Preparation method and application of COL3A1 protein

Abstract

The invention provides a preparation method and application of COL3A1 protein, and relates to the technical field of biology. The preparation method comprises the following steps: expressing COL3A1 protein by using HEK-293T cells, and taking FBLN1 protein signal peptide as the signal peptide of the COL3A1 protein. According to the preparation method, HEK-293T cells can secrete and express the COL3A1 protein with high yield and high biological activity, and the application of the COL3A1 protein in the aspects of tissue regeneration, wound healing and the like is facilitated.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method and application of COL3A1 protein. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] The COL3A1 protein, also known as type III collagen α1 peptide chain (CoL3A1), is encoded by the COL3A1 gene. Type III collagen is a fibrous collagen protein composed of three type III collagen α1 peptide chains arranged in a triple helical structure. Type III collagen has a stable Gly-XY (glycine-proline-hydroxyproline) triple helical conformation and is widely distributed in soft connective tissues such as the skin, blood vessels, and internal organs. Together with type I collagen, it maintains tissue elasticity and mechanical strength, playing a key role in maintaining tissue structure and function. As the primary collagen component of the extracellular matrix, type III collagen has numerous biological functions, including maintaining tissue elasticity and flexibility, promoting cell migration and adhesion, and regulating wound repair. It has a wide range of applications in regenerative medicine, gene therapy, biomaterials, and cosmetic skincare.

[0004] In recent years, Escherichia coli, yeast, plant, and mammalian cell expression systems have all been used to express recombinant collagen, but these systems still face numerous technical challenges. While recombinant expression of COL3A1 in E. coli or Pichia pastoris is cost-effective and produces high yields, the expressed COL3A1 is insufficiently hydroxylated, requiring exogenous addition of P4H or chemical modification. The lack of a triple helical structure makes it susceptible to enzymatic degradation and potentially contains endotoxins. Therefore, recombinant expression of COL3A1 in E. coli or Pichia pastoris is limited to scientific research and in vitro experiments. Collagen expression in plant cells also results in limited expression levels and presents significant challenges in extraction and purification.

[0005] The recombinant human COL3A1 protein expressed in mammalian cells such as HEK-293T and CHO is closest to natural human type III collagen, has complete hydroxylation modification, no risk of animal pathogens, has higher biological activity, and can be used for therapeutic research. However, its expression level is low, and purification steps such as affinity chromatography and ion exchange are required, which greatly increases production costs.

[0006] Therefore, developing a method for preparing recombinant human type III collagen COL3A1 with high efficiency, high activity, low immunogenicity and low cost, and expanding its application in the biomedical field, has important market prospects.

[0007] In view of this, the present invention is proposed. Summary of the Invention

[0008] The object of the present invention is to provide a method for preparing COL3A1 protein, so as to alleviate the problem of low efficiency of expressing COL3A1 protein using mammalian cells in the prior art.

[0009] In order to solve the above technical problems, the present invention adopts the following technical solutions: In a first aspect, a method for preparing a COL3A1 protein is provided. The method comprises expressing the COL3A1 protein using HEK-293T cells and using an FBLN1 protein signal peptide as a signal peptide of the COL3A1 protein.

[0010] In a second aspect, a polynucleotide is provided, wherein the polynucleotide sequentially comprises, from the 5' end to the 3' end, a sequence encoding a signal peptide of the FBLN1 protein and a sequence encoding a COL3A1 protein.

[0011] In a third aspect, a vector is provided, wherein the vector carries the polynucleotide described in the second aspect.

[0012] In a fourth aspect, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide of the second aspect, or contains the vector of the third aspect.

[0013] In a fifth aspect, a method for preparing the COL3A1 protein described in the first aspect, or the COL3A1 protein prepared by the method of the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cell described in the fourth aspect, for use in any one of (i) to (iii) is provided: (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) Use in the preparation of products for tissue regeneration or wound healing.

[0014] In a sixth aspect, provided is a method for preparing the COL3A1 protein of the first aspect, or use of the COL3A1 protein prepared by the method of the first aspect, or the polynucleotide of the second aspect, or the vector of the third aspect, or the recombinant HEK-293T cells of the fourth aspect in preparing regenerative medicine products, gene therapy products, biomaterials, or cosmetic products.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses HEK-293T cells to express the COL3A1 protein and replaces the traditional signal peptide with the FBLN1 protein signal peptide, thereby successfully achieving high-yield and highly bioactive COL3A1 protein production. Experiments have confirmed a synergistic effect between the FBLN1 protein signal peptide and HEK-293T cells, significantly enhancing the secretory expression efficiency of the COL3A1 protein in this cell line. However, the FBLN1 protein signal peptide fails to achieve this promoting effect in CHO cells, suggesting a synergistic effect between the host cells and the signal peptide. Furthermore, the COL3A1 protein produced by the present invention exhibits excellent bioactivity, as demonstrated by experiments to effectively promote fibroblast proliferation, adhesion, and migration. Based on these excellent properties, this preparation method has significant application potential and broad market prospects in a variety of fields, including tissue regeneration, wound healing, regenerative medicine product development, gene therapy product development, biomaterial preparation, and cosmetic product production. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] Figure 1 The plasmid map of the expression plasmid constructed in Example 1; Figure 2 The results of immunoblotting in Example 3 are as follows: Figure 3 The results of immunoblotting in Example 4 are as follows: Figure 4 is the relative adhesion rate of the negative control and the fibroblasts after being coated with COL3A1 protein in Example 5; Figure 5 is the relative proliferation rate of fibroblasts treated with various concentrations of COL3A1 protein in Example 6; Figure 6 These are photos of fibroblasts at 0 h, 6 h, and 24 h in the cell scratch experiment in Example 7. DETAILED DESCRIPTION

[0018] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0019] As used herein, "and / or" is used to indicate that either or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0020] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or action from another entity or action, and does not necessarily require or imply any actual relationship, order, or importance between these entities or actions, such as numbering first, second, etc.

[0021] As used herein, unless otherwise stated, "optionally," "optional," "optional," or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0022] Herein, the terms "comprise" or "comprising" are intended to imply the inclusion of stated elements, integers or steps, but not the exclusion of any other elements, integers or steps.

[0023] As used herein, the term "COL3A1 protein" refers to the type III collagen α1 peptide chain (CoL3A1), which is encoded by the COL3A1 gene. COL3A1 protein may also refer to a polymer composed of COL3A1 protein, for example, when COL3A1 protein forms a trimer, it is type III collagen.

[0024] In this article, peptides, polypeptides, and proteins are not strictly distinguished and can be used interchangeably in some cases. They generally refer to polymers composed of amino acids connected by peptide bonds, whether naturally occurring or synthetic.

[0025] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. When a polynucleotide encodes a protein or polypeptide, the encoding may optionally encode a sense strand or an antisense strand. A polynucleotide may be naturally occurring, synthetic, recombinant, or any combination thereof. "Nucleic acid molecule," "nucleic acid," and "polynucleotide" may be used interchangeably. In an optional embodiment, the polynucleotide is DNA.

[0026] As used herein, the term "vector" refers to a vehicle into which a genetic element (e.g., the aforementioned polynucleotide) can be operatively inserted and used to express the genetic element, for example, to produce the protein, RNA, or DNA encoded by the genetic element, or to replicate the genetic element. Vectors can be used to transform, transduce, or transfect host cells, enabling expression of the genetic element carried by the vector within the host cell. For example, vectors include plasmids, episomal plasmids, minicircle DNA, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs), bacteriophages such as lambda phage or M13 phage, and animal viruses. Vectors may contain a variety of elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Vectors may also contain a replication initiation site. Vectors may also include components that facilitate entry into cells, including, but not limited to, viral particles, liposomes, or protein coats. Vectors may be expression vectors or cloning vectors. The vector may also include a selectable marker, such as, but not limited to, a resistance gene and / or a fluorescent protein gene.

[0027] In a first aspect, a method for preparing a COL3A1 protein is provided. The method comprises expressing the COL3A1 protein using HEK-293T cells and using an FBLN1 protein signal peptide as a signal peptide of the COL3A1 protein.

[0028] The FBLN1 protein in this article refers to fibulin-1, an extracellular matrix protein encoded by the FBLN1 gene. FBLN1 is a secreted glycoprotein that maintains extracellular matrix stability and is involved in regulating cell morphology, migration, and interaction with the ECM. FBLN1 is primarily localized in organ basement membranes, elastic fibers, and other connective tissue structures. With a molecular weight of approximately 90 kDa, FBLN1 is composed of a typical "fibulin-type" module at the C-terminus, an anaphylatoxin domain at the N-terminus, and a calcium-binding epidermal growth factor-like domain connecting the two, participating in a variety of biological processes.

[0029] HEK-293T cells (Human Embryonic Kidney 293T cells) are derived from human embryonic kidney cells and are often used as host cells for exogenous expression of target proteins. They have the advantages of stable and high in vitro proliferation capacity and high transfection efficiency. The present invention discovered that using the FBLN1 protein signal peptide as the signal peptide for the COL3A1 protein can significantly improve the expression of the COL3A1 protein in HEK-293T cells.

[0030] In an optional embodiment, the original signal peptide of the COL3A1 protein is replaced by the FBLN1 protein signal peptide. It is understood that the FBLN1 protein signal peptide is located at the N-terminus of the COL3A1 protein.

[0031] In an alternative embodiment, the COL3A1 protein is secreted and expressed in HEK-293T cells.

[0032] In an optional embodiment, the preparation method further comprises forming type III collagen by secreting and expressing COL3A1 protein in HEK-293T cells.

[0033] In an optional embodiment, the amino acid sequence of the FBLN1 protein signal peptide is shown as SEQ ID NO.1.

[0034] SEQ ID NO. 1: MERAAPSRRVPPLPLLLLGGLALLAAGVDA.

[0035] In an optional embodiment, the nucleotide sequence encoding the FBLN1 protein signal peptide is shown as SEQ ID NO.2.

[0036] SEQ ID NO.2: atggagcgcgccgcgccgtcgcgccgggtcccgcttccgctgctgctgctcggcggccttgcgctgctggcggccggagtggacgcg.

[0037] In an optional embodiment, the preparation method comprises allowing HEK-293T cells to express a polynucleotide, wherein the polynucleotide sequentially comprises, from the 5' end to the 3' end, a sequence encoding a signal peptide of the FBLN1 protein and a sequence encoding a COL3A1 protein.

[0038] The sequence encoding the FBLN1 protein signal peptide and the sequence encoding the COL3A1 protein may or may not be integrated into the genome of the HEK-293T cells.

[0039] In an optional embodiment, the preparation method comprises: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and allowing the HEK-293T cells to express COL3A1 protein.

[0040] In an alternative embodiment, those skilled in the art can introduce the polynucleotide encoding the FBLN1 protein signal peptide and the polynucleotide encoding the COL3A1 protein into HEK-293T cells by any method known in the art for introducing exogenous nucleic acids into cells, such as, but not limited to, liposome transfection, cationic polymer transfection, electroporation, microinjection, gene gun, or viral vector-mediated transfection.

[0041] It is understood that those skilled in the art can culture the HEK-293T cells using any method known in the art, including any known culture medium, culture environment, culture container, and culture equipment.

[0042] In an optional embodiment, the preparation method further comprises isolating, enriching and / or purifying the COL3A1 protein expressed by recombinant HEK-293T cells.

[0043] In an optional embodiment, the COL3A1 protein carries a His tag, and the preparation method further comprises purifying the COL3A1 protein using a filler modified with nickel ions.

[0044] The COL3A1 protein produced by the preparation method described in the first aspect includes wild-type COL3A1 protein or artificially modified COL3A1 protein. Such artificially modified COL3A1 protein includes, but is not limited to, a polypeptide or protein that has undergone mutation, truncation, or fusion with other domains. The COL3A1 protein produced by the preparation method described in the first aspect can be a single chain or a multimer, which is not limited by the present invention. For example, it can form a trimer, i.e., type III collagen. Therefore, the preparation method provided in the first aspect of the present invention can also be a method for producing type III collagen.

[0045] The COL3A1 protein produced by the preparation method described in the first aspect can be derived from any species known in the art, such as mammalian COL3A1 protein, including but not limited to humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, alpacas, poultry, goats, and sheep. In an alternative embodiment, the COL3A1 protein produced by the preparation method described in the first aspect is a human COL3A1 protein. In an alternative embodiment, the protein expressed by the preparation method is the COL3A1 protein encoded by the nucleotide sequence set forth in SEQ ID NO. 7.

[0046] In a second aspect, a polynucleotide is provided, wherein the polynucleotide sequentially comprises, from the 5' end to the 3' end, a sequence encoding a signal peptide of the FBLN1 protein and a sequence encoding a COL3A1 protein.

[0047] In an optional embodiment, the amino acid sequence of the FBLN1 protein signal peptide is shown as SEQ ID NO.1.

[0048] In an optional embodiment, the polynucleotide sequence encoding the FBLN1 protein signal peptide is shown as SEQ ID NO.2.

[0049] In an optional embodiment, the nucleotide sequence encoding the COL3A1 protein is shown as SEQ ID NO.7.

[0050] In a third aspect, a vector is provided, wherein the vector carries the polynucleotide described in the second aspect.

[0051] In an optional embodiment, the vector is a plasmid.

[0052] In an optional embodiment, the vector is an expression plasmid.

[0053] In a fourth aspect, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide described in the second aspect, or contains the vector described in the third aspect.

[0054] In an optional embodiment, the polynucleotide described in the second aspect may or may not be integrated into the genome of the recombinant HEK-293T cells.

[0055] In an optional embodiment, the recombinant HEK-293T cells contain a plasmid carrying the polynucleotide described in the second aspect.

[0056] In a fifth aspect, a method for preparing the COL3A1 protein described in the first aspect, or the COL3A1 protein prepared by the method of the first aspect, or the polynucleotide described in the second aspect, or the vector described in the third aspect, or the recombinant HEK-293T cell described in the fourth aspect, for use in any one of (i) to (iii) is provided: (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) Use in the preparation of products for tissue regeneration or wound healing.

[0057] In an optional embodiment, the (i) is an application in promoting fibroblast adhesion, proliferation and / or migration in vitro.

[0058] In a sixth aspect, provided is a method for preparing the COL3A1 protein of the first aspect, or the COL3A1 protein prepared by the method for preparing the COL3A1 protein of the first aspect, or the polynucleotide of the second aspect, or the vector of the third aspect, or the recombinant HEK-293T cells of the fourth aspect, in preparing regenerative medicine products, gene therapy products, biomaterials, or cosmetic products.

[0059] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.

[0060] Example 1 1. Construct the target gene into the pCDNA3.1 gene expression vector by seamless cloning, and obtain different signal peptide-linked COL3A1 gene expression plasmids. The plasmid map is as follows Figure 1 As shown, the nucleotide sequence encoding the signal peptide is connected to the 5' end of the COL3A1 gene. The nucleotide sequence of the COL3A1 gene is shown in SEQ ID NO.7. COL3A1 is connected to a 6×His tag. The sequences of the signal peptides are: Signal peptide A (FBLN1 protein signal peptide): Amino acid sequence, SEQ ID NO.1: MERAAPSRRVPLPLLLLGGLALLAAGVDA Nucleotide sequence, SEQ ID NO.2: atggagcgcgccgcgccgtcgcgccgggtcccgcttccgctgctgctgctcggcggccttgcgctgctggcggccggagtggacgcg.

[0061] Signal peptide B (SULF1 (sulfatase 1) protein signal peptide): Amino acid sequence, SEQ ID NO.3: MKYSCCALVLAVLGTELLGSLC.

[0062] Nucleotide sequence, SEQ ID NO.4: atgaagtattcttgctgtgctctggttttggctgtcctgggcacagaattgctgggaagcctctgt.

[0063] Signal peptide C (COL3A1 signal peptide): Amino acid sequence, SEQ ID NO.5: MMSFVQKGSWLLLALLHPTIILA.

[0064] Nucleotide sequence, SEQ ID NO.6: atgatgagctttgtgcaaaaggggagctggctacttctcgctctgcttcatcccactattattttggca.

[0065] Three expression plasmids were obtained, which were respectively integrated with the encoding signal peptide and the encoding COL3A1 protein and named pA-COL3A1, pB-COL3A1 and pC-COL3A1. Figure 1 shown.

[0066] Example 2 Production and preparation of human type III collagen COL3A1 efficiently secreted and expressed by HEK-293T cells: HEK-293T cells were plated one day in advance so that their confluence reached 80% before transfection. During transfection, 20 μg of pA-COL3A1, pB-COL3A1, and pC-COL3A1 prepared in Example 1 were incubated with PEI transfection reagent to form transfection complexes. After incubation, the transfection complexes were added dropwise to the supernatant of the HEK-293T cell culture medium. After secretion by HEK-293T cells, the propeptide was cleaved to form a mature single chain, and the three single chains formed a triple helix structure with a molecular weight of 390 kDa. The supernatant of the HEK-293T cell culture medium after transfection was collected, and the COL3A1 protein corresponding to the elution peak was eluted and collected using a nickel ion affinity chromatography column to obtain recombinant human type III collagen COL3A1.

[0067] Example 3 Comparison of expression levels of COL3A1 proteins linked to different signal peptides: Following the method described in Example 2, pA-COL3A1, pB-COL3A1, and pC-COL3A1 were transfected into HEK-293T cells, and the cell culture supernatant was collected 72 hours after transfection. The expression level of COL3A1 was compared by immunoblotting. Figure 2 As shown in the figure, when the total protein loading amount per well is the same, the expression level of COL3A1 protein linked to signal peptide A is the highest among COL3A1 linked to signal peptide A, signal peptide B, and signal peptide C. Therefore, when using HEK-293T cells to express COL3A1, using signal peptide A to link COL3A1 can achieve the maximum expression level of COL3A1.

[0068] Example 4 Comparison of the expression ability of signal peptide A-linked COL3A1 protein in different mammalian cells: pA-COL3A1 was transfected into HEK-293T and CHO cells respectively, using the same transfection method as in Example 2, and the expression differences in different mammalian cells were compared. One day before transfection, HEK-293T and CHO cells were seeded into 6-well plates respectively so that their confluence reached 80% before transfection. During transfection, 2 μg of pA-COL3A1 was incubated with PEI transfection reagent to form a transfection complex. After incubation, the transfection complex was added dropwise to the culture supernatant of HEK 293T and CHO cells respectively, and the same amount of plasmid was used for transfection of both. After transfection, the culture supernatant of HEK-293T and CHO cells was collected at 72 hours, and the expression level of COL3A1 was compared by immunoblotting. The results are shown in FIG. Figure 3As shown in the figure, when the total protein loading amount per well is consistent, the expression level of the recombinant expression plasmid containing signal peptide A linked to COL3A1 in HEK 293T cells is significantly higher than that in CHO cells. Therefore, using HEK-293T cells to express the recombinant plasmid containing signal peptide A linked to COL3A1 can efficiently secrete and express human type III collagen COL3A1.

[0069] Example 5 COL3A1 promotes fibroblast adhesion: The COL3A1 protein prepared in Example 2 was dissolved in PBS to form a 1 mg / ml protein solution. For the 96-well plate for cell adhesion assay, 100 μl of COL3A1 protein solution was added to each well of the experimental group, and PBS solution was used for the negative group. The plates were coated overnight at 4°C, and then incubated with 2% denatured BSA for 1 hour. The plates were then washed 3 times with serum-free culture medium to remove excess glue for later use. Fibroblasts were digested, 5,000 cells were inoculated into each well, and a blank control with no cells but only culture medium was set up, and the plates were incubated in a 37°C incubator for 2 hours. After 2 hours, the culture medium of each well was removed, and the cells that did not adhere to the wall were gently washed 3 times with PBS. 100 μl of culture medium containing 10% CCK-8 was added, and the plates were incubated in a 37°C cell incubator for another 2 hours. The absorbance at 450 nm was detected using an enzyme reader, and the cell adhesion rate was calculated. The results are shown in the figure. Figure 4 As shown, the cell adhesion rate of the COL3A1 protein-coated plate was significantly higher than that of the PBS solution-coated plate.

[0070] Example 6 COL3A1 promotes fibroblast proliferation: The COL3A1 protein obtained in Example 2 was diluted using DMEM basal medium to the following concentration gradient: 4 μg / ml, 2 μg / ml, 1 μg / ml, 0.5 μg / ml, 0.25 μg / ml, 0.125 μg / ml, 0.0625 μg / ml, and 0 μg / ml (i.e., without COL3A1 protein). The sample group received the aforementioned diluted COL3A1, while the blank control group received DMEM basal medium. Three replicate wells were set up for each group. Fibroblasts were seeded in 96-well plates one day in advance, with 2000 cells per well. The outer wells were left unseeded and PBS was added to prevent evaporation of the inner wells. After seeding, the plates were incubated overnight at 37°C in a humidified incubator. The cells in each group were then treated with the diluted COL3A1 protein and DMEM basal medium, and cultured for an additional 48 hours. After 48 hours, the culture medium of each well was removed, and the wells were washed three times with PBS. The culture medium containing 10% CCK-8 was added and the wells were incubated in a 37°C cell culture incubator for another 2 hours. The absorbance at 450 nm was measured using a microplate reader. Figure 5 As shown, with the increase of COL3A1 protein concentration, the proliferation activity of fibroblasts gradually increased.

[0071] Example 7 COL3A1 promotes fibroblast migration: COL3A1 protein was dissolved in DMEM to a 1 mg / ml protein solution. In a 12-well plate, the experimental group used 500 μl of COL3A1 protein solution to coat the plate for 2 hours, while the negative control group used DMEM without COL3A1 to coat the plate. After coating each well, a marker was used to draw even horizontal lines on the back of the 12-well plate with a ruler. Fibroblasts in the logarithmic growth phase were digested and counted, and 3×10 cells were plated in each well. 5 After the cells were adhered to the plate and the confluence reached 100%, the next day after plating, the cells were scratched straight along the horizontal line at the bottom of the plate using a 200 μl pipette tip. After scratching, the cells were cleared three times with PBS and 1 ml of complete culture medium was added to continue the cell culture at 37°C. The cells were observed and photographed at 0 h, 6 h, and 24 h. The results are shown in the figure below. Figure 6 As shown, the area of ​​the middle scratch of fibroblasts added with COL3A1 protein-coated well plates was significantly reduced over time, and their wound healing speed was faster than that of fibroblasts added with no COL3A1 protein-coated well plates.

[0072] The nucleotide sequence of SEQ ID NO.7 is as follows: Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing COL3A1 protein, characterized in that: The method comprises using HEK-293T cells to express COL3A1 protein, and using FBLN1 protein signal peptide as the signal peptide of COL3A1 protein.

2. The preparation method according to claim 1, wherein The amino acid sequence of the FBLN1 protein signal peptide is shown in SEQ ID NO.1; Optionally, the nucleotide sequence encoding the FBLN1 protein signal peptide is shown as SEQ ID NO.

2.

3. The preparation method according to claim 1, characterized in that The preparation method comprises allowing HEK-293T cells to express a polynucleotide, wherein the polynucleotide sequentially contains, from the 5' end to the 3' end, a sequence encoding a signal peptide of an FBLN1 protein and a sequence encoding a COL3A1 protein; Optionally, the preparation method comprises: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and allowing the HEK-293T cells to express COL3A1 protein.

4. The preparation method according to any one of claims 1 to 3, characterized in that COL3A1 protein was secreted and expressed in HEK-293T cells; Optionally, the preparation method further comprises forming type III collagen by secreting and expressing the COL3A1 protein in HEK-293T cells.

5. A polynucleotide, characterized in that The polynucleotide sequentially contains a sequence encoding a signal peptide of an FBLN1 protein and a sequence encoding a COL3A1 protein from the 5' end to the 3' end.

6. The polynucleotide according to claim 5, wherein The amino acid sequence of the FBLN1 protein signal peptide is shown in SEQ ID NO.1; Optionally, the polynucleotide sequence encoding the FBLN1 protein signal peptide is shown as SEQ ID NO.2; Optionally, the nucleotide sequence encoding the COL3A1 protein is shown as SEQ ID NO.

7.

7. A carrier, characterized in that The vector carries the polynucleotide according to claim 5 or 6.

8. Recombinant HEK-293T cells, characterized in that The recombinant HEK-293T cells carry the polynucleotide of claim 5 or 6, or contain the vector of claim 7.

9. Use of the method for preparing the COL3A1 protein according to any one of claims 1 to 4, or the COL3A1 protein prepared by the method according to any one of claims 1 to 4, or the polynucleotide according to claim 5 or 6, or the vector according to claim 7, or the recombinant HEK-293T cells according to claim 8 in any one of (i) to (iii): (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) use in the preparation of products for tissue regeneration or wound healing; Optionally, the (i) is an application in promoting fibroblast adhesion, proliferation and / or migration in vitro.

10. Use of the method for preparing the COL3A1 protein according to any one of claims 1 to 4, or the COL3A1 protein produced by the method according to any one of claims 1 to 4, or the polynucleotide according to claim 5 or 6, or the vector according to claim 7, or the recombinant HEK-293T cells according to claim 8 in the preparation of regenerative medicine products, gene therapy products, biomaterials, or cosmetic products.

Images