from the 14th amino acid, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from the 224th amino acid;

[0021] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at the specific key site changes from the 11th amino acid, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at the specific key site changes from the 225th amino acid; or,

[0022] 4) The amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changed from amino acid position 330, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changed from amino acid position 419;

[0023] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from amino acid position 322, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from amino acid position 408;

[0024] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site is deleted at amino acids 323-346, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site is changed from amino acid 419;

[0025] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from amino acid position 332, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from amino acid position 419;

[0026] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from amino acid position 333, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from amino acid position 419;

[0027] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from amino acid position 343, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site is deleted from amino acid position 419;

[0028] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from amino acid position 343, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from amino acid position 420;

[0029] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from amino acid position 343, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from amino acid position 416;

[0030] Or the amino acid sequence of the protein encoded by the target gene ZmGA20ox3 after editing at a specific key site changes from the 344th amino acid, and the amino acid sequence of the protein encoded by the target gene ZmGA20ox5 after editing at a specific key site changes from the 419th amino acid.

[0031] Specifically, the present invention provides a method for creating corn dwarfing materials, the specific steps of which are as follows:

[0032] 1) Design target sites for the target genes ZmGA20ox3 and / or ZmGA20ox5 in maize, and concatenate the gRNA sequences designed based on the target sites into the corresponding gene editing vector carrying the Cas protein encoding gene to obtain a tandem gene editing vector.

[0033] In some embodiments, two gRNA sequences are designed for the target genes ZmGA20ox3 and ZmGA20ox5 respectively for two gene editing vectors.

[0034] In some embodiments, currently known gene editing technologies can also complete the gene editing process of the present invention, such as: CRISPR / Cas9 gene editing technology, CRISPR / CasD gene editing technology, etc.

[0035] In some embodiments, CRISPR / CasD gene editing technology is used to construct the LP216-OX3-gRNA and LP216-OX5-gRNA target sites into the gene sequence of the CasD protein and the corresponding gene editing vector LP216 to obtain a tandem gene editing vector; then the LP217-OX3-gRNA and LP217-OX5-gRNA target sites are constructed into the gene sequence of the CasD protein and the corresponding gene editing vector LP217 to obtain another tandem gene editing vector.

[0036] 2) The tandem gene editing vector described in step 1) is connected to a plant expression vector through a cloning reaction to obtain a recombinant expression vector.

[0037] In some embodiments, there are two recombinant expression vectors for the target genes ZmGA20ox3 and ZmGA20ox5, namely pCasD-ZmGA20ox3 and pCasD-ZmGA20ox5.

[0038] 3) The recombinant expression vectors described in step 2) are respectively transferred into Agrobacterium to perform genetic transformation of corn, thereby achieving editing of specific key sites of the target genes ZmGA20ox3 and / or ZmGA20ox5 in the corn and mutation of specific amino acid sites of the proteins encoded by the target genes ZmGA20ox3 and / or ZmGA20ox5 after the editing of the specific key sites, and obtaining corn dwarf materials through cultivation and screening.

[0039] In some embodiments, for the target gene ZmGA20ox3 in corn, the gRNA sequence is:

[0040] LP216-OX3-gRNA:cccaactcccagcattgacctcc (SEQ ID NO: 5);

[0041] LP217-OX3-gRNA: cgccgcggcagtacccggacttc (sequence SEQ ID NO: 6);

[0042] For the target gene ZmGA20ox5 in maize, the gRNA sequence is:

[0043] LP216-OX5-gRNA: cgaccggttcgcggccaagctcc (SEQ ID NO: 7);

[0044] LP217-OX5-gRNA: cgccgcggcgctacccggacttc (SEQ ID NO: 8);

[0045] In some embodiments, the gene editing vectors in step 1) are LP216 and LP217.

[0046] In some embodiments, for the target gene ZmGA20ox3, the mutation of its editing site is as follows:

[0047] In the LP217 vector, the DNA sequence of the target gene ZmGA20ox3 lacks bases 2398-2467, and the amino acid sequence of the encoded protein changes from the 330th amino acid; its sequence lacks bases 2373-2466, and the amino acid sequence of the encoded protein changes from the 322nd amino acid; its sequence lacks bases 2378-2449, and the amino acid sequence of the encoded protein is deleted from the 323rd to 346th amino acids; its sequence lacks bases 2405-2450 and inserts 8bp, and the amino acid sequence of the encoded protein changes from the 332nd amino acid sequence; its sequence lacks bases 2407-2449, and the amino acid sequence of the encoded protein changes from the 333rd amino acid sequence; its sequence has base GA inserted at base 2440, and the amino acid sequence of the encoded protein changes from the 344th amino acid sequence;

[0048] In the LP216 vector, the DNA sequence of the target gene ZmGA20ox3 lacks bases 131-542, and the amino acid sequence of the encoded protein changes from the 18th amino acid sequence; its sequence lacks bases 126-542, and the amino acid sequence of the encoded protein changes from the 15th-153rd amino acid sequence; its sequence lacks bases 129-132, and the amino acid sequence of the encoded protein changes from the 16th amino acid sequence; its sequence lacks bases 106-129 and inserts 52bp, and the amino acid sequence of the encoded protein changes from the 8th amino acid sequence; its sequence lacks bases 124-131, and the amino acid sequence of the encoded protein changes from the 14th amino acid sequence; its sequence lacks base T at position 128, and the amino acid sequence of the encoded protein changes from the 17th amino acid sequence; its sequence lacks bases 118-130, and the amino acid sequence of the encoded protein changes from the 11th amino acid sequence.

[0049] For the target gene ZmGA20ox5, the mutations at its editing sites are as follows:

[0050] In the LP217 vector, the DNA sequence of the target gene ZmGA20ox3 lacks base C at position 2348, and the amino acid sequence of the encoded protein changes from the amino acid sequence at position 419; its sequence lacks bases 2309-2350, and the amino acid sequence of the encoded protein changes from the amino acid sequence at position 408; its sequence lacks base G at position 2350, and the amino acid sequence of the encoded protein changes from the amino acid sequence at position 420.

[0051] In the LP216 vector, the DNA sequence of the target gene ZmGA20ox3 lacks the 684th position and inserts base G, and the amino acid sequence of the encoded protein changes from the 225th amino acid sequence; its sequence lacks the 682nd position and inserts base T, and the amino acid sequence of the encoded protein changes from the 224th amino acid sequence; its sequence lacks bases 622-686, and the amino acid sequence of the encoded protein is deleted from the 220th to 225th amino acid sequences.

[0052] In some embodiments, for the tandem gene editing vector obtained from the gene editing vector LP216, the site-directed mutagenesis are:

[0053] After editing at specific key sites, the target gene ZmGA20ox3 had bases 131-542 deleted, and the amino acid sequence of the encoded protein changed from the 18th amino acid. After editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at the 684th base, and the amino acid sequence of the encoded protein changed from the 225th amino acid.

[0054] After editing at specific key sites, the target gene ZmGA20ox3 had bases 126-542 deleted, and the amino acid sequence of the encoded protein changed from amino acids 15-153. After editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at base 684, and the amino acid sequence of the encoded protein changed from amino acid 225.

[0055] After editing at specific key sites, the target gene ZmGA20ox3 had bases 129-132 deleted, and the amino acid sequence of the encoded protein changed from the 16th amino acid. After editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at the 684th base, and the amino acid sequence of the encoded protein changed from the 225th amino acid.

[0056] After editing at specific key sites, the target gene ZmGA20ox3 had bases 106-129 deleted and 52 bp inserted, and the amino acid sequence of the encoded protein changed from the 8th amino acid. After editing at specific key sites, the target gene ZmGA20ox5 had base T inserted at the 682nd base, and the amino acid sequence of the encoded protein changed from the 224th amino acid.

[0057] After editing at a specific key site, the target gene ZmGA20ox3 had a TC inserted at base 129, and the amino acid sequence of the encoded protein changed from the 16th amino acid. After editing at a specific key site, the target gene ZmGA20ox5 had a T inserted at base 682, and the amino acid sequence of the encoded protein changed from the 224th amino acid.

[0058] After editing the target gene ZmGA20ox3 at specific key sites, bases 124-131 were deleted, and the amino acid sequence of the encoded protein changed from the 14th amino acid. After editing the target gene ZmGA20ox5 at specific key sites, bases 656-718 were deleted, and amino acids 215-235 of the amino acid sequence of the encoded protein were deleted.

[0059] After editing the target gene ZmGA20ox3 at specific key sites, bases 96-134 were deleted, and amino acids 4-16 were deleted in the amino acid sequence of the encoded protein; after editing the target gene ZmGA20ox5 at specific key sites, bases 656-718 were deleted, and amino acids 215-235 were deleted in the amino acid sequence of the encoded protein;

[0060] After editing at a specific key site, the target gene ZmGA20ox3 had a TC insertion at base 129, and the amino acid sequence of the encoded protein changed from amino acid 16; after editing at a specific key site, the target gene ZmGA20ox5 had a deletion at bases 656-686, and the amino acid sequence of the encoded protein changed from amino acid 215;

[0061] After editing at specific key sites, the target gene ZmGA20ox3 had bases 129-134 deleted, and the amino acids 16-17 of the amino acid sequence of the encoded protein were deleted; after editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at base 684, and the amino acid sequence of the encoded protein changed from amino acid 225;

[0062] After editing the target gene ZmGA20ox3 at a specific key site, the T base at position 128 was deleted, and the amino acid sequence of the encoded protein changed from the 17th amino acid. After editing the target gene ZmGA20ox5 at a specific key site, the bases 622-686 were deleted, and the amino acid sequence of the encoded protein was deleted from positions 220-225.

[0063] After editing at specific key sites, the target gene ZmGA20ox3 had bases 126-132 deleted, and the amino acid sequence of the encoded protein changed from the 14th amino acid. After editing at specific key sites, the target gene ZmGA20ox5 had a T inserted at the 682nd base, and the amino acid sequence of the encoded protein changed from the 224th amino acid.

[0064] After editing at specific key sites, the target gene ZmGA20ox3 had bases 118-130 deleted, and the amino acid sequence of the encoded protein changed from the 11th amino acid; after editing at specific key sites, the target gene ZmGA20ox5 had base G inserted at the 684th base, and the amino acid sequence of the encoded protein changed from the 225th amino acid.

[0065] In some embodiments, for the tandem gene editing vector derived from the gene editing vector LP217, the site-directed mutagenesis is:

[0066] After editing at specific key sites, the target gene ZmGA20ox3 had bases 2398-2467 deleted, and the amino acid sequence of the encoded protein changed from amino acid 330. After editing at specific key sites, the target gene ZmGA20ox5 had base C deleted at position 2348, and the amino acid sequence of the encoded protein changed from amino acid 419.

[0067] After editing at specific key sites, the target gene ZmGA20ox3 had bases 2373-2466 deleted, and the amino acid sequence of the encoded protein changed from amino acid 322; after editing at specific key sites, the target gene ZmGA20ox5 had bases 2309-2350 deleted, and the amino acid sequence of the encoded protein changed from amino acid 408;

[0068] After editing at specific key sites, the target gene ZmGA20ox3 had bases 2378-2449 deleted, and the amino acid sequence of the encoded protein had amino acids 323-346 deleted. After editing at specific key sites, the target gene ZmGA20ox5 had base C deleted at position 2348, and the amino acid sequence of the encoded protein changed from amino acid 419.

[0069] After editing at specific key sites, the target gene ZmGA20ox3 had a deletion of bases 2405-2450 and an insertion of 8bp, and the amino acid sequence of the encoded protein changed from amino acid position 332. After editing at specific key sites, the target gene ZmGA20ox5 had a deletion of base C at position 2348, and the amino acid sequence of the encoded protein changed from amino acid position 419.

[0070] After editing at specific key sites, the target gene ZmGA20ox3 deleted bases 2407-2449, and the amino acid sequence of the encoded protein changed from amino acid 333; after editing at specific key sites, the target gene ZmGA20ox5 deleted base C at position 2348, and the amino acid sequence of the encoded protein changed from amino acid 419.

[0071] After editing at a specific key site, the target gene ZmGA20ox3 has a C base deletion at position 2440, and the amino acid sequence of the encoded protein changes from amino acid position 343; after editing at a specific key site, the target gene ZmGA20ox5 has a base deletion at positions 2348-2350, and the amino acid sequence of the encoded protein is deleted from amino acid position 419.

[0072] After editing at a specific key site, the target gene ZmGA20ox3 deleted the C base at position 2440, and the amino acid sequence of the encoded protein changed from the 343rd amino acid; after editing at a specific key site, the target gene ZmGA20ox5 deleted the G base at position 2350, and the amino acid sequence of the encoded protein changed from the 420th amino acid.

[0073] After editing at a specific key site, the target gene ZmGA20ox3 has a C base deletion at position 2440, and the amino acid sequence of the encoded protein changes from amino acid position 343; after editing at a specific key site, the target gene ZmGA20ox5 has a base deletion at positions 2348-2393, and the amino acid sequence of the encoded protein changes from amino acid position 416.

[0074] After editing at a specific key site, the target gene ZmGA20ox3 had a GA insertion at position 2440, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at a specific key site, the target gene ZmGA20ox5 had a C deletion at position 2348, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0075] After editing at a specific key site, the target gene ZmGA20ox3 deleted the base CA at position 2440-2441, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at a specific key site, the target gene ZmGA20ox5 inserted the base GA at position 2348, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0076] After editing at specific key sites, the target gene ZmGA20ox3 deleted the base CA at positions 2440-2441, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at specific key sites, the target gene ZmGA20ox5 deleted the bases 2349-2350, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0077] After editing at a specific key site, the target gene ZmGA20ox3 deleted base C at position 2440, and the amino acid sequence of the encoded protein changed from amino acid position 344; after editing at a specific key site, the target gene ZmGA20ox5 inserted base T at position 2348, and the amino acid sequence of the encoded protein changed from amino acid position 419.

[0078] After editing at a specific key site, the target gene ZmGA20ox3 deleted base C at position 2440, and the amino acid sequence of the encoded protein changed from amino acid position 344; after editing at a specific key site, the target gene ZmGA20ox5 deleted base C at position 2348, and the amino acid sequence of the encoded protein changed from amino acid position 419.

[0079] After editing at specific key sites, the target gene ZmGA20ox3 deleted the base CA at positions 2440-2441, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at specific key sites, the target gene ZmGA20ox5 deleted the base GC at positions 2349-2350, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0080] After editing at a specific key site, the target gene ZmGA20ox3 had a C base inserted at position 2440, and the amino acid sequence of the encoded protein changed from amino acid position 344; after editing at a specific key site, the target gene ZmGA20ox5 had a GC base deleted at positions 2349-2350, and the amino acid sequence of the encoded protein changed from amino acid position 419.

[0081] After editing at a specific key site, the target gene ZmGA20ox3 had a GA insertion at position 2440, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at a specific key site, the target gene ZmGA20ox5 had a C deletion at position 2348, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0082] After editing at a specific key site, the target gene ZmGA20ox3 deleted base C at position 2440-2442 and inserted base A, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at a specific key site, the target gene ZmGA20ox5 deleted base C at position 2348, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0083] The present invention provides application of the above method in transgenic corn plants with different plant heights and other agronomic traits.

[0084] In some embodiments, the application includes any one of the following applications:

[0085] 1) Create dwarf corn;

[0086] 2) Reduce the height of corn ears;

[0087] 3) Reduce the leaf angle of corn plants;

[0088] 4) Increase corn production.

[0089] Compared with the prior art, the present invention has the following beneficial effects:

[0090] The present invention utilizes genetic engineering methods to edit specific key sites in the target genes ZmGA20ox3 and / or ZmGA20ox5 in corn. The proteins encoded by the target genes ZmGA20ox3 and / or ZmGA20ox5 after editing the specific key sites undergo specific amino acid site mutations, and further cultivation and screening are performed to obtain corn dwarfing materials. The method provided by the present invention can be used to cultivate transgenic corn plants with different plant heights and other agronomic traits, and at the same time provides a new breeding technology solution for creating dwarf corn, reducing corn ear height, reducing the angle between corn plant leaves, and increasing corn yield. In agriculture, the corn dwarfing materials created by the method provided by the present invention can enable more dense planting of crops, thereby increasing the yield per unit area of ​​crops, which is of great significance to corn breeding work. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] Figure 1 It is a bar graph of plant height of conventional material (CK) and each homozygous mutant material of the present invention; A represents the bar graph of plant height of conventional material (CK) and homozygous mutant material obtained by LP216 gene editing vector, and B represents the bar graph of plant height of conventional material (CK) and homozygous mutant material obtained by LP217 gene editing vector.

[0092] Figure 2 It is a bar graph of the plant ear height of the conventional material (CK) of the present invention and each homozygous mutant material; A represents the bar graph of the plant ear height of the conventional material (CK) and the homozygous mutant material obtained by the LP216 gene editing vector, and B represents the bar graph of the plant ear height of the conventional material (CK) and the homozygous mutant material obtained by the LP217 gene editing vector.

[0093] Figure 3 These are the comparison results of plant height between conventional material (CK) and homozygous editing material of the present invention and their average plant height and average ear height bar graphs; A represents the comparison graph of plant height between conventional material (CK) and homozygous editing material 1, B represents the comparison graph of plant height between conventional material (CK) and homozygous editing material 2, and C represents the bar graph of average plant height and average ear height between conventional material (CK) and homozygous editing material (KO).

[0094] Figure 4 The figures are a comparison of the plant heights of the hybrid control material (CK) and the hybrid editing material (KO) of the present invention, and a bar graph showing their average plant height and average ear height; A represents a comparison of the plant heights of the hybrid control material (CK) and the hybrid editing material (KO), and B represents a bar graph showing the average plant height and average ear height of the hybrid control material (CK) and the hybrid editing material (KO).

[0095] Figure 5The figures are the comparison results of the plant leaf angles of the conventional material and the homozygous mutant material of the present invention; A represents the conventional material, and B represents the homozygous mutant material.

[0096] Figure 6 It is a bar graph showing the planting empty stem rate of the conventional material (CK) of the present invention and the homozygous mutant materials LP216-3-5-2 and LP217-31-10. DETAILED DESCRIPTION

[0097] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0098] Example 1 Design based on gene editing sites

[0099] The embodiments of the present invention use CRISPR / Cas9 gene editing technology to complete the gene editing process. Currently known gene editing technologies can also complete the gene editing process of the present invention (such as CRISPR / Cas9 gene editing technology, etc.), thereby obtaining the same gene editing products as those of the present invention.

[0100] The map of the CasD gene editing vector has been disclosed in the invention patent (CN116286742B). The gene editing vectors LP216 and LP217 used in the present invention are based on the above-mentioned CasD gene editing vector by modifying the specific gRNA sequence and renaming them respectively.

[0101] Two target sites were designed for the maize target genes ZmGA20ox3 and ZmGA20ox5 using the CRISPR-P platform (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The maize target genes ZmGA20ox3 and ZmGA20ox5 and related information were downloaded from MaizeGDB (https: / / www.maizegdb.org / ). The nucleotide sequence of the target gene ZmGA20ox3 is shown in SEQ ID NO:13, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:14. The nucleotide sequence of the target gene ZmGA20ox5 is shown in SEQ ID NO:15, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:16.

[0102] Upload the exon sequence of the target gene to the CRISPR-P website, select the maize genome as the reference genome, and obtain potential editing sites near the 5'-TNN. Design two gRNA sequences for each target gene based on the target site, and locate them in the first exon of the gene. This allows the subsequent steps to concatenate the two gRNA sequences of different target genes (located in different expression cassettes) into the same gene editing vector. Two gRNA sequences were designed for the target gene ZmGA20ox3 based on the gene editing vectors LP216 and LP217. The gRNA sequences are:

[0103] LP216-OX3-gRNA:cccaactcccagcattgacctcc (SEQ ID NO: 1);

[0104] LP217-OX3-gRNA: cgccgcggcagtacccggacttc (sequence SEQ ID NO: 2);

[0105] The target gene ZmGA20ox5 was also designed with two gRNA sequences based on the gene editing vectors LP216 and LP217. The gRNA sequences are:

[0106] LP216-OX5-gRNA: cgaccggttcgcggccaagctcc (SEQ ID NO: 3);

[0107] LP217-OX5-gRNA: cgccgcggcgctacccggacttc (sequence SEQ ID NO: 4).

[0108] Example 2 Construction of tandem gene editing vector

[0109] The LP216-OX3-gRNA and LP216-OX5-gRNA target sites were incorporated into the gene sequence of the CasD protein used in the gene editing system of the present invention and the corresponding gene editing vector LP216 to obtain a tandem gene editing vector. The LP217-OX3-gRNA and LP217-OX5-gRNA target sites were then incorporated into the gene sequence of the CasD protein used in the gene editing system of the present invention and the corresponding gene editing vector LP217 to obtain another tandem gene editing vector.

[0110] The synthesized tandem gene editing vectors (DNA molecules) were cloned into plant expression vectors to generate the recombinant expression vectors pCasD-ZmGA20ox3 and pCasD-ZmGA20ox5. The two recombinant expression vectors were then transformed into Escherichia coli T1 competent cells (Transgen, Beijing, China; Cat. No. CD501) using the heat shock method. The transformation process involved mixing 50 μl of transformed E. coli T1 competent cells with 10 μl of plasmid DNA (recombinant cloning vectors LP10-T and LP11-T), incubating at 42°C for 30 seconds and then at 37°C for 45 minutes. After transformation, the cells were shaken at 200 rpm for 1 hour before being plated on LB plates (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, pH adjusted to 7.5 with NaOH) and grown overnight. White colonies were picked and cultured in LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 100 mg / L ampicillin, pH adjusted to 7.5 with NaOH) on a shaker at 37°C overnight. The plasmid was extracted using the alkaline method. The specific steps were as follows: centrifuge the bacterial solution at 12000 rpm for 1 min, discard the supernatant, suspend the precipitated bacteria in 100 μl of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH adjusted to 8.0); add 150 μl of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the centrifuge tube upside down 4 times to mix, and place on ice for 3-5 min; add 150 μl of ice-cold solution III (4 M potassium acetate, 2 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 12000 rpm for 5 min at 4°C, add 2 volumes of anhydrous ethanol to the supernatant, mix well, and place at room temperature for 5 min; centrifuge at 12000 rpm for 5 min at 4°C, discard the supernatant, precipitate, wash with 70% ethanol by mass concentration, and dry; add 30 The precipitate was dissolved in TE (10 mM Tris-HCl, 1 mM EDTA, pH adjusted to 8.0) containing RNase (20 μg / ml); the RNA was digested in a water bath at 37°C for 30 min; and the RNA was stored in a -20°C refrigerator for later use.

[0111] Example 3 Transformation of Agrobacterium with Recombinant Expression Vector and Detection

[0112] (1) Transformation of Agrobacterium with recombinant expression vector

[0113] The correctly constructed recombinant expression vectors pCasD-ZmGA20ox3 and pCasD-ZmGA20ox5 were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using the liquid nitrogen method. The transformation conditions were as follows: 100 μl of Agrobacterium LBA4404 and 3 μl of plasmid DNA (recombinant expression vector) were frozen in liquid nitrogen for 10 min and then incubated in a 37°C water bath for 10 min; the transformed Agrobacterium LBA4404 was inoculated into a centrifuge tube containing LB liquid culture medium and cultured on a shaker at 28°C and 200 rpm for 2 h, then spread on LB solid culture medium containing 50 mg / L rifampicin and 50 mg / L kanamycin until a positive single colony grew. The single colony was picked and cultured for 4-6 h for PCR detection. Positive clones were further expanded and cultured with 10 μL of bacterial solution in 10 mL of liquid LB (kanamycin 100 mg / L, gentamicin 50 mg / L, rifampicin 50 mg / L). Culture was continued at 28°C and 220 rpm overnight. The cells were centrifuged at 5000 rpm and resuspended in 10 mM MgCl to an OD of approximately 0.6-0.8. The cells were induced in the dark for 3 h with 10 mM MES and 200 μM AS for genetic transformation.

[0114] The specific steps of conversion are as follows:

[0115] 1. Preparation of Maize Embryos

[0116] The company's in-house homozygous inbred corn line AX808 was planted in the field or greenhouse, and the corn was used as the source of immature embryos 8-10 days (in summer) or 10-13 days (in autumn) after artificial pollination.

[0117] 2. Preparation of Agrobacterium

[0118] (1) Take the transformed and identified glycerol Agrobacterium and streak it on YEP solid medium containing 100 mg / L kan and 12 mg / L tet and culture it in the dark at 28°C for 2-3 days;

[0119] (2) Add 1 ml of infection medium to a sterilized 2 ml centrifuge tube, place the Agrobacterium from step 1 into the infection medium, and mix thoroughly by pipetting.

[0120] (3) Take another sterilized 2 ml centrifuge tube and adjust the bacterial concentration with infection medium so that the OD660 reaches 0.5-0.7.

[0121] 3. Co-cultivation of Maize Embryos with Agrobacterium

[0122] (1) Remove the infection medium from the centrifuge tube containing the embryos and add 1.5 mL of fresh infection medium to wash the embryos once;

[0123] (2) Remove the infection medium and add the prepared Agrobacterium solution;

[0124] (3) Place on a shaker at maximum speed for 30 seconds and then place at room temperature for 5 minutes;

[0125] (4) Pour the embryo onto the co-culture medium and drain the liquid;

[0126] (5) Place the embryo with the flat surface facing up and the shield facing down;

[0127] (6) Place the embryos in a dark incubator at 22°C for 2-3 days.

[0128] 4. Callus Induction and Screening

[0129] (1) After co-culture, the embryos were transferred to callus induction medium and cultured in a dark incubator at 28°C for 7-10 days;

[0130] (2) The induced calli were transferred to screening medium for screening culture at a screening pressure of 5.0 mM glyphosate and cultured in the dark at 28°C for 2-3 weeks;

[0131] (3) The calli that survived the first screening were selected for the second screening at a screening pressure of 2.0 mM glyphosate.

[0132] 5. Regeneration and Cultivation of Transformed Strains

[0133] (1) Place the embryonic calli grown after screening on a predifferentiation medium and culture in the dark at 28°C for 10-14 days;

[0134] (2) Take the embryonic callus and place it on differentiation medium. Culture it in the light at 28°C for 10-14 days until the seedlings differentiate.

[0135] (3) The differentiated seedlings were transferred to rooting medium and cultured in the light at 28°C until the roots were fully developed;

[0136] (4) Transplant the well-growing seedlings into a greenhouse substrate for growth. Harvest the transgenic plants after they have flowered and set fruit. Sow the harvested seeds in the greenhouse and perform expression analysis using PCR when the plants reach the 4-6 leaf stage.

[0137] (2) Detection of edited transgenic corn plants

[0138] The editing status of ZmGA20ox3 and ZmGA20ox5 maize plants was verified using standard PCR using the Quanshijin EasyTag PCR SuperMix (Beijing, China, Cat: AS111-11). Samples with bands matching the target fragment size were sequenced. Eleven edited lines were screened using the LP216 vector, and nine edited lines were screened using the LP217 vector. PCR reaction conditions were: 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 40 seconds, for 30 cycles.

[0139] The primers used for PCR detection are:

[0140] LP216-OX3-F: GTAAATTCGGCGCCATCTTCTTC (SEQ ID NO: 5)

[0141] LP216-OX3-R: CCTAAGAACGGCAAGAGCCAG (SEQ ID NO: 6)

[0142] LP216-OX5-F: ATGTAAACCGGCGCTCCTTC (SEQ ID NO: 7)

[0143] LP216-OX5-R: CATCTCATGGTGTCGCAGGAAC (SEQ ID NO: 8)

[0144] LP217-OX3-F:GGGTCGTCCAAAAATGGGGAAG (SEQ ID NO:9)

[0145] LP217-OX3-R: GCGTTTTTCTAGCCGTTTCCGC (SEQ ID NO: 10)

[0146] LP217-OX5-F: AGTAGGGCCAGCGTCAAAAA (SEQ ID NO: 11)

[0147] LP217-OX5-R: GCACCGCAACAATGAGACAG (SEQ ID NO: 12)

[0148] Example 4 Editing results and field characteristics

[0149] 1. Single-gene and double-gene editing types and plant height measurement results are as follows:

[0150]

[0151]

[0152] 2. Dual gene editing types and plant height measurement results are as follows:

[0153]

[0154]

[0155] (1) Site mutation of single gene editing type

[0156] For the target gene ZmGA20ox3, the mutations at its editing sites are as follows:

[0157] In the LP217 vector, the DNA sequence of the target gene ZmGA20ox3 lacks bases 2398-2467, and the amino acid sequence of the encoded protein changes from the 330th amino acid; its sequence lacks bases 2373-2466, and the amino acid sequence of the encoded protein changes from the 322nd amino acid; its sequence lacks bases 2378-2449, and the amino acid sequence of the encoded protein is deleted from the 323rd to 346th amino acids; its sequence lacks bases 2405-2450 and inserts 8bp, and the amino acid sequence of the encoded protein changes from the 332nd amino acid sequence; its sequence lacks bases 2407-2449, and the amino acid sequence of the encoded protein changes from the 333rd amino acid sequence; its sequence has base GA inserted at base 2440, and the amino acid sequence of the encoded protein changes from the 344th amino acid sequence;

[0158] In the LP216 vector, the DNA sequence of the target gene ZmGA20ox3 lacks bases 131-542, and the amino acid sequence of the encoded protein changes from the 18th amino acid sequence; its sequence lacks bases 126-542, and the amino acid sequence of the encoded protein changes from the 15th-153rd amino acid sequence; its sequence lacks bases 129-132, and the amino acid sequence of the encoded protein changes from the 16th amino acid sequence; its sequence lacks bases 106-129 and inserts 52bp, and the amino acid sequence of the encoded protein changes from the 8th amino acid sequence; its sequence lacks bases 124-131, and the amino acid sequence of the encoded protein changes from the 14th amino acid sequence; its sequence lacks base T at position 128, and the amino acid sequence of the encoded protein changes from the 17th amino acid sequence; its sequence lacks bases 118-130, and the amino acid sequence of the encoded protein changes from the 11th amino acid sequence.

[0159] For the target gene ZmGA20ox5, the mutations at its editing sites are as follows:

[0160] In the LP217 vector, the DNA sequence of the target gene ZmGA20ox3 lacks base C at position 2348, and the amino acid sequence of the encoded protein changes from the amino acid sequence at position 419; its sequence lacks bases 2309-2350, and the amino acid sequence of the encoded protein changes from the amino acid sequence at position 408; its sequence lacks base G at position 2350, and the amino acid sequence of the encoded protein changes from the amino acid sequence at position 420.

[0161] In the LP216 vector, the DNA sequence of the target gene ZmGA20ox3 lacks the 684th position and inserts base G, and the amino acid sequence of the encoded protein changes from the 225th amino acid sequence; its sequence lacks the 682nd position and inserts base T, and the amino acid sequence of the encoded protein changes from the 224th amino acid sequence; its sequence lacks bases 622-686, and the amino acid sequence of the encoded protein is deleted from the 220th to 225th amino acid sequences.

[0162] (2) Site mutations of dual gene editing

[0163] For the tandem gene editing vector derived from the gene editing vector LP216:

[0164] After editing at specific key sites, the target gene ZmGA20ox3 had bases 131-542 deleted, and the amino acid sequence of the encoded protein changed from the 18th amino acid. After editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at the 684th base, and the amino acid sequence of the encoded protein changed from the 225th amino acid.

[0165] After editing at specific key sites, the target gene ZmGA20ox3 had bases 126-542 deleted, and the amino acid sequence of the encoded protein changed from amino acids 15-153. After editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at base 684, and the amino acid sequence of the encoded protein changed from amino acid 225.

[0166] After editing at specific key sites, the target gene ZmGA20ox3 had bases 129-132 deleted, and the amino acid sequence of the encoded protein changed from the 16th amino acid. After editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at the 684th base, and the amino acid sequence of the encoded protein changed from the 225th amino acid.

[0167] After editing at specific key sites, the target gene ZmGA20ox3 had bases 106-129 deleted and 52 bp inserted, and the amino acid sequence of the encoded protein changed from the 8th amino acid. After editing at specific key sites, the target gene ZmGA20ox5 had base T inserted at the 682nd base, and the amino acid sequence of the encoded protein changed from the 224th amino acid.

[0168] After editing at a specific key site, the target gene ZmGA20ox3 had a TC inserted at base 129, and the amino acid sequence of the encoded protein changed from the 16th amino acid. After editing at a specific key site, the target gene ZmGA20ox5 had a T inserted at base 682, and the amino acid sequence of the encoded protein changed from the 224th amino acid.

[0169] After editing the target gene ZmGA20ox3 at specific key sites, bases 124-131 were deleted, and the amino acid sequence of the encoded protein changed from the 14th amino acid. After editing the target gene ZmGA20ox5 at specific key sites, bases 656-718 were deleted, and amino acids 215-235 of the amino acid sequence of the encoded protein were deleted.

[0170] After editing the target gene ZmGA20ox3 at specific key sites, bases 96-134 were deleted, and amino acids 4-16 were deleted in the amino acid sequence of the encoded protein; after editing the target gene ZmGA20ox5 at specific key sites, bases 656-718 were deleted, and amino acids 215-235 were deleted in the amino acid sequence of the encoded protein;

[0171] After editing at a specific key site, the target gene ZmGA20ox3 had a TC insertion at base 129, and the amino acid sequence of the encoded protein changed from amino acid 16; after editing at a specific key site, the target gene ZmGA20ox5 had a deletion at bases 656-686, and the amino acid sequence of the encoded protein changed from amino acid 215;

[0172] After editing at specific key sites, the target gene ZmGA20ox3 had bases 129-134 deleted, and the amino acids 16-17 of the amino acid sequence of the encoded protein were deleted; after editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at base 684, and the amino acid sequence of the encoded protein changed from amino acid 225;

[0173] After editing the target gene ZmGA20ox3 at a specific key site, the T base at position 128 was deleted, and the amino acid sequence of the encoded protein changed from the 17th amino acid. After editing the target gene ZmGA20ox5 at a specific key site, the bases 622-686 were deleted, and the amino acid sequence of the encoded protein was deleted from positions 220-225.

[0174] After editing at specific key sites, the target gene ZmGA20ox3 had bases 126-132 deleted, and the amino acid sequence of the encoded protein changed from the 14th amino acid. After editing at specific key sites, the target gene ZmGA20ox5 had a T inserted at the 682nd base, and the amino acid sequence of the encoded protein changed from the 224th amino acid.

[0175] After editing at specific key sites, the target gene ZmGA20ox3 had bases 118-130 deleted, and the amino acid sequence of the encoded protein changed from the 11th amino acid; after editing at specific key sites, the target gene ZmGA20ox5 had base G inserted at the 684th base, and the amino acid sequence of the encoded protein changed from the 225th amino acid.

[0176] (2) For the tandem gene editing vector derived from the gene editing vector LP217:

[0177] After editing at specific key sites, the target gene ZmGA20ox3 had bases 2398-2467 deleted, and the amino acid sequence of the encoded protein changed from amino acid 330. After editing at specific key sites, the target gene ZmGA20ox5 had base C deleted at position 2348, and the amino acid sequence of the encoded protein changed from amino acid 419.

[0178] After editing at specific key sites, the target gene ZmGA20ox3 had bases 2373-2466 deleted, and the amino acid sequence of the encoded protein changed from amino acid 322; after editing at specific key sites, the target gene ZmGA20ox5 had bases 2309-2350 deleted, and the amino acid sequence of the encoded protein changed from amino acid 408;

[0179] After editing at specific key sites, the target gene ZmGA20ox3 had bases 2378-2449 deleted, and the amino acid sequence of the encoded protein had amino acids 323-346 deleted. After editing at specific key sites, the target gene ZmGA20ox5 had base C deleted at position 2348, and the amino acid sequence of the encoded protein changed from amino acid 419.

[0180] After editing at specific key sites, the target gene ZmGA20ox3 had a deletion of bases 2405-2450 and an insertion of 8bp, and the amino acid sequence of the encoded protein changed from amino acid position 332. After editing at specific key sites, the target gene ZmGA20ox5 had a deletion of base C at position 2348, and the amino acid sequence of the encoded protein changed from amino acid position 419.

[0181] After editing at specific key sites, the target gene ZmGA20ox3 deleted bases 2407-2449, and the amino acid sequence of the encoded protein changed from amino acid 333; after editing at specific key sites, the target gene ZmGA20ox5 deleted base C at position 2348, and the amino acid sequence of the encoded protein changed from amino acid 419.

[0182] After editing at a specific key site, the target gene ZmGA20ox3 has a C base deletion at position 2440, and the amino acid sequence of the encoded protein changes from amino acid position 343; after editing at a specific key site, the target gene ZmGA20ox5 has a base deletion at positions 2348-2350, and the amino acid sequence of the encoded protein is deleted from amino acid position 419.

[0183] After editing at a specific key site, the target gene ZmGA20ox3 deleted the C base at position 2440, and the amino acid sequence of the encoded protein changed from the 343rd amino acid; after editing at a specific key site, the target gene ZmGA20ox5 deleted the G base at position 2350, and the amino acid sequence of the encoded protein changed from the 420th amino acid.

[0184] After editing at a specific key site, the target gene ZmGA20ox3 has a C base deletion at position 2440, and the amino acid sequence of the encoded protein changes from amino acid position 343; after editing at a specific key site, the target gene ZmGA20ox5 has a base deletion at positions 2348-2393, and the amino acid sequence of the encoded protein changes from amino acid position 416.

[0185] After editing at a specific key site, the target gene ZmGA20ox3 had a GA insertion at position 2440, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at a specific key site, the target gene ZmGA20ox5 had a C deletion at position 2348, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0186] After editing at a specific key site, the target gene ZmGA20ox3 deleted the base CA at position 2440-2441, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at a specific key site, the target gene ZmGA20ox5 inserted the base GA at position 2348, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0187] After editing at specific key sites, the target gene ZmGA20ox3 deleted the base CA at positions 2440-2441, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at specific key sites, the target gene ZmGA20ox5 deleted the bases 2349-2350, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0188] After editing at a specific key site, the target gene ZmGA20ox3 deleted base C at position 2440, and the amino acid sequence of the encoded protein changed from amino acid position 344; after editing at a specific key site, the target gene ZmGA20ox5 inserted base T at position 2348, and the amino acid sequence of the encoded protein changed from amino acid position 419.

[0189] After editing at a specific key site, the target gene ZmGA20ox3 deleted base C at position 2440, and the amino acid sequence of the encoded protein changed from amino acid position 344; after editing at a specific key site, the target gene ZmGA20ox5 deleted base C at position 2348, and the amino acid sequence of the encoded protein changed from amino acid position 419.

[0190] After editing at specific key sites, the target gene ZmGA20ox3 deleted the base CA at positions 2440-2441, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at specific key sites, the target gene ZmGA20ox5 deleted the base GC at positions 2349-2350, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0191] After editing at a specific key site, the target gene ZmGA20ox3 had a C base inserted at position 2440, and the amino acid sequence of the encoded protein changed from amino acid position 344; after editing at a specific key site, the target gene ZmGA20ox5 had a GC base deleted at positions 2349-2350, and the amino acid sequence of the encoded protein changed from amino acid position 419.

[0192] After editing at a specific key site, the target gene ZmGA20ox3 had a GA insertion at position 2440, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at a specific key site, the target gene ZmGA20ox5 had a C deletion at position 2348, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0193] After editing at a specific key site, the target gene ZmGA20ox3 deleted base C at position 2440-2442 and inserted base A, and the amino acid sequence of the encoded protein changed from the 344th amino acid; after editing at a specific key site, the target gene ZmGA20ox5 deleted base C at position 2348, and the amino acid sequence of the encoded protein changed from the 419th amino acid.

[0194] 2. Field performance of plants

[0195] Compared with conventional materials, the results of field plant height traits showed that the average plant height of the homozygous inbred lines decreased by 38.8%. The plant height bar graphs of the conventional material (CK) of the present invention and the homozygous mutant materials are as follows: Figure 1 (A and B) As shown. In other field traits, the ear height of each homozygous mutant material was also significantly reduced. The bar graphs of the ear height of the conventional material (CK) and each homozygous mutant material are shown in Figure 2 (A and B) The comparison results of plant height between conventional material (CK) and homozygous edited material of the present invention and their average plant height and average ear height are shown in the bar graph. Figure 3 (A, B and C) shown.

[0196] In different genetic backgrounds, the average plant height and average ear height of the hybrid editing materials were also significantly reduced. The comparison results of the hybrid control material (CK) and the hybrid editing material (KO) of the present invention and their average plant height and ear height bar graphs are shown in FIG. Figure 4 (A and B) further illustrate that the mutations caused by the ZmGA20ox3 and ZmGA20ox5 technologies of the present invention have the same effect of reducing maize plant height under different genome / variety backgrounds.

[0197] On the other hand, we also found that compared with the conventional materials, the homozygous mutant materials all showed smaller leaf angles. The comparison results of the leaf angles of the conventional materials (A) and the homozygous mutant materials (B) are shown in the figure below. Figure 5 (A and B) Upright leaves enable densely planted crops to reduce mutual shading and capture more light. The significance of reduced leaf angle and plant height for agricultural applications lies in enabling denser crop planting and increasing yield per unit area.

[0198] The present invention has a row length of 5 meters, 4 rows, 3 replicates, and a planting density of 6000 plants / mu and 7000 plants / mu respectively. The planting results show that the empty stem rate of high-density planting is much lower than that of the control, and is improved compared with conventional materials. The bar graph of the empty stem rate of the conventional material (CK) of the present invention and the homozygous mutant materials LP216-3-5-2 and LP217-31-10 is shown in the figure below. Figure 6 shown.

[0199] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for creating corn dwarfing material, characterized in that: CRISPR / Cas9 gene editing technology is used to edit specific key sites of the target genes ZmGA20ox3 and ZmGA20ox5 in maize. After the editing of the specific key sites, the proteins encoded by the target genes ZmGA20ox3 and ZmGA20ox5 undergo specific amino acid site mutations. Further cultivation and screening are performed to obtain dwarf maize materials. The nucleotide sequence of the target gene ZmGA20ox3 is shown in SEQ ID NO: 13, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO:

14. The nucleotide sequence of the target gene ZmGA20ox5 is shown in SEQ ID NO: 15, and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO:

16. The specific key site and amino acid site mutations involve any of the following situations: 1) After editing at specific key sites, the target gene ZmGA20ox3 had bases 131-542 deleted, and the amino acid sequence of the encoded protein changed from amino acid 18; after editing at specific key sites, the target gene ZmGA20ox5 had a G inserted at base 684, and the amino acid sequence of the encoded protein changed from amino acid 225; 2) After editing at a specific key site, the target gene ZmGA20ox3 had a GA insertion at position 2440, and the amino acid sequence of the encoded protein changed from amino acid position 344. After editing at a specific key site, the target gene ZmGA20ox5 had a C deletion at position 2348, and the amino acid sequence of the encoded protein changed from amino acid position 419. The specific steps of the method are as follows: 1) Target sites were designed for the maize target genes ZmGA20ox3 and ZmGA20ox5, and the gRNA sequences designed based on the target sites were serially connected to the corresponding gene editing vectors carrying the CasD protein-encoding gene to obtain tandem gene editing vectors; for the maize target gene ZmGA20ox3, the gRNA sequence was: LP216-OX3-gRNA:cccaactcccagcattgacctcc; LP217-OX3- gRNA:cgccgcggcagtacccggacttc; For the target gene ZmGA20ox5 in maize, the gRNA sequence is: LP216-OX5-gRNA: cgaccggttcgcggccaagctcc; LP217-OX5-gRNA: cgccgcggcgctacccggacttc; 2) Connecting the tandem gene editing vector described in step 1) into a plant expression vector through a cloning reaction to obtain a recombinant expression vector; 3) The recombinant expression vector described in step 2) is transferred into Agrobacterium for genetic transformation of corn, thereby achieving editing of specific key sites of the target genes ZmGA20ox3 and ZmGA20ox5 in corn and mutation of specific amino acid sites of the proteins encoded by the target genes ZmGA20ox3 and ZmGA20ox5 after the editing of the specific key sites, and obtaining corn dwarf materials through cultivation and screening.

2. The method for creating corn dwarfing material according to claim 1, characterized in that: The gene editing vectors in step 1) are LP216 and LP217.

3. Use of the method for creating corn dwarf material according to any one of claims 1 or 2 in creating dwarf corn.

4. Use of the method for creating corn dwarfing materials according to any one of claims 1 or 2 in reducing corn ear height.

5. Use of the method for creating corn dwarfing material according to any one of claims 1 or 2 in reducing the leaf angle of corn plants.

6. Use of the method for creating corn dwarfing materials according to any one of claims 1 or 2 in increasing corn yield.

Images