Paenibacillus mucilaginosus C1 with salt-tolerant, growth-promoting and water-retaining functions and application thereof

Abstract

The invention relates to paenibacillus mucilaginosus and application thereof, in particular to paenibacillus mucilaginosus C1 with salt-tolerant, growth-promoting and water-retaining functions and application of the paenibacillus mucilaginosus C1, and belongs to the technical field of agricultural microorganisms. The preservation number of the paenibacillus mucilaginosus C1 is CGMCC (China General Microbiological Culture Collection Center) The strain obtained by the invention has the characteristic of high salt tolerance, can increase the content of rapidly available potassium and available phosphorus in soil, can generate a large amount of exopolysaccharides, has good water retention characteristic, and has efficient chitin degradation capability; the invention further provides a liquid culture medium suitable for fermentation of the paenibacillus mucilaginosus C1, a large amount of paenibacillus mucilaginosus C1 with salt-tolerant growth-promoting and water-retaining functions can be rapidly obtained by using the culture medium, and the salt-tolerant growth-promoting and water-retaining strain provides an excellent strain resource for saline-alkali farmland soil remediation and sandy soil water retention and growth promotion. The strain and the bacterial liquid thereof have relatively high agricultural application prospects and economic values.

Description

Technical Field

[0001] The present invention relates to a strain of Paenibacillus colloidus and applications thereof, in particular to a strain of Paenibacillus colloidus C1 with salt-resistant growth-promoting and water-retaining functions and applications thereof, belonging to the technical field of agricultural microorganisms. Background Art

[0002] Soil salinization is a major ecological issue facing the world. Globally, the area of ​​saline-alkali land exceeds 1 billion hectares, and China's saline-alkali land covers approximately 150 million hectares, primarily in major agricultural production areas such as Northeast China, North China, and Northwest China. Salt-alkali stress can lead to deterioration of soil physical and chemical properties (such as high osmotic pressure and ion imbalance), inhibiting plant growth and causing crop yield reductions or even complete failure. Traditional saline-alkali land improvement methods include chemical improvement (such as the application of gypsum and sulfur), physical improvement (such as leaching and soil addition), and the cultivation of salt-tolerant crops. However, these methods suffer from high costs, the risk of secondary pollution, and long improvement cycles. Therefore, the development of environmentally friendly, efficient, and sustainable bioremediation technologies has become a research hotspot.

[0003] Microbial agents have shown great potential in saline-alkali land restoration due to their green, environmentally friendly and diverse functions. Paenibacillus mucilaginosus ) can dissolve insoluble phosphorus and potassium in the soil by secreting organic acids, thereby improving nutrient utilization, while producing extracellular polysaccharides (EPS) to improve soil aggregate structure and enhance water retention capacity. However, existing strains generally have shortcomings such as poor salt tolerance, single functions, and poor environmental adaptability in saline-alkali environments. In recent years, a large number of studies have been conducted at home and abroad on the screening and application of salt-tolerant microorganisms. In the existing technology, the resources of strains that are salt-tolerant, growth-promoting, water-retaining, and chitin-degrading are still relatively scarce. Summary of the Invention

[0004] Addressing the bottlenecks of existing microbial improvements in saline-alkali soils, the present invention aims to provide a strain of Paenibacillus colloidus C1 with salt-tolerant growth-promoting and water-retention capabilities. This strain exhibits strong salt tolerance, high growth-promoting efficiency, significant water-retention capabilities, and efficient chitin degradation. Through the synergistic effects of its multiple functions, it improves saline-alkali soil structure, enhances sandy soil water retention, increases soil nutrient utilization, and enhances crop stress resistance. This strain overcomes the limited adaptability of traditional microbial agents in high-salt environments, providing a new technical solution for saline-alkali soil ecological restoration and sustainable agricultural development.

[0005] Another object of the present invention is to provide the use of the above-mentioned Paenibacillus subtilis C1 in increasing the available potassium and effective phosphorus in saline-alkali soil and improving soil structure.

[0006] The present invention also provides the use of the above-mentioned Paenibacillus subtilis C1 in improving the water retention function of sandy soil.

[0007] The technical solutions adopted by the present invention to achieve the above-mentioned purpose are as follows: The present invention provides a strain of Paenibacillus colloids C1, the deposit number of which is CGMCC No. 30802, deposited in the General Microbiology Center of China Culture Collection Administration on May 28, 2024, and classified as Paenibacillus colloids Paenibacillus mucilaginosus .

[0008] The nucleotide sequence of the 16S rRNA gene of Paenibacillus mucilaginosus C1 provided by the present invention is shown in SEQ ID NO.1.

[0009] The present invention also provides the use of the above-mentioned Paenibacillus subtilis C1 for increasing the available potassium and effective phosphorus in saline-alkali soil under salt stress conditions.

[0010] Preferably, the salt stress refers to saline-alkali soil with a salt concentration mass ratio of not less than 2‰ in the soil.

[0011] The application process of the Paenibacillus subtilis C1 provided by the present invention for increasing available potassium and available phosphorus in saline-alkali soil under salt stress conditions comprises the following steps: (1) inoculating the activated Paenibacillus subtilis C1 seed liquid into a fermentation liquid medium for cultivation to obtain a suspension containing Paenibacillus subtilis; (2) Dilute the microbial suspension obtained by fermentation and apply the diluted microbial suspension to the saline-alkali soil.

[0012] Preferably, in step (1), the inoculation is carried out by inoculating the activated Paenibacillus subtilis seed solution at a volume ratio of 1-2%.

[0013] Preferably, in step (1), the composition of the fermentation liquid culture medium is as follows: 10 g sucrose, 0.5 g dipotassium hydrogen phosphate trihydrate, 10 g sodium chloride, 0.2 g magnesium sulfate heptahydrate, 1.0 g calcium carbonate, and 0.5 g yeast extract per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.0.

[0014] Preferably, in step (1), the culture conditions are culturing at 28-30°C and 220 rpm for 24-48 hours.

[0015] Preferably, in step (2), the concentration of the diluted Paenibacillus subtilis suspension is 1×10 7 cfu / mL~1×10 8 cfu / mL.

[0016] Another object of the present invention is to provide the use of the above-mentioned Paenibacillus subtilis C1 in improving the water retention function of sandy soil.

[0017] The present invention screened and screened Paenibacillus colloidalis C1, which has salt-tolerant growth-promoting properties, exhibits biological characteristics: short rod-shaped cells, the production of endospores, and a cell size of (0.2 μm to 0.5 μm) × (1.0 μm to 1.6 μm). When cultured on a solid plate at 30°C, the colonies are small, round, transparent, and have a moist, oily, and droplet-like appearance. With increasing culture time, the colonies rapidly expand and become colloid-like, forming stringy, smooth edges when picked. Its physiological and biochemical characteristics include Gram-negative staining, aerobic properties, an optimal growth temperature of 25-33°C, an optimal pH of 6.5-8.5, and an optimal salt concentration of 1-10%. It exhibits a wide salt tolerance range and can grow and reproduce at salt concentrations as high as 20%, though with a significantly reduced growth rate. It also exhibits potassium and phosphate solubilization, chitin degradation, and exopolysaccharide production.

[0018] The results of sequencing the 16S rRNA gene of Paenibacillus mucilaginosus C1 of the present invention showed that the gene length was 1402 bp, and the corresponding nucleotide sequence was shown in SEQ ID NO.1.

[0019] The strain C1 of the present invention was identified as similar to the model strain Paenibacillus colloidus by comparison and phylogenetic analysis using the BLASTN program of the National Center for Biotechnology Information (NCBI). Paenibacillus mucilaginosus ) strain VKPM B-7519 is highly homologous, with a 16S rDNA sequence similarity of up to 99.86%. Ten 16S rDNA sequences with high homology were selected as references, and a phylogenetic tree was constructed between strain C1 and the reference strain using the neighbor-joining method using Mega 7 software. In the phylogenetic tree, strain C1 is closely related to Paenibacillus mucilaginosus ( Paenibacillus mucilaginosus ) VKPM B-7519 formed a separate intra-cluster evolutionary branch ( Figure 8 ). Therefore, it can be determined that C1 is a strain of Bacillus colloids ( Paenibacillus mucilaginosus ).

[0020] The basic method for breeding the salt-tolerant, growth-promoting, water-retaining and chitin-degrading Paenibacillus sp. C1 strain of the present invention is as follows: 5-10 cm of soil was collected from the saline-alkali land of the Yellow River Delta Nature Reserve, placed in a sterile ziplock bag, mixed thoroughly, and quickly placed on dry ice before being transferred to a laboratory ultra-low temperature freezer for storage. One gram of soil was enriched in a culture medium containing colloidal chitin as the sole carbon source. The enrichment culture was incubated at 28-30°C in a constant-temperature shaking incubator at 220 rpm for 48 hours. A gradient dilution was then spread onto a solid culture plate containing colloidal chitin as the sole carbon source and incubated at 28-30°C. Single colonies with a clear transparent degradation zone were selected and plated onto the same culture plate. After two purifications, the strain was obtained. The strain was frozen in glycerol.

[0021] The beneficial effects of the present invention are: (1) The present invention discloses a strain of Bacillus subtilis C1 with salt-tolerant growth-promoting function. The strain also has the characteristics of high salt tolerance, potassium solubility, phosphate solubility, and phosphate solubility. It has a wide range of salt tolerance and can maintain good growth under salt concentration conditions of 1-10%. It has great application potential in saline-alkali soil remediation.

[0022] (2) Through multiple rounds of screening, the present invention has obtained a strain that has the ability to degrade chitin and secrete exopolysaccharides. The strain can efficiently degrade chitin while simultaneously secreting a large amount of exopolysaccharides, and has excellent water retention function. This strain has high application prospects and economic value in the fields of agricultural pathogenic fungi control and sandy soil water retention.

[0023] Preservation Information Deposit date: May 28, 2024; Depository: General Microbiology Center, China Culture Collection Administration; Deposit number: CGMCC NO.30802; Address of the depository: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Postal code: 100101; Classification name: Paenibacillus mucilaginosus Paenibacillus mucilaginosus . BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the cell morphology of Paenibacillus mucilaginosus C1 under a microscope; Figure 2 This is the colony morphology of Paenibacillus mucilaginosus C1; Figure 3 This is the colony morphology of Paenibacillus mucilaginosus C1 under high salt conditions; Figure 4 This is a diagram showing the degradation effect of Paenibacillus subtilis C1 on chitin; A represents the solid degradation effect and B represents the liquid degradation effect; Figure 5This is a diagram showing the potassium dissolving effect of Paenibacillus mucilaginosus C1; Figure 6 This is a diagram showing the effect of Paenibacillus mucilaginosus C1 on phosphate solubilization (organic phosphorus); Figure 7 This is a diagram showing the effect of Paenibacillus mucilaginosus C1 on solubilizing phosphate (inorganic phosphate); Figure 8 is the phylogenetic tree between Paenibacillus mucilaginosus C1 and the reference strain; Figure 9 Liquid culture 48 hours of bacterial liquid state; Figure 10 Exopolysaccharides extracted from the fermentation broth of Paenibacillus mucilaginosus C1; A is a photo of ethanol-extracted exopolysaccharides, and B is exopolysaccharides; Figure 11 Actual photos of the soil column tested for water retention in sandy soil using the bacterial solution of Paenibacillus subtilis C1; Figure 12 Curve of water migration distance changing with time in soil column experiment; Figure 13 Growth-promoting effect of Paenibacillus subtilis on rice seedlings. DETAILED DESCRIPTION

[0025] The present invention is described in detail below with reference to the accompanying drawings and examples. The examples described below are merely preferred embodiments of the present invention. It should be noted that the following description is merely for the purpose of explaining the present invention and does not limit the present invention in any form. Any simple modifications, equivalent changes, and modifications made to the embodiments based on the technical essence of the present invention fall within the scope of the technical solution of the present invention.

[0026] In the following examples, the materials and reagents used were obtained from commercial sources unless otherwise specified.

[0027] Example 1 Screening of salt-tolerant Paenibacillus colloidus (1) 5-10 cm soil samples were collected from the saline-alkali land of the Yellow River Delta Nature Reserve, placed in clean sampling bags and mixed, marked, placed in an ice box and brought back to the laboratory, and stored at -80°C for future use. 1 g of soil sample was weighed in a sterile clean bench and placed in a triangular flask containing 20 mL of liquid culture medium with colloidal chitin as the sole carbon source. The sample was enriched and cultured in a shaking incubator at 30°C and 220 rpm for 48 hours. Under sterile conditions, 1 mL of the culture medium was taken and mixed thoroughly in 9 mL of sterile water, and then diluted in sequence to make 10 -1 , 10 -3 , 10 -5Pipette 0.2 mL of each sample solution at different dilutions onto a solid culture plate containing colloidal chitin as the sole carbon source. Incubate the plate upside down in a 30°C incubator for 2–5 days, observing the plate for the presence of a transparent degradation zone. Transfer individual colonies from the degradation zone to the same solid culture plate, number them, and culture them sequentially. After two transfers and streaks, a pure culture of the strain is obtained.

[0028] (2) Use an inoculation loop to pick a single colony and transfer it to a test tube containing 5 mL of liquid culture medium containing colloidal chitin as the sole carbon. Shake and culture at 30°C and 220 rpm for 24 h. The strains were then preserved and 16S rDNA sequenced. The strains were preserved using the glycerol tube freezing method. 200 μL of glycerol (final glycerol concentration 20%) and 800 μL of bacterial solution were added to the frozen tubes, mixed well, and stored in a -80°C ultra-low temperature freezer.

[0029] Among the screened strains, one strain produced a very significant chitin transparent degradation zone ( Figure 4 When cultured on solid state at 30℃, the colonies are round, oil-drop-shaped, with a gel-like surface, translucent, and smooth and moist ( Figure 2 ), the inoculation loop is picked into a drawing state, and under the condition of 10% salt (NaCl) ( Figure 3 The strain is numbered C1 and is preliminarily determined to be the selected strain C1 of the present invention.

[0030] The composition of the liquid culture medium with colloidal chitin as the sole carbon source is as follows: 5 g of colloidal chitin, 0.5 g of yeast extract, 1.0 g of potassium dihydrogen phosphate, 1 g of ammonium sulfate, 0.3 g of magnesium sulfate, 0.02 g of ferrous sulfate, 30 g of sodium chloride, and 3 g of yeast powder per 1000 mL of distilled water, with the pH adjusted to 7.5-8.0 (the solid culture plate also contains 15 g of agar powder).

[0031] Example 2 Optimization of culture conditions of strain C1 After strain C1 was inoculated on an LB solid culture plate and placed in a 30°C incubator for 24 hours, no colonies were observed to grow. However, when strain C1 was inoculated on an LB solid culture medium in which the carbon source and nitrogen source were diluted 5 times, 10 times, and 100 times, normal colony growth was observed after culturing at 30°C for 24 hours. The results showed that strain C1 is more suitable for growth under oligotrophic conditions, may be easier to colonize in the soil, and has good agricultural application potential. Subsequently, the carbon source and nitrogen source were further optimized to obtain the optimal strain fermentation medium ( Figure 2 , Figure 9 ).

[0032] The composition of the LB solid medium diluted 10-fold with the above carbon source and nitrogen source is as follows: 1 g of peptone, 0.5 g of yeast powder, 30 g of sodium chloride, and 15 g of agar powder per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.0.

[0033] The fermentation medium composition is as follows: per 1000 mL of distilled water, contains 10 g of sucrose, 0.5 g of potassium hydrogen phosphate trihydrate, 10 g of sodium chloride, 0.2 g of magnesium sulfate heptahydrate, 1.0 g of calcium carbonate, and 0.5 g of yeast extract, and the pH is adjusted to 7.5-8.0.

[0034] Example 2 Morphological observation and physiological and biochemical characteristics of strain C1 The cell morphology of strain C1 was observed under a microscope.

[0035] The culture temperature for the physiological and biochemical characterization tests of strain C1 was set at 30°C. The biological characteristics of strain C1 are: short rod shape, endospore production, and cell size of (0.2 μm ~ 0.5 μm) × (1.0 μm ~ 1.6 μm) ( Figure 1 When cultured in a solid medium at 30°C, the colonies are initially round. As the culture time increases, they grow larger and gradually become irregularly round, colloid-like, protruding, colorless and transparent, with a very moist surface. When picked, they become stringy ( Figure 2 ).

[0036] The physiological and biochemical characteristics of strain C1 are: Gram staining negative, aerobic, optimal growth temperature of 28~32℃, optimal growth pH of 6.5~8.0, normal growth in a salt concentration range of 1~10%, and the ability to produce enzymes such as esterase, lipid esterase, acid phosphatase, naphthol-AS-BI-phosphohydrolase, α-glucosidase, N-acetyl-glucosaminidase, and chitinase.

[0037] The results of determining the 16S rRNA gene sequence of the screened strain C1 showed that the gene length was 1402 bp, and the corresponding nucleotide sequence was shown in SEQ ID NO.1.

[0038] The strain was identified as a strain of Paenibacillus gloeosporioides (Bacillus gloeosporioides) by comparison and phylogenetic analysis using the BLASTN program of the National Center for Biotechnology Information (NCBI). Paenibacillus mucilaginosus ), namely Bacillus subtilis C1.

[0039] The 16S rDNA sequences of 10 sequences with high homology were selected as reference objects, and the phylogenetic tree between strain C1 and the reference strains was constructed using the Neighbor-Joining method using Mega 7 software. In the phylogenetic tree, strain C1 and the model strain of Paenibacillus mucilaginosus Paenibacillus mucilaginosus strain VKPMB-7519 formed a separate intracluster evolutionary branch ( Figure 8 ).

[0040] The composition of the solid culture medium for bacterial morphology observation is as follows: 1 g of peptone, 0.5 g of yeast powder, 10 g of sodium chloride, and 15 g of agar powder per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.0.

[0041] Example 3 Analysis of the potassium, phosphate and phosphate solubilization functions of strain C1 A single colony of the isolated strain C1 was transferred to a test tube containing 5 mL of liquid culture medium and cultured at 30°C, 220 rpm, with shaking for 24 hours. 10 μL of the culture was then spotted on a potassium-dissolving medium and cultured in a 30°C constant-temperature incubator for 3 days. The culture plates were then observed for the appearance of transparent, oil-droplet-like colonies. The results showed that after 24 hours of culture in the potassium-dissolving medium, strain C1 developed transparent, oil-droplet-like colonies on the plates, indicating that strain C1 could dissolve potassium feldspar and possess potassium-dissolving properties ( Figure 5 ).

[0042] The isolated strain C1 single colony was transferred to a test tube containing 5 mL of liquid culture medium and cultured at 30°C and 220 rpm with shaking for 24 hours. 10 μL of the seed liquid was then spotted on an organophosphate solid culture medium and cultured in a constant temperature incubator at 30°C. The colonies were observed for signs of degradation and transparent zones around them. The results showed that after two days of culture on the organophosphate solid culture medium, a clear degradation transparent zone appeared around the colonies of strain C1. With continued culture, the degradation zone significantly increased, indicating that strain C1 can rapidly dissolve organophosphate and has strong phosphate-solubilizing properties ( Figure 6 ).

[0043] A single colony of the isolated strain C1 was transferred to a test tube containing 5 mL of liquid culture medium and cultured at 30°C, 220 rpm, and shaking for 24 hours. 10 μL of the seed solution was then spotted onto an inorganic phosphorus solid culture medium and cultured in a 30°C incubator. After 3 days of culture, a clear, transparent degradation zone formed around the colony, indicating that strain C1 could dissolve inorganic phosphorus and had phosphate-solubilizing properties ( Figure 7 ).

[0044] The composition of the liquid culture medium is as follows: 1 g of peptone, 0.5 g of yeast powder, and 10 g of sodium chloride per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.0.

[0045] The composition of the potassium-dissolving medium is as follows: 5 g of sucrose, 0.5 g of ammonium sulfate, 0.5 g of yeast extract, 0.3 g of magnesium sulfate, 2 g of disodium hydrogen phosphate, 0.03 g of ferrous sulfate, 0.03 g of manganese sulfate, 2 g of potassium feldspar, and 15 g of agar powder per 1000 mL of distilled water, pH 7.5.

[0046] The composition of the above-mentioned organophosphorus solid culture medium is as follows: 10 g of glucose, 0.5 g of ammonium sulfate, 10 g of sodium chloride, 0.3 g of magnesium sulfate, 0.03 g of manganese sulfate, 0.3 g of potassium chloride, 0.03 g of ferrous sulfate, 2.0 g of lecithin, and 15 g of agar powder per 1000 mL of distilled water, pH 7.5.

[0047] The composition of the inorganic phosphorus solid culture medium is as follows: 10 g glucose, 0.5 g ammonium sulfate, 10 g sodium chloride, 0.3 g magnesium sulfate, 0.03 g manganese sulfate, 0.3 g potassium chloride, 0.03 g ferrous sulfate, 5.0 g calcium phosphate, and 15 g agar powder per 1000 mL distilled water, pH 7.5.

[0048] Example 4 16S rRNA gene identification method of strain C1 Total genomic DNA from strain C1 was extracted and purified according to the instructions of the BioTeKe Bacterial Genomic Extraction Kit. The extracted total genomic DNA was analyzed by 1% agarose gel electrophoresis at 175 V for 20 minutes. The 16S rRNA gene of the isolated strain was amplified using upstream primer 27F, as shown in SEQ ID NO. 2 (5'-3': AGAGTTTGATCCTGGCTCAG), and downstream primer 1492R, as shown in SEQ ID NO. 3 (5'-3': GGTTACCTTGTTACGACTT). The PCR reaction system and conditions are shown in Tables 1 and 2.

[0049] Table 1 PCR reaction system of purified 16S rRNA gene of strain C1

[0050] Table 2 PCR reaction program settings

[0051] PCR products were examined by 1% agarose gel electrophoresis at 175 V for 20 minutes. Using a gel imager, the 16S rRNA gene PCR marker band was located near the 1.5 kbp position. After excising the desired band, the PCR product was purified according to the instructions of the agarose gel extraction kit. The purified PCR product was sent to a sequencing company for sequencing.

[0052] The results of 16S rRNA gene sequencing of strain C1 showed that the gene length was 1402 bp, and the corresponding nucleotide sequence is shown in SEQ ID NO.1.

[0053] The specific sequence is as follows:

[0054] The 16S rRNA gene sequence obtained by sequencing was submitted to the NCBI database (http: / / www.ncbi.nlm.nih.gov) for BLASTN comparison. The results showed that the 16S rRNA of this strain was similar to that of Paenibacillus gloeosporioides ( Paenibacillus mucilaginosus ) VKPM B-7519 with a similarity of 99.86%. The 16S rDNA sequences of 10 sequences with high homology were selected as references, and a phylogenetic tree was constructed between strain C1 and the reference strain using the Neighbor-Joining method using Mega 7 software. In the phylogenetic tree, strain C1 and the model strain of Paenibacillus mucilaginosus Paenibacillus mucilaginosus strain VKPM B-7519 formed a separate intracluster evolutionary branch ( Figure 8 ), therefore, it was named Paenibacillus mucilaginosus C1.

[0055] Example 5 Application of strain C1 in chitin degradation (1) Bacterial strain selection: Paenibacillus subtilis strain C1.

[0056] (2) Activation of bacterial strains: Inoculate the bacterial strains onto an activated solid culture plate, incubate at 28-30°C for 24-48 hours, and set aside.

[0057] (3) Pick the colony from step (2) and inoculate it into 5 mL of liquid culture medium containing colloidal chitin as the sole carbon source, and culture it at 30°C and 220 rpm for 24 h.

[0058] (4) Chitin degradation: Take 5uL and spot-inoculate it on a colloidal chitin solid plate. At the same time, inoculate the activated seed liquid into a liquid culture medium containing chitin as the only carbon source at a 1% inoculation rate. Place the solid plate in a static culture at 30°C, and culture the liquid at 30°C and 220 rpm for 3-5 days. Observe the degradation of the chitin degradation circle on the plate and the degradation of the liquid chitin.

[0059] The results showed that after one day of fermentation, a clear chitin degradation zone could be observed. After three days of culture, the degradation zone was significantly enlarged. Figure 4 As shown in Figure A, at the same time, the colloidal chitin in the liquid culture medium also decreased significantly. After 3 days of culture, the colloidal chitin in the liquid culture medium was completely degraded (as shown in Figure A). Figure 4 (as shown in B in Figure 3), indicating that Paenibacillus mucilaginosus has great application potential in chitin degradation.

[0060] The composition of the activated solid culture plate for the above-mentioned Paenibacillus mucilaginosus C1 is as follows: 10 g of sucrose, 0.5 g of dipotassium hydrogen phosphate trihydrate, 10 g of sodium chloride, 0.2 g of magnesium sulfate heptahydrate, 1.0 g of calcium carbonate, 0.5 g of yeast extract, and 15 g of agar powder per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.0.

[0061] The composition of the colloidal chitin sole carbon source liquid culture medium is as follows: 5 g of colloidal chitin, 0.5 g of yeast extract, 1.0 g of potassium dihydrogen phosphate, 1 g of ammonium sulfate, 0.3 g of magnesium sulfate, 0.02 g of ferrous sulfate, 30 g of sodium chloride, and 3 g of yeast powder per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.0.

[0062] Example 6 Extraction of exopolysaccharides from the fermentation broth of strain C1 (1) Bacterial strain selection: Paenibacillus subtilis strain C1; (2) Activation of bacterial strains: Inoculate the bacterial strains onto a solid culture medium for bacterial activation, incubate at 28-30°C for 24-48 hours, and set aside. (3) Seed culture: Pick the colony from step (2) and inoculate it into 5 mL of liquid seed culture medium, and culture it at 30°C and 220 rpm for 12-24 h;

[0063] (4) Fermentation culture: Inoculate the seed liquid into a 500 mL flask containing 200 mL of fermentation medium at a 1% inoculum volume and culture at 30°C and 220 rpm for 48 h to obtain the Bacillus subtilis fermentation liquid; (5) Ethanol extraction of extracellular polysaccharides: Add 4 times the volume of anhydrous ethanol to the fermentation broth, that is, the volume ratio of fermentation broth to anhydrous ethanol is 1:4, mix well and place at 4℃ overnight, and flocculent suspension can be observed ( Figure 10 A in the figure is picked out with a clean glass rod and placed in a plate, which is the extracted extracellular polysaccharide ( Figure 10 B in ).

[0064] The activated solid medium and liquid seed culture medium for Paenibacillus mucilaginosus C1 are composed of: 10 g sucrose, 0.5 g potassium phosphate dihydrate, 10 g sodium chloride, 0.2 g magnesium sulfate heptahydrate, 1.0 g calcium carbonate, and 0.5 g yeast extract per 1000 mL of distilled water. The pH is adjusted to 7.5-8.0. (Note: 15 g agar powder is added to the solid medium.)

[0065] Example 7 Application of strain C1 in enhancing water retention capacity of sandy soil (1) Bacterial strain selection: Paenibacillus subtilis strain C1.

[0066] (2) Activation of bacterial strains: Inoculate the bacterial strains onto the solid culture medium for bacterial activation, incubate at 28-30°C for 24-48 hours, and set aside.

[0067] (3) Seed culture: Pick the colony from step (2) and inoculate it into 5 mL of liquid seed culture medium, and culture it at 30°C and 220 rpm for 12-24 h.

[0068] (4) Fermentation culture: Inoculate the seed liquid into a 500 mL flask containing 200 mL fermentation medium at a 1% inoculum volume, and culture at 30°C and 220 rpm for 48 h to obtain a bacterial suspension containing Bacillus subtilis. Dilute the suspension 5-fold and 10-fold, respectively, for later use.

[0069] (5) Soil column device: Use an acrylic soil column device with an inner diameter of 10 cm and a height of 70 cm, and install drainage valves at the middle and bottom of the column. Add sand (taken from 0-20 cm arable layer soil in Cao County, Heze, Shandong Province) into the soil column. The height of the sand in the soil column is 65 cm, and a height of 5 cm is left above the column for the flow of tap water ( Figure 11 ).

[0070] (6) Soil column water seepage test: The experiment set up three groups: CK (blank control group), D5 (5-fold dilution) and D10 (10-fold dilution). 50 ml of tap water, 5-fold dilution of bacterial solution and 10-fold dilution of bacterial solution were sprayed into the three groups at different times. After standing for 1 hour after spraying, water was added to the column in a laminar flow so that the water surface was 5 cm higher than the soil layer. The water migration distance (the distance from the infiltrated water to the top of the soil column) was measured at 5 min, 15 min, 30 min, 60 min, 120 min, 180 min, 240 min and 300 min respectively. When water leaked out of the bottom drain valve, water addition was stopped and the time was recorded. At the same time, the migration time of the water migration peak reaching the middle and bottom of the column was recorded.

[0071] The results showed that the water migration rate of the sand column with the addition of diluted bacterial solution was significantly reduced ( Figure 12 ), the time it took for the water migration peak of D5 and D10 to reach the center of the column was 8.6 times and 4.6 times that of the control, respectively, and the time it took to reach the bottom of the column was 7 times and 3 times that of the control, respectively. Therefore, it can be confirmed that the fermentation broth of Paenibacillus mucilaginosus can effectively prolong the retention time of water in sandy soil and enhance the water retention capacity of sandy soil. The average migration rates of CK, D5, and D10 were approximately 13 cm / h, 1.8 cm / h, and 4.3 cm / h, respectively.

[0072] Table 3 The duration of the wetting peak migration to the column and the column bottom

[0073] The activated solid medium and liquid seed culture medium for Paenibacillus mucilaginosus C1 are composed of: 10 g sucrose, 0.5 g potassium phosphate dihydrate, 10 g sodium chloride, 0.2 g magnesium sulfate heptahydrate, 1.0 g calcium carbonate, and 0.5 g yeast extract per 1000 mL of distilled water. The pH is adjusted to 7.5-8.0. (Note: 15 g agar powder is added to the solid medium.)

[0074] Example 8: Application of strain C1 in alleviating the inhibitory effect of salt stress on rice growth (1) Bacterial strain selection: Paenibacillus subtilis strain C1.

[0075] (2) Activation of bacterial strains: Inoculate the bacterial strains onto the solid culture medium for bacterial activation, incubate at 28-30°C for 24-48 hours, and set aside.

[0076] (3) Seed culture: Pick the colony from step (2) and inoculate it into 5 mL of liquid seed culture medium, and culture it at 30°C and 220 rpm for 12-24 h.

[0077] (4) Fermentation culture: Inoculate the seed liquid into a 500 mL flask containing 200 mL of fermentation medium at a 1% inoculum volume, and culture at 30°C and 220 rpm for 48 h to obtain a bacterial suspension containing Bacillus subtilis C1 for later use.

[0078] (5) Alleviation of the inhibitory effect of salt stress on rice growth and detection of soluble potassium and phosphorus in the soil: Rice seeds were first soaked in tap water for 24 ± 2 h. The seeds of uniform size and fullness were evenly arranged in pots (30 cm × 24 cm × 9 cm) filled with an equal amount of sterilized nutrient soil watered with 7‰ NaCl solution. The C1 bacterial suspension obtained by fermentation was diluted 10 times to obtain C1 bacterial suspension. The diluted C1 bacterial solution was watered into the pots of the experimental group, while the inactivated bacterial solution was used as a control. All pots were watered with 7‰ NaCl solution. The 7‰ NaCl solution was watered every other day. After ten days, the growth of rice seedlings was observed and the content of soluble potassium and soluble phosphorus in the soil around the rice roots was detected. Each treatment was repeated three times, with 40 rice seeds placed in each repeat.

[0079] The results showed that under the condition of continuous irrigation of 7‰ NaCl solution, the growth of rice seedlings in the experimental group was significantly better than that in the control group, proving that strain C1 can significantly alleviate the inhibitory effect of salt stress on rice seedling growth ( Figure 13By measuring the physical and chemical indicators of the soil around the rice rhizosphere, it was found (Table 4) that the soluble potassium and soluble phosphorus contents in the soil around the rice rhizosphere added with the C1 bacterial solution were significantly increased compared with the control group. The soluble potassium content in the soil increased by up to 46.1%, and the soluble phosphorus content in the soil increased by up to 36.6%.

[0080] Table 4 Results of soluble phosphorus and soluble potassium in the soil around rice roots

[0081] The activated solid medium and liquid seed culture medium for Paenibacillus mucilaginosus C1 are composed of: 10 g sucrose, 0.5 g potassium phosphate dihydrate, 10 g sodium chloride, 0.2 g magnesium sulfate heptahydrate, 1.0 g calcium carbonate, and 0.5 g yeast extract per 1000 mL of distilled water. The pH is adjusted to 7.5-8.0. (Note: 15 g agar powder is added to the solid medium.)

Claims

1. A strain of Paenibacillus subtilis C1, characterized in that: The deposit number of the gelatinous bacillus C1 is CGMCC No. 30802, and it was deposited in the General Microbiology Center of the China Culture Collection Administration on May 28, 2024, and was classified as gelatinous bacillus Paenibacillus mucilaginosus .

2. The Paenibacillus mucilaginosus C1 according to claim 1, characterized in that The nucleotide sequence of the 16S rRNA gene of Paenibacillus mucilaginosus C1 is shown in SEQ ID NO.

1.

3. Use of the Paenibacillus mucilaginosus C1 as claimed in claim 1 for increasing available potassium and effective phosphorus in saline-alkali soil under salt stress conditions.

4. The use according to claim 3, characterized in that The salt stress refers to saline-alkali soil with a salt concentration mass ratio of not less than 2‰ in the soil.

5. The use according to claim 3 or 4, characterized in that The following steps are involved: (1) inoculating the activated Paenibacillus subtilis C1 seed liquid into a fermentation liquid medium for cultivation to obtain a suspension containing Paenibacillus subtilis; (2) Dilute the microbial suspension obtained by fermentation and apply the diluted microbial suspension to the saline-alkali soil.

6. The use according to claim 5, characterized in that In step (1), the inoculation is carried out by inoculating the activated Paenibacillus subtilis seed solution at a volume ratio of 1-2%.

7. The use according to claim 5, characterized in that In step (1), the composition of the fermentation liquid culture medium is as follows: 10 g sucrose, 0.5 g dipotassium hydrogen phosphate trihydrate, 10 g sodium chloride, 0.2 g magnesium sulfate heptahydrate, 1.0 g calcium carbonate, and 0.5 g yeast extract per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.

0.

8. The use according to claim 5, characterized in that In step (1), the culture conditions are 28-30°C and 220 rpm for 24-48 hours.

9. The use according to claim 5, characterized in that In step (2), the concentration of the diluted Paenibacillus subtilis suspension is 1×10 7 cfu / mL~1×10 8 cfu / mL.

10. Use of the Paenibacillus subtilis C1 according to claim 1 or 2 in improving the water retention function of sandy soil.

Images