Preparation method and application of COL17A1 protein
By using the EDIL3 protein signal peptide to express COL17A1 protein in HEK-293T cells, the problem of low expression efficiency of recombinant COL17A1 protein was solved, high yield and high biological activity were achieved, fibroblast function was promoted, and its application in the biomedical field was expanded.
Patent Information
- Application Number
- CN202510791212.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-13
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2045-06-13
AI Technical Summary
In the prior art, the expression efficiency of recombinant COL17A1 protein in mammalian cells is low, resulting in high production costs and low biological activity, making it difficult to apply in large quantities in the biomedical field.
HEK-293T cells were used to express COL17A1 protein, and EDIL3 protein signal peptide was used to replace the traditional signal peptide to improve the expression level and biological activity of COL17A1 protein.
The high-yield and highly bioactive COL17A1 protein was prepared, which promoted the proliferation, adhesion and migration of fibroblasts and expanded its application potential in tissue regeneration, wound healing, regenerative medicine, gene therapy, skin disease treatment and anti-aging products.
Smart Images

Figure CN120591345A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method and application of COL17A1 protein. Background Art
[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.
[0003] COL17A1 (collagen type XVII α1 chain) belongs to the type XVII collagen family and is a key transmembrane protein in the basement membrane region. As a core component of hemidesmosomes, COL17A1 is present in the basement membrane region of the epidermis and dermis, playing a vital role in maintaining skin structural stability, cell adhesion, signal transduction, and tissue regeneration. It also regulates the stem cell microenvironment, promoting stem cell proliferation, regulating keratinocyte migration, and promoting wound healing. In recent years, it has been widely used in the treatment of skin diseases, gene therapy, regenerative medicine, and anti-aging.
[0004] Natural COL17A1 is present in extremely low concentrations in humans and animals, making extraction difficult and yields extremely low. Large-scale production is therefore difficult, limiting its potential for application. Currently, sources rely primarily on recombinant expression in Escherichia coli, Pichia pastoris, or mammalian cells (such as HEK-293T and CHO). However, current recombinant expression systems still present numerous technical challenges. While recombinant expression of COL17A1 in E. coli or Pichia pastoris offers low cost and high yield, the expressed COL17A1 lacks glycosylation and is prone to inclusion body formation, resulting in decreased protein stability. Furthermore, the presence of endotoxins can lead to immune reactions, limiting its use to scientific research and in vitro experiments. Recombinant human COL17A1 expressed in mammalian cells such as HEK-293T and CHO cells exhibits near-natural glycosylation, lower immunogenicity, and higher biological activity, potentially enabling widespread applications in immunotherapy, regenerative medicine, and anti-aging. However, protein expression is low in yield and requires purification steps such as affinity chromatography and ion exchange, significantly increasing production costs.
[0005] Therefore, developing a method for preparing recombinant human type XVII collagen COL17A1 with high efficiency, high activity, low immunogenicity and low cost, and expanding its application in the biomedical field, has important market prospects.
[0006] In view of this, the present invention is proposed. Summary of the Invention
[0007] The object of the present invention is to provide a method for preparing COL17A1 protein, so as to alleviate the problem of low efficiency of expressing COL17A1 protein using mammalian cells in the prior art.
[0008] In order to solve the above technical problems, the present invention adopts the following technical solutions: In a first aspect, a method for preparing a COL17A1 protein is provided. The method comprises expressing the COL17A1 protein using HEK-293T cells, and using an EDIL3 protein signal peptide as a signal peptide of the COL17A1 protein.
[0009] In a second aspect, a polynucleotide is provided, wherein the polynucleotide sequentially comprises, from the 5' end to the 3' end, a sequence encoding an EDIL3 protein signal peptide and a sequence encoding a COL17A1 protein.
[0010] In a third aspect, a vector is provided, wherein the vector carries the polynucleotide described in the second aspect.
[0011] In a fourth aspect, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide of the second aspect, or contains the vector of the third aspect.
[0012] In a fifth aspect, a method for preparing the COL17A1 protein according to the first aspect is provided, or the COL17A1 protein prepared by the method according to the first aspect, or the polynucleotide according to the second aspect, or the vector according to the third aspect, or the recombinant HEK-293T cell according to the fourth aspect is provided, for use in any one of (i) to (iii): (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) Use in the preparation of products for tissue regeneration or wound healing.
[0013] In a sixth aspect, provided is a method for preparing the COL17A1 protein of the first aspect, or use of the COL17A1 protein prepared by the method of the first aspect, or the polynucleotide of the second aspect, or the vector of the third aspect, or the recombinant HEK-293T cells of the fourth aspect in preparing a regenerative medicine product, a gene therapy product, a skin disease treatment product, or an anti-aging product.
[0014] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses HEK-293T cells to express the COL17A1 protein and replaces the traditional signal peptide with the EDIL3 protein signal peptide, thereby successfully producing high-yield, highly bioactive COL17A1 protein. Experiments have confirmed a synergistic effect between the EDIL3 protein signal peptide and HEK-293T cells, demonstrating that the EDIL3 protein signal peptide can increase the expression of the COL17A1 protein in HEK-293T cells compared to CHO cells. The COL17A1 protein produced by the present invention also exhibits excellent bioactivity, with experiments demonstrating its ability to effectively promote the proliferation, adhesion, and migration of fibroblasts. Based on these excellent properties, this preparation method has significant application potential and broad market prospects in a variety of fields, including tissue regeneration, wound healing, regenerative medicine product development, gene therapy product development, biomaterial preparation, and the production of dermatological, anti-aging, and cosmetic products. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0016] Figure 1 The plasmid map of the expression plasmid constructed in Example 1; Figure 2 The results of immunoblotting in Example 3 are as follows: the expression of COL17A1 linked to signal peptide A, signal peptide B, and signal peptide C; Figure 3 The results of immunoblotting in Example 4 are as follows: Figure 4 is the relative adhesion rate of the negative control and the fibroblasts after being coated with COL17A1 protein in Example 5; Figure 5 is the relative proliferation rate of fibroblasts treated with various concentrations of COL17A1 protein in Example 6; Figure 6 These are photos of fibroblasts at 0 h, 6 h, and 24 h in the cell scratch experiment in Example 7. DETAILED DESCRIPTION
[0017] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0018] As used herein, "and / or" is used to indicate that either or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).
[0019] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or action from another entity or action, and does not necessarily require or imply any actual relationship, order, or importance between these entities or actions, such as numbering first, second, etc.
[0020] As used herein, unless otherwise stated, "optionally," "optional," "optional," or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0021] Herein, the terms "comprise" or "comprising" are intended to imply the inclusion of stated elements, integers or steps, but not the exclusion of any other elements, integers or steps.
[0022] As used herein, the term "COL17A1 protein" refers to the type XVII collagen α1 peptide chain (COL17A1), which is encoded by the COL17A1 gene. COL17A1 protein may also refer to a multimer composed of COL17A1 protein, for example, when COL17A1 protein forms a trimer, it is type XVII collagen.
[0023] In this article, peptides, polypeptides, and proteins are not strictly distinguished and can be used interchangeably in some cases. They generally refer to polymers composed of amino acids connected by peptide bonds, whether naturally occurring or synthetic.
[0024] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. When a polynucleotide encodes a protein or polypeptide, the encoding may optionally encode a sense strand or an antisense strand. A polynucleotide may be naturally occurring, synthetic, recombinant, or any combination thereof. "Nucleic acid molecule," "nucleic acid," and "polynucleotide" may be used interchangeably. In an optional embodiment, the polynucleotide is DNA.
[0025] As used herein, the term "vector" refers to a vehicle into which a genetic element (e.g., the aforementioned polynucleotide) can be operatively inserted and used to express the genetic element, for example, to produce the protein, RNA, or DNA encoded by the genetic element, or to replicate the genetic element. Vectors can be used to transform, transduce, or transfect host cells, enabling expression of the genetic element carried by the vector within the host cell. For example, vectors include plasmids, episomal plasmids, minicircle DNA, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs), bacteriophages such as lambda phage or M13 phage, and animal viruses. Vectors may contain a variety of elements that control expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Vectors may also contain a replication initiation site. Vectors may also include components that facilitate entry into cells, including, but not limited to, viral particles, liposomes, or protein coats. Vectors may be expression vectors or cloning vectors. The vector may also include a selectable marker, such as, but not limited to, a resistance gene and / or a fluorescent protein gene.
[0026] In a first aspect, a method for preparing a COL17A1 protein is provided. The method comprises expressing the COL17A1 protein using HEK-293T cells, and using an EDIL3 protein signal peptide as a signal peptide of the COL17A1 protein.
[0027] The EDIL3 protein in this article refers to epidermal growth factor-like repeats and discoidin I-like domains 3 (EDIL3), also known as developmental endothelial locus-1 (Del-1). EDIL3 is an extracellular matrix protein secreted by endothelial cells and a unique integrin ligand that promotes angiogenesis.
[0028] HEK-293T cells (Human Embryonic Kidney 293T cells) are derived from human embryonic kidney cells and are often used as host cells for exogenous expression of target proteins. They have the advantages of stable and high in vitro proliferation capacity and high transfection efficiency. The present invention discovered that using the EDIL3 protein signal peptide as the signal peptide for the COL17A1 protein can significantly improve the expression of the COL17A1 protein in HEK-293T cells.
[0029] In an alternative embodiment, the COL17A1 protein is secreted and expressed in HEK-293T cells.
[0030] In an optional embodiment, the preparation method further comprises forming type XVII collagen by secreting and expressing COL17A1 protein in HEK-293T cells.
[0031] In an optional embodiment, the amino acid sequence of the EDIL3 protein signal peptide is shown as SEQ ID NO.1.
[0032] SEQ ID NO. 1: MKRSVAVWLLVGLSLGVPQFGKG.
[0033] In an optional embodiment, the nucleotide sequence encoding the EDIL3 protein signal peptide is shown as SEQ ID NO.2.
[0034] SEQ ID NO.2: atgaagcgctcggtagccgtctggctcttggtcgggctcagcctcggtgtcccccagttcggcaaaggt.
[0035] In an optional embodiment, the preparation method comprises allowing HEK-293T cells to express a polynucleotide, wherein the polynucleotide sequentially comprises, from the 5' end to the 3' end, a sequence encoding an EDIL3 protein signal peptide and a sequence encoding a COL17A1 protein.
[0036] The sequence encoding the EDIL3 protein signal peptide and the sequence encoding the COL17A1 protein may or may not be integrated into the genome of the HEK-293T cells.
[0037] In an optional embodiment, the preparation method comprises: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and allowing the HEK-293T cells to express COL17A1 protein.
[0038] In an alternative embodiment, those skilled in the art can introduce the polynucleotide encoding the EDIL3 protein signal peptide and the polynucleotide encoding the COL17A1 protein into HEK-293T cells by any method known in the art for introducing exogenous nucleic acids into cells, such as, but not limited to, liposome transfection, cationic polymer transfection, electroporation, microinjection, gene gun, or viral vector-mediated transfection.
[0039] It is understood that those skilled in the art can culture the HEK-293T cells using any method known in the art, including any known culture medium, culture environment, culture container, and culture equipment.
[0040] In an optional embodiment, the preparation method further comprises isolating, enriching and / or purifying the COL17A1 protein expressed by recombinant HEK-293T cells.
[0041] In an optional embodiment, the COL17A1 protein carries a His tag, and the preparation method further comprises purifying the COL17A1 protein using a filler modified with nickel ions.
[0042] The COL17A1 protein produced by the preparation method described in the first aspect includes wild-type COL17A1 protein or artificially modified COL17A1 protein. Such artificially modified COL17A1 protein includes, but is not limited to, a polypeptide or protein that has undergone mutation, truncation, or fusion with other domains. The COL17A1 protein produced by the preparation method described in the first aspect can be a single chain or a multimer, which is not limited by the present invention. For example, it can form a trimer, i.e., type XVII collagen. Therefore, the preparation method provided in the first aspect of the present invention can also be a method for producing type XVII collagen.
[0043] The COL17A1 protein produced by the preparation method described in the first aspect can be derived from any species known in the art, such as mammalian COL17A1 protein, including but not limited to humans, monkeys, dogs, cats, mice, rats, cattle, horses, camels, alpacas, poultry, goats, and sheep. In alternative embodiments, the COL17A1 protein produced by the preparation method described in the first aspect is human COL17A1 protein. In alternative embodiments, the protein expressed by the preparation method is the COL17A1 protein encoded by the nucleotide sequence set forth in SEQ ID NO. 7.
[0044] In a second aspect, a polynucleotide is provided, wherein the polynucleotide sequentially comprises, from the 5' end to the 3' end, a sequence encoding an EDIL3 protein signal peptide and a sequence encoding a COL17A1 protein.
[0045] In an optional embodiment, the amino acid sequence of the EDIL3 protein signal peptide is shown as SEQ ID NO.1.
[0046] In an optional embodiment, the polynucleotide sequence encoding the EDIL3 protein signal peptide is shown as SEQ ID NO.2.
[0047] In an optional embodiment, the nucleotide sequence encoding the COL17A1 protein is shown as SEQ ID NO.8.
[0048] In a third aspect, a vector is provided, wherein the vector carries the polynucleotide described in the second aspect.
[0049] In an optional embodiment, the vector is a plasmid.
[0050] In an optional embodiment, the vector is an expression plasmid.
[0051] In a fourth aspect, a recombinant HEK-293T cell is provided, wherein the recombinant HEK-293T cell carries the polynucleotide described in the second aspect, or contains the vector described in the third aspect.
[0052] In an optional embodiment, the polynucleotide described in the second aspect may or may not be integrated into the genome of the recombinant HEK-293T cells.
[0053] In an optional embodiment, the recombinant HEK-293T cells contain a plasmid carrying the polynucleotide described in the second aspect.
[0054] In a fifth aspect, a method for preparing the COL17A1 protein according to the first aspect is provided, or the COL17A1 protein prepared by the method according to the first aspect, or the polynucleotide according to the second aspect, or the vector according to the third aspect, or the recombinant HEK-293T cell according to the fourth aspect is provided, for use in any one of (i) to (iii): (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) Use in the preparation of products for tissue regeneration or wound healing.
[0055] In an optional embodiment, the (i) is an application in promoting fibroblast adhesion, proliferation and / or migration in vitro.
[0056] In a sixth aspect, provided is a method for preparing the COL17A1 protein of the first aspect, or the COL17A1 protein prepared by the method for preparing the COL17A1 protein of the first aspect, or the polynucleotide of the second aspect, or the vector of the third aspect, or the recombinant HEK-293T cells of the fourth aspect, in preparing a regenerative medicine product, a gene therapy product, a skin disease treatment product, or an anti-aging product.
[0057] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.
[0058] Example 1 1. Connect the target gene to the pLV-CMV expression vector by seamless cloning to obtain COL17A1 gene expression plasmids connected with different signal peptides. The plasmid map is as follows: Figure 1 As shown, the nucleotide sequence encoding the signal peptide is connected to the 5' end of the COL17A1 gene. The nucleotide sequence of the COL17A1 gene is shown in SEQ ID NO. 7. COL17A1 is connected to a 6×His tag.
[0059] The signal peptide sequences are: Signal peptide A (EDIL3 protein signal peptide): Amino acid sequence, SEQ ID NO. 1: MKRSVAVWLLVGLSLGVPQFGKG; Nucleotide sequence, SEQ ID NO.2: atgaagcgctcggtagccgtctggctcttggtcgggctcagcctcggtgtcccccagttcggcaaaggt.
[0060] Signal peptide B (C3 protein signal peptide): Amino acid sequence, SEQ ID NO. 3: MGPTSGPSLLLLLLTHLPLALG; Nucleotide sequence, SEQ ID NO.4: atgggacccacctcaggtcccagcctgctgctcctgctactaacccacctcccctggctctgggg.
[0061] Signal peptide C (IGFBP6 protein signal peptide): Amino acid sequence, SEQ ID NO. 5: MTPHRLLPPLLLLLALLLAASPGGALA; Nucleotide sequence, SEQ ID NO.6: atgaccccccacaggctgctgccaccgctgctgctgctgctagctctgctgctcgctgccagcccaggaggcgccttggcg.
[0062] Three expression plasmids were obtained, each containing a signal peptide and a type XVII collagen protein, and were named pA-COL17A1, pB-COL17A1, and pC-COL17A1, respectively. Figure 1 shown.
[0063] Example 2 Production and preparation of HEK-293T cells that efficiently secrete and express human type XVII collagen COL17A1: HEK-293T cells were plated one day in advance to a confluence of 80% before transfection. During transfection, 20 μg of pA-COL17A1, pB-COL17A1, and pC-COL17A1 prepared in Example 1 were incubated with PEI transfection reagent to form transfection complexes. After incubation, the transfection complexes were added dropwise to the supernatant of the HEK-293T cell culture medium. The supernatant of the transfected HEK-293T cell culture medium was collected and eluted using a nickel ion affinity chromatography column. The COL17A1 protein corresponding to the elution peak was collected. The COL17A1 protein formed a trimer, i.e., recombinant human type XVII collagen.
[0064] Example 3 Comparison of expression levels of COL17A1 proteins linked to different signal peptides The expression plasmids pA-COL17A1, pB-COL17A1 and pC-COL17A1 prepared in Example 1 were transfected into HEK-293T cells, and the cell culture supernatant was collected 72 hours after transfection. The expression level of COL17A1 was compared by immunoblotting. Figure 2 As shown in the figure, when the total protein loading amount per well is the same, the protein expression level of COL17A1 linked to signal peptide A, signal peptide B, and signal peptide C is the highest among the three signal peptide sequences linked to COL17A1. Therefore, when using HEK-293T cells to express COL17A1, using signal peptide A to link COL17A1 can achieve the maximum expression level of COL17A1.
[0065] Example 4 Comparison of expression of signal peptide A-linked COL17A1 protein in different mammalian cells: The expression plasmid pA-COL17A1 constructed in Example 1 was transfected into HEK-293T and CHO cells, respectively, to compare the expression differences in different mammalian cells. One day before transfection, HEK-293T and CHO cells were seeded into 6-well plates, respectively, so that the confluence reached 80% before transfection. During transfection, 2 μg of the constructed signal peptide A was connected to the COL17A1 recombinant expression plasmid and incubated with PEI transfection reagent to form a transfection complex. After the incubation, the transfection complex was added dropwise to the culture supernatant of HEK 293T and CHO cells, respectively, and the same amount of plasmid was used for transfection of both. After transfection, the culture supernatant of HEK-293T and CHO cells was collected at 72 hours, and the expression level of COL17A1 was compared by immunoblotting. The results are as follows Figure 3 As shown in the figure, when the total protein loading amount per well is consistent, the expression level of the recombinant expression plasmid containing signal peptide A linked to COL17A1 in HEK 293T cells is significantly higher than that in CHO cells. Therefore, using HEK-293T cells to express the recombinant plasmid containing signal peptide A linked to COL17A1 can efficiently secrete and express human type XVII collagen COL17A1.
[0066] Example 5 COL17A1 promotes fibroblast adhesion: The COL17A1 protein prepared in Example 2 was dissolved in PBS to a 1 mg / ml protein solution. For the 96-well plate for cell adhesion assay, 100 μl of COL17A1 protein solution was added to each well of the experimental group, and PBS solution was used for the negative group. The plates were coated overnight at 4°C, and then incubated with 2% denatured BSA for 1 hour. The plates were then washed 3 times with serum-free culture medium to remove excess glue for later use. Fibroblasts were digested, 5,000 cells were inoculated into each well, and a blank control with no cells but only culture medium was set up, and the plates were incubated in a 37°C incubator for 2 hours. After 2 hours, the culture medium of each well was removed, and the cells that did not adhere to the wall were gently washed 3 times with PBS. 100 μl of culture medium containing 10% CCK-8 was added, and the plates were incubated in a 37°C cell incubator for another 2 hours. The absorbance at 450 nm was detected using an enzyme reader, and the cell adhesion rate was calculated. The results are shown in the figure below. Figure 4 As shown, the cell adhesion rate of the COL17A1 protein-coated plate prepared in Example 2 was significantly higher than that of the PBS solution-coated plate.
[0067] Example 6 COL17A1 promotes fibroblast proliferation: The COL17A1 protein obtained in Example 2 was diluted using DMEM basal medium to the following concentration gradient: 4 μg / ml, 2 μg / ml, 1 μg / ml, 0.5 μg / ml, 0.25 μg / ml, 0.125 μg / ml, 0.0625 μg / ml, and 0 μg / ml (i.e., without COL17A1 protein). The sample group received the aforementioned diluted COL17A1, while the blank control group received DMEM basal medium. Three replicates were set up for each group. Fibroblasts were seeded in 96-well plates one day in advance, with 2000 cells per well. The outer wells were left unseeded and PBS was added to prevent evaporation of the inner wells. After seeding, the plates were incubated overnight at 37°C in a humidified incubator. The cells in each group were then treated with the diluted COL17A1 protein and DMEM basal medium, and cultured for an additional 48 hours. After 48 hours, the culture medium of each well was removed, and the cells were washed three times with PBS. The culture medium containing 10% CCK-8 was added and the cells were incubated in a 37°C cell culture incubator for another 2 hours. The absorbance at 450 nm was measured using a microplate reader. Figure 5 As shown, with the increase of COL17A1 protein concentration, the proliferation activity of fibroblasts gradually increased.
[0068] Example 7 COL17A1 promotes fibroblast migration: COL17A1 protein was dissolved in DMEM to a 1 mg / ml protein solution. In a 12-well plate, the experimental group used 500 μl of COL17A1 protein solution to coat the plate for 2 hours, while the negative control group used DMEM without COL17A1 to coat the plate. After coating each well, a marker was used to draw even horizontal lines on the back of the 12-well plate with a ruler. Fibroblasts in the logarithmic growth phase were digested and counted, and 3×10 cells were plated in each well. 5 After the cells were plated, they were allowed to adhere to the plate and reach 100% confluence. On the second day of plating, the cells were scratched straight along the horizontal line at the bottom of the plate using a 200μl pipette tip. After scratching, the cells were washed three times with PBS, and 1ml of complete culture medium was added. The cells were cultured at 37℃ and observed and photographed at 0h, 6h, and 24h. The results are shown in the figure below. Figure 6 As shown, the area of the middle scratch of fibroblasts added with COL17A1 protein-coated well plates was significantly reduced over time, and their wound healing speed was faster than that of fibroblasts added with no COL17A1 protein-coated well plates.
[0069] The nucleotide sequence of SEQ ID NO.7 is as follows: Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for preparing COL17A1 protein, characterized in that: The method includes using HEK-293T cells to express COL17A1 protein, and using EDIL3 protein signal peptide as the signal peptide of COL17A1 protein.
2. The preparation method according to claim 1, wherein The amino acid sequence of the EDIL3 protein signal peptide is shown in SEQ ID NO.1; Optionally, the nucleotide sequence encoding the EDIL3 protein signal peptide is shown as SEQ ID NO.
2.
3. The preparation method according to claim 1, characterized in that The preparation method comprises allowing HEK-293T cells to express a polynucleotide, wherein the polynucleotide sequentially contains, from the 5' end to the 3' end, a sequence encoding an EDIL3 protein signal peptide and a sequence encoding a COL17A1 protein; Optionally, the preparation method comprises: introducing the polynucleotide into HEK-293T cells, culturing the HEK-293T cells, and allowing the HEK-293T cells to express COL17A1 protein.
4. The preparation method according to any one of claims 1 to 3, characterized in that COL17A1 protein was secreted and expressed in HEK-293T cells; Optionally, the preparation method further comprises forming type XVII collagen by secreting and expressing COL17A1 protein in HEK-293T cells.
5. A polynucleotide, characterized in that The polynucleotide sequentially contains a sequence encoding an EDIL3 protein signal peptide and a sequence encoding a COL17A1 protein from the 5' end to the 3' end.
6. The polynucleotide according to claim 5, wherein The amino acid sequence of the EDIL3 protein signal peptide is shown in SEQ ID NO.1; Optionally, the polynucleotide sequence encoding the EDIL3 protein signal peptide is shown as SEQ ID NO.2; Optionally, the nucleotide sequence encoding the COL17A1 protein is shown as SEQ ID NO.
7.
7. A carrier, characterized in that The vector carries the polynucleotide according to claim 5 or 6.
8. Recombinant HEK-293T cells, characterized in that The recombinant HEK-293T cells carry the polynucleotide of claim 5 or 6, or contain the vector of claim 7.
9. Use of the method for preparing the COL17A1 protein according to any one of claims 1 to 4, or the COL17A1 protein prepared by the method according to any one of claims 1 to 4, or the polynucleotide according to claim 5 or 6, or the vector according to claim 7, or the recombinant HEK-293T cells according to claim 8 in any one of (i) to (iii): (i) Use in promoting fibroblast adhesion, proliferation and / or migration for non-diagnostic and therapeutic purposes; (ii) use in the preparation of a product for promoting fibroblast adhesion, proliferation and / or migration; (iii) use in the preparation of products for tissue regeneration or wound healing; Optionally, the (i) is an application in promoting fibroblast adhesion, proliferation and / or migration in vitro.
10. Use of the method for preparing the COL17A1 protein according to any one of claims 1 to 4, or the COL17A1 protein produced by the method according to any one of claims 1 to 4, or the polynucleotide according to claim 5 or 6, or the vector according to claim 7, or the recombinant HEK-293T cells according to claim 8 in preparing a regenerative medicine product, a gene therapy product, a skin disease treatment product, or an anti-aging product.
Citation Information
Patent Citations
Recombinant elastin, preparation method and application thereof
CN118064468A