Composting method based on coordinated regulation and control of in-situ photo-Fenton and functional additive

Abstract

The invention discloses a composting method based on in-situ photo-Fenton and functional additive cooperative regulation and control, and belongs to the technical field of composting. The composting method comprises the following steps: adding an in-situ photo-Fenton reagent and a functional additive into the forestry residues, adjusting the C / N ratio and the water content, adding an EM microbial agent, uniformly mixing, carrying out aerobic composting under sunlight, and ending composting when a compost body is close to room temperature; wherein the in-situ photo-Fenton reagent comprises pyrite and ascorbic acid, and the functional additive comprises at least one of tea waste and charcoal. Experiments show that by adding the functional additive constructed by the tea waste and the biochar into the forestry residues, the effect of an in-situ photo-Fenton process in forestry residue compost can be optimized, the problems of slow iron ion conversion, poor in-situ photo-Fenton performance and the like can be effectively solved, the degradation efficiency of a system on lignocellulose is improved, and the energy consumption of the system is reduced. Decomposition of organic matters in the composting process of the forestry residues is accelerated, and more favorable conditions are provided for the composting process.

Description

Technical Field

[0001] The present invention relates to the technical field of composting, and in particular to a composting method based on the coordinated regulation of in-situ photo-Fenton and functional additives. Background Art

[0002] With the growing global emphasis on ecological progress, environmental protection has become a universal consensus and shared goal across all sectors of society. The continued expansion of green areas in cities has led to a dramatic increase in forestry waste. The scientific and rational disposal of this waste has become a pressing environmental issue. Composting, as an economical and environmentally friendly treatment method, has become a leading technology for treating forestry waste.

[0003] Forestry residues come from a wide range of sources, mainly including naturally fallen branches and leaves of garden plants in urban greening construction, waste generated by artificial greening pruning, and by-products such as woody waste derived from other industries. This type of waste contains a large amount of cellulose, of which lignin accounts for between 23% and 30%, cellulose accounts for 45% to 50%, and hemicellulose accounts for 20% to 30%. These components are closely intertwined to form a strong and stable network structure, which significantly increases the difficulty of waste treatment and has an adverse effect on the efficiency and quality of composting, making the composting of forestry residues face many challenges. Therefore, accelerating the degradation process of forestry residues and improving the quality and efficiency of composting have become research focuses in this field.

[0004] As research continues, it has been discovered that the hydroxyl radicals produced by the photo-Fenton process have the ability to oxidize fibers. These radicals can disrupt the bonds between lignin and hemicellulose, providing more binding sites for lignin-degrading enzymes and thereby improving lignin degradation efficiency. This holds significant promise for promoting the application of the photo-Fenton process in composting. However, the traditional photo-Fenton process has limitations. In response, research has proposed the in situ photo-Fenton oxidation method. This method utilizes pyrite and organic acids to generate hydrogen peroxide (H2O2) in situ, effectively addressing the high H2O2 consumption and low utilization rate inherent in traditional photo-Fenton technology. Given its advantages, such as strong oxidizing properties and high reaction rates, the in situ photo-Fenton oxidation method holds great promise for its application in forestry residue composting.

[0005] Although the in-situ photo-Fenton process can produce a large amount of active oxygen and effectively improve the degradation rate of complex organic matter such as lignocellulose, the reaction depends on the presence of trivalent iron (Fe 3+ ) / Fe 2+ ) cycle. Due to the difference in rate constants, Fe 3+ Reduction to Fe 2+The process is very slow, resulting in a slow overall cycle rate, which in turn affects the performance of the photo-Fenton reaction. As the core of the in situ photo-Fenton reaction, the number of hydroxyl radicals is mainly composed of Fe 2+ and H2O2. If the system cannot maintain a high concentration of Fe 2 + , hydroxyl radicals will be difficult to generate effectively, which will seriously inhibit the degradation of lignocellulose and may prolong the time for compost maturity.

[0006] In addition, in the complex organic environment of composting, iron ions easily form complexes with humic acid, lignin degradation intermediates, etc., and then produce iron sludge precipitation. This precipitation not only reduces the density of catalytic active sites, but also blocks the pores of the compost, hinders the diffusion of oxygen, and inhibits the activity of microorganisms. Therefore, in order to enhance the Fe 3+ It is of great significance to further improve the composting microenvironment, enhance microbial activity, and improve the quality of compost products by exploring additives with excellent effects.

[0007] In view of this, there is an urgent need in this field to develop a functional additive to improve the application of in-situ photo-Fenton technology in composting. This additive should not only eliminate the drawbacks of in-situ photo-Fenton technology, but also improve the efficiency of composting forestry residues. Specifically, it is necessary to solve problems such as the slow conversion rate of iron ions, break through the bottleneck of free radical generation, and further improve the ability of free radicals to degrade lignocellulose. If such a technology can be successfully developed, it is expected to be applied to the composting of forestry residues, accelerate the degradation process of lignocellulose, shorten the composting cycle, and ultimately improve the efficiency and quality of composting. Summary of the Invention

[0008] The purpose of the present invention is to provide a composting method based on the coordinated regulation of in-situ photo-Fenton and functional additives to solve the problems existing in the above-mentioned prior art. By constructing a functional additive composed of tea waste and biochar, the effect of the in-situ photo-Fenton process in the composting of forestry residues can be optimized, the synergistic effect of the two can be fully utilized, and the problems such as slow iron ion conversion and poor in-situ photo-Fenton performance can be effectively solved. The degradation efficiency of the system for lignocellulose is improved, the decomposition of organic matter in the composting process of forestry residues is accelerated, and more favorable conditions are provided for the composting process.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010] The present invention provides a composting method based on the coordinated regulation of in-situ photo-Fenton and functional additives, comprising the following steps:

[0011] In situ photo-Fenton reagent and functional additives are added to forestry residues, the C / N ratio and moisture content are adjusted, EM inoculum is added, mixed evenly and then aerobic composting is carried out under sunlight. Composting is completed when the pile approaches room temperature.

[0012] The in-situ photo-Fenton reagent includes pyrite and ascorbic acid, and the functional additive includes at least one of tea waste and biochar.

[0013] Preferably, the added amount of the pyrite and ascorbic acid is 1% of the dry weight of the forestry residue respectively.

[0014] Preferably, the amount of the tea waste added is 0-15% of the dry weight of the forestry residues, and the amount of the biochar added is 0-20% of the dry weight of the forestry residues.

[0015] Preferably, the amount of tea waste added is 5% of the dry weight of the forestry residues, and the amount of biochar added is 10% of the dry weight of the forestry residues.

[0016] Preferably, the C / N ratio is 25%-30% and the moisture content is 60%.

[0017] Preferably, based on the dry weight of the forestry residues, 10 g of the EM bacterial agent is added to every 1 kg of the forestry residues.

[0018] The present invention also provides an in-situ photo-Fenton reagent for composting, wherein the in-situ photo-Fenton reagent comprises pyrite and ascorbic acid, and the weight ratio of the pyrite to the ascorbic acid is 1:1.

[0019] The present invention also provides a functional additive for composting, wherein the functional additive comprises at least one of tea waste and biochar, and the weight ratio of the tea waste to the biochar is 0-15:0-20.

[0020] The present invention also provides the use of the composting method, the in-situ photo-Fenton reagent or the functional additive in improving the iron ion conversion rate or composting efficiency.

[0021] The present invention also provides the use of the composting method, the in-situ photo-Fenton reagent or the functional additive in improving the safety of compost products or improving the seed germination index.

[0022] The present invention discloses the following technical effects:

[0023] (1) The in-situ photo-Fenton process of the present invention is a key technology to drive the overall efficiency of forestry residue composting to a leap forward.

[0024] Principle of in-situ photo-Fenton reagent: The in-situ photo-Fenton reagent combination (pyrite and ascorbic acid) will undergo a chemical reaction under the irradiation of sunlight, thereby producing a large amount of H2O2, ensuring the continuous generation of hydroxyl radicals. Hydroxyl radicals have strong oxidizing properties and can oxidize and destroy the CO bonds and CC bonds in the lignin structure, promote the degradation and mineralization of difficult-to-degrade organic matter, make the interior of the compost fluffy, and effectively alleviate the anaerobic environment. It can also provide a substrate for laccase, increase the activity of laccase, and thus accelerate the composting process. In addition, hydroxyl radicals can promote the decomposition of fulvic acid into stable humic acid, thereby enhancing the complexity of humus. And Fe 2+ It can accelerate the redox cycle of peroxidase and increase the activity of lignin peroxidase.

[0025] This method addresses the key challenges faced by traditional composting of forestry residues, such as the difficulty in degrading lignocellulose, the long composting cycle, and low processing efficiency. By leveraging the strong oxidizing properties of hydroxyl radicals generated by the in-situ photo-Fenton process, it precisely attacks and destroys the structure of lignocellulose, significantly improving the overall efficiency of composting. This method effectively breaks down barriers between disciplines, providing a solid theoretical basis for the collaborative optimization of composting using multiple technologies and creating a practical example for reference, thus opening up a new path for the innovative development of composting technology.

[0026] Through interdisciplinary innovation, this invention successfully overcomes the limitations of traditional composting technology, which relies solely on microbial activity, by incorporating the highly successful in-situ Photo-Fenton process from environmental chemistry into the composting process. By combining this technology with composting, the researchers aim to improve the efficiency of lignocellulose degradation, shorten the composting cycle, and accelerate the composting process, thereby broadening the application prospects of composting technology and promoting the resource utilization of forestry residues.

[0027] (2) The present invention is based on the synergistic effect of in-situ photo-Fenton and functional additives to promote the oxidation efficacy and efficiency improvement mechanism of forestry residue composting.

[0028] The working principle of tea waste: Tea polyphenols are natural chelating agents and reducing agents, including catechins, flavonoids and their glycosides, phenolic acids and proanthocyanidins. They have a wide pH range of application and are easy to react with Fe at neutral pH. 2+ or Fe 3+ The combination forms a stable complex, which has great potential in accelerating the in-situ photo-Fenton reaction rate and enhancing the degradation efficiency. Studies have shown that tea polyphenols accelerate the Fe 2+ / Fe 3+ The circulation speed is increased, which reduces the amount of in-situ photo-Fenton reagent and produces more hydroxyl radicals.

[0029] The working principle of biochar: As a green and cheap biomass-derived carbon material, biochar can directly participate in the degradation as an electron donor, and can also indirectly participate in the removal of target degradation products as an electron shuttle. At the same time, the persistent free radicals, oxygen-containing functional groups and edge defects of biochar itself have redox activity, which can promote the 3+ Electron transfer occurs between biochar and Fe 2+ It can effectively activate the oxidant and enhance the in situ photo-Fenton reaction.

[0030] The combined application of tea waste and biochar as functional additives can achieve a synergistic effect: tea waste is rich in nutrients and exogenous microorganisms, providing abundant nutrition and energy for microorganisms, while the porous nature of biochar provides a favorable living environment for microorganisms. The combination of these two enhances microbial enzyme production, heat production, and degradation. The high adsorption capacity of biochar and the abundant surface functional groups of tea waste provide a suitable microenvironment for enzymes, enhancing their adsorption and stability, allowing them to maintain activity during the composting process and continuously act on their target biodegradable products. The addition of biochar may inhibit the abundance or activity of certain bacteria, leading to a decrease in bacterial community diversity. However, the rich microbial communities, water-soluble compounds, and nitrogen compounds inherent in tea waste can contribute to a greater number of microorganisms and a greater variety of species during the composting process, accelerating microbial community succession and compensating for the shortcomings of biochar.

[0031] The functional additive composed of tea waste and biochar constructed in the present invention can not only further promote the conversion of iron ions and the generation of hydroxyl radicals in the in situ photo-Fenton reaction and significantly improve the reaction performance, but also break through the functional limitations of a single additive and construct a complete metabolic chain from organic matter decomposition to product maturation, providing a theoretical paradigm for the development of composite compost functional additives.

[0032] The addition of the functional additive of the present invention optimizes the in-situ photo-Fenton process in forestry residue composting. It effectively addresses issues such as slow iron ion conversion and poor in-situ photo-Fenton performance, improves the system's efficiency in degrading lignocellulose, accelerates the decomposition of organic matter during forestry residue composting, and provides more favorable conditions for the composting process. Consequently, composting efficiency is significantly improved, cycle times are shortened, and compost product quality is optimized, achieving a multi-dimensional upgrade in composting technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] Figure 1 The temperature changes of T2-T9 and the control group (T1) during the composting reaction in the embodiment;

[0035] Figure 2 The pH changes of T2-T9 and the control group (T1) during the composting reaction in the examples;

[0036] Figure 3 The changes in electrical conductivity during the composting reaction of T2-T9 and the control group (T1) in the examples;

[0037] Figure 4 The changes in organic matter degradation rates during the composting process for T2-T9 and the control group (T1) in the examples;

[0038] Figure 5 The changes in humus during the composting process of T2-T9 and the control group (T1) in the examples;

[0039] Figure 6 The changes of hydrogen peroxide in T2-T9 and the control group (T1) during the composting reaction in the example;

[0040] Figure 7 The changes of hydroxyl radicals in T2-T9 and the control group (T1) during the composting reaction in the examples;

[0041] Figure 8 Fe in the composting process of T2-T9 and the control group (T1) in the embodiment 3+ / Fe 2+ Changes and ratios between them; (a) Fe 3+ Content changes, (b) Fe 2+ Content changes, (c) Fe 3+ / Fe 2+ changes;

[0042] Figure 9 The changes of polyphenols during the composting reaction of T2-T9 and the control group (T1) in the examples;

[0043] Figure 10 The changes in ammonium nitrogen and nitrate nitrogen and their ratios during the composting reaction of T2-T9 and the control group (T1) in the examples are shown; (a) changes in ammonium nitrogen content, (b) changes in nitrate nitrogen content, and (c) changes in ammonium nitrogen / nitrate nitrogen;

[0044] Figure 11 The changes of laccase during the composting reaction of T2-T9 and the control group (T1) in the example;

[0045] Figure 12The changes of catalase during the composting reaction of T2-T9 and the control group (T1) in the example;

[0046] Figure 13 The changes in bacterial community phylum levels at different stages during the composting reaction of T2-T9 and the control group (T1) in the examples; (a)-(c) represent the temperature rise period, high temperature period, and temperature fall period of the composting, respectively;

[0047] Figure 14 The changes in bacterial community genus levels during the warming period of the composting reaction in T2-T9 and the control group (T1) in the example;

[0048] Figure 15 The changes in bacterial community genus levels during the high-temperature period of the composting reaction in T2-T9 and the control group (T1) in the example;

[0049] Figure 16 The changes in bacterial community genus levels during the cooling period of the composting reaction in T2-T9 and the control group (T1) in the example;

[0050] Figure 17 The changes in seed germination index during the composting reaction of T2-T9 and the control group (T1) in the example. DETAILED DESCRIPTION

[0051] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0052] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0053] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0054] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0055] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0056] The room temperature in the present invention refers to 25±2°C.

[0057] The forestry residues in the embodiments of the present invention are the dead branches and leaves produced during the landscape maintenance of the Beijing National Botanical Garden in the autumn of 2024 and the spring of 2025. The tea waste used in the embodiments of the present invention was purchased from Tianhe Tea House in Huaining County, Anqing City, Anhui Province. It is the secondary tea, coarse old stem leaves and tea ash produced in the primary and fine processing of tea, containing tea polyphenols, vitamin C, amino acids and other substances. Biochar was purchased from Shengxiang Activated Carbon Business Department in Gongyi City, Zhengzhou City, Henan Province. It is a product of thermal cracking of bamboo. The main component is carbon molecules, with a particle size of 1-3 mm, a carbon content of 58.92%, a hydrogen content of 1.87%, and a specific surface area of ​​390 m 2 / g. EM microbial agent was purchased from Guoyou Ecological Environment Technology Co., Ltd., Hangzhou, Zhejiang Province.

[0058] Example 1 A composting method based on the coordinated regulation of in-situ photo-Fenton and functional additives

[0059] This experiment was conducted at the Beijing National Botanical Garden (40°00′64″N - 116°20′22″E) from July to September 2024. The region has a semi-humid, semi-arid monsoon climate, with an average temperature of 23.5°C and an average daily sunshine duration of 14.3 hours.

[0060] 1. Experimental Design

[0061] 1.1 Grouping: Eight experimental groups (T2-T9) and one control group (T1) were set up. The experimental groups used the composting technology of the present invention using the synergistic action of the in situ photo-Fenton reagent and functional additives, while the control group used the traditional natural composting method (only the in situ photo-Fenton reagent was added without the functional additives). See Table 1. Three replicates were set up for each treatment.

[0062] 1.2 Methods: Forestry residues were crushed into 5-20 mm long segments. Tea waste and biochar were added to the dry weight of 60 kg of forestry residues according to Table 1. In situ photo-Fenton reagent (1% pyrite and 1% organic acid, %: percentage of the dry weight of forestry residues) was added to each treatment. Water was added to adjust the moisture content to 60 ± 5%, and urea was added to adjust the C / N ratio to 25-30%. EM inoculant was added (10 g EM inoculant was added per 1 kg of forestry residues). After mixing, the mixture was piled into a conical pile in a greenhouse (with sunlight).

[0063] Table 1

[0064]

[0065] During the composting process, samples were collected on days 0, 4, 7, 11, 25, 32, 39, 41, 42, 43, 44, and 45. During the sampling process, 200 g of sample was collected from the top, middle, and bottom of each compost pile, mixed evenly, and divided into three parts: the first part of the test sample was air-dried for determination of organic matter and other indicators; the second part, as a fresh sample, was placed in a plastic bag and stored in a refrigerator (4°C) for determination of indicators such as pH and reactive oxygen species; and the third part was placed in a refrigerator (-80°C) for microbial community analysis.

[0066] 1.2.1 Physical and chemical indicators

[0067] (1) Temperature monitoring: During the composting process, the temperature of the pile is measured daily using a probe thermometer. The specific operation method is: select three evenly distributed detection points, perform insertion measurement, and then take the average of the readings of the three measurement points as the compost temperature data for that day. This temperature measuring device can also be used to measure the ambient temperature. When the pile temperature is equal to or lower than the room temperature, it indicates that the composting is complete.

[0068] (2) pH and EC value: pH changes are shown in Figure 2 , the changes in electrical conductivity (EC) are shown in Figure 3 The pH and conductivity were determined by directly measuring the pH and EC values ​​of the filtrate after the sample was mixed with deionized water in a volume ratio of 1:10 using an MP521 pH / EC meter (Shanghai, China).

[0069] (3) Organic matter degradation: For changes in organic matter, see Figure 4 , the determination of organic matter was carried out by potassium dichromate titration method.

[0070] (4) Humus content: See the changes in humus content in Figure 5 The determination of humus was carried out by sodium pyrophosphate alkaline solution extraction method.

[0071] 1.2.2 In situ photo-Fenton reaction related indicators

[0072] Hydrogen peroxide (H2O2) content: Changes in H2O2 content were determined by spectrophotometry.

[0073] Hydroxyl free radical: Changes in hydroxyl free radical content were determined using the thiobarbituric acid (TBA) method, and the absorbance at 532 nm was used to indicate its activity.

[0074] Iron ion conversion: the changes between iron ions, using the o-phenanthroline colorimetric method to determine Fe 2+ and Fe 3+ content.

[0075] Polyphenol content: Changes in polyphenol content were determined using the Folin-phenol colorimetric method.

[0076] 1.2.3 Nutrient indicators

[0077] Nitrogen transformation: Changes in the content of ammonium nitrogen and nitrate nitrogen were determined by ultraviolet spectrophotometry.

[0078] 1.2.4 Microbiological indicators

[0079] Enzyme activity analysis: The samples were stored at 4°C, and the activities of laccase and catalase were measured and compared with the control group (T1). The laccase and catalase were determined by ABTS method and potassium permanganate titration method, respectively. The changes were shown in Table 1. Figure 11 and Figure 12 .

[0080] Microbial Community Analysis: Samples were stored at -80°C, and changes in their microbial communities were measured. High-throughput sequencing was used to investigate the dynamics of bacterial communities in the compost products obtained from samples T2-T9 and the control (T1) during the composting of forestry residues. Total DNA was extracted from the compost samples using the FastDNA® Spin Kit for Soil (MPBio, USA). Polymerase chain reaction (PCR) amplification was performed on an ABI GeneAmp® Model 9700 thermal cycler using primers 338F (ACTCCTACGGGAGGCAGCAG, SEQ ID NO. 1) and 806R (GGACTACHVGGGTWTCTAAT, SEQ ID NO. 2). Sequencing reads were filtered and quality controlled using QIIME (version 2.0). Qualified reads were clustered into operational taxonomic units (OTUs) using UPARSE at a 97% similarity threshold, and OTUs were classified using the SILVA database (version 132). The Majorbio I-Sanger cloud platform (http: / / www.iSanger.com) was used to analyze the bacterial community composition and differences.

[0081] 1.2.5 Toxicity indicators

[0082] Seed germination experiment: The compost products obtained from treatments T2-T9 in the examples and the control group (T1) were used in a seed germination experiment. Specifically, 5 mL of the compost sample was thoroughly shaken with distilled water, and the filtrate was placed on filter paper in a sterile Petri dish. 5 mL of distilled water was used as a control. Uniformly sized Brassica parachinensis seeds were evenly placed in each Petri dish. The dishes were incubated in a dark incubator at 25°C for two days, keeping the filter paper moist. Each treatment was repeated three times, and the germination index was calculated. The germination index was calculated as follows: Germination index = (average number of germinated seeds in treatment group × average radicle root length in treatment group × 100) / (average number of germinated seeds in control group × average radicle root length in control group).

[0083] 2. Results and Analysis

[0084] 2.1 Physical and chemical index determination results

[0085] After adding tea waste and biochar, the temperature of the pile was significantly regulated. Figure 1Figure 2 shows the temperature changes during the composting process for T2-T9 and the control (T1). The figure shows that the addition of functional additives shortened the composting process, resulting in higher peak temperatures, a longer thermophilic period, and a shorter composting cycle. The experimental groups (T2-T9) exhibited superior temperature rise rates compared to the control (T1). The thermophilic peaks exceeded 60°C for T6 (15% tea waste + 10% biochar), T3 (15% tea waste), and T9 (15% tea waste + 20% biochar). Furthermore, the composting cycle for T5 (5% tea waste + 10% biochar) and T6 was shortened to 38 days, completing composting two days earlier than the control. Overall, T5 (5% tea waste + 10% biochar) achieved fully mature compost within 38 days, reaching a maximum temperature of 58.2°C. In contrast, the composting cycle for T1 (without functional additives) lasted 40 days.

[0086] In the complex organic environment of composting, iron ions easily form complexes to produce iron sludge precipitation, which reduces the density of catalytic active sites, blocks the pores of the compost, hinders oxygen diffusion, inhibits microbial activity, and affects the chemical environment of the compost. The addition of tea waste and biochar can regulate pH and EC values ​​and optimize the chemical environment. Figure 2 and Figure 3 As shown, the pH values ​​of the experimental groups (T2-T9) decreased by 1.6-5.9%, while the EC values ​​increased by 2.9-66.3% (except T7), all falling within the acceptable range for application (pH: 6.5-7.5; EC: <4.0 mS / cm). Appropriate pH and EC levels provide a favorable environment for microorganisms, promoting their decomposition of organic matter. This also facilitates the continued in situ photo-Fenton reaction and improves the quality of the compost product. In particular, treatment T5 (5% tea waste + 10% biochar) achieved the optimal pH and inorganic salt content within the compost during the composting process.

[0087] Depend on Figure 4 The addition of functional additives promoted organic matter degradation during composting of forestry residues, with organic matter degradation rates ranging from 39.9% to 45.5% across all treatments. Compared to the control group, the degradation rates of the experimental groups increased by 0.1% to 5.6%, with treatments T5, T6, and T8 showing particularly significant effects. The organic matter degradation rate of the compost product containing T5 (5% tea waste + 10% biochar) increased by 5% compared to the control group (T1).

[0088] Depend on Figure 5It can be seen that the addition of functional additives promoted the maturation of the compost product, resulting in a faster increase in humus content during the composting process. Humus content increased in all experimental groups (T2-T9), with T6 and T8 showing the most significant increases, at 9.8% and 9.3%, respectively. Among the compost products, T5 (5% tea waste + 10% biochar) showed a 5.62% increase in humus content compared to the control group (T1).

[0089] 2.2 Results of in situ photo-Fenton reaction-related index determination

[0090] Depend on Figure 6 The addition of functional additives improved the recycling efficiency of iron ions, accelerated the rate of the in situ photo-Fenton reaction, and thus increased the H2O2 content. H2O2 levels increased to some extent in treatments T2, T3, T5, T6, T8, and T9. The maximum H2O2 content in the compost product T5 (5% tea waste + 10% biochar) increased by 23.9% compared to the control (T1).

[0091] Depend on Figure 7 It can be seen that the addition of functional additives significantly regulated the dynamic changes of hydroxyl radicals, and its changing trend was consistent with that of H2O2.

[0092] Depend on Figure 8 It can be seen that the addition of functional additives has a certain regulatory effect on the circulation of iron and the regeneration of H2O2 during composting. 2+ The content was 20.4%-47.2% higher than that of the control group, Fe 3+ The content decreased by 2.8%-17.5%, Fe 3+ with Fe 2+ The ratio (T2-T9) is finally lower than that of the control group (T1). This shows that the additive effectively increases the Fe 2+ The concentration provides sufficient raw materials for the generation of hydroxyl radicals, breaks through the bottleneck of free radical generation, improves the degradation ability of free radicals on lignocellulose, and accelerates the degradation process of organic matter.

[0093] Depend on Figure 9 The addition of functional additives improved the recycling efficiency and oxidation performance of iron ions during composting. The polyphenol concentration in the compost product T5 (5% tea waste + 10% biochar) ultimately remained low (0.5 mg / kg).

[0094] 2.3 Nutrient index measurement results

[0095] Depend on Figure 10The present invention improves the nutrient content of compost products by adding functional additives to forestry residues. Compared to T1, the ammonium nitrogen content of T5, T6, T7, and T8 decreased by 13.9%, 18.5%, 3.5%, and 15.5%, respectively. Nitrate nitrogen content increased, particularly in T5 and T8, which increased by 12.5% ​​and 14.9%, respectively. The ammonium nitrogen / nitrate nitrogen ratio of T5, T6, and T8 decreased by 25.1%, 29.8%, and 30.2%, respectively, compared to T1.

[0096] 2.4 Microbial index determination results

[0097] Depend on Figure 11 and Figure 12 The addition of functional additives increased enzyme activity during composting and promoted the growth and reproduction of microorganisms under the in situ photo-Fenton reaction. T5 (5% tea waste + 10% biochar) showed higher laccase and catalase activities during composting compared to the other treatments, reflecting the enhanced microbial activity under the T5 (5% tea waste + 10% biochar) treatment. T5, T6, and T8 performed best in terms of laccase increase rate and content, with peak values ​​increasing by 12.9%, 9.3%, and 18.0%, respectively, compared to T1. Catalase peak values ​​increased by 0.7%-14.2% in T2-T9 compared to T1, with T5 showing the largest increase, reaching 14.2%.

[0098] Depend on Figure 13-16 These results indicate that in situ photo-Fenton and functional additives can synergistically adjust the bacterial community structure in compost and enhance metabolic activity. During the warming period, the relative abundance of Proteobacteria increased by 1.6%-21.9% in treatments T2, T3, T5, T6, T8, and T9 compared to T1. During the high-temperature period, the relative abundance of Firmicutes increased by 36.4%-57.4% in treatments T4, T6, T8, and T9 compared to T1. At the genus level, the dominant genera varied among the treatments. Specifically, the relative abundance of Bacillus increased by 5.4%-20.8% in treatments T4, T6, and T8 compared to T1. This suggests that a suitable bacterial community structure is conducive to the decomposition of organic matter and the smooth progress of composting.

[0099] 2.5 Toxicity index determination results

[0100] Depend on Figure 17It can be seen that the addition of a functional additive during the combined in situ photo-Fenton degradation of compost lignin in the present invention can promote compost maturity and reduce its phytotoxicity. The seed germination index of all treatments exceeded 80%. The seed germination index of T4, T5, T7, and T8 increased by 1.4%-12.1% compared to T1. Among them, T5 (5% tea waste + 10% biochar) had the highest germination index, at 124.3%. The seed germination index is an important indicator of compost product toxicity. This additive reduces product toxicity and improves the safety of the compost product, making it more suitable for subsequent applications.

[0101] In summary, in the composting process of forestry residues, lignocellulose has a complex structure, and its chemical bonds are difficult to be effectively degraded and transformed by microorganisms, which greatly prolongs the composting cycle and reduces the efficiency of resource utilization. In response to this key issue, the present invention provides a composting method based on the coordinated regulation of in-situ photo-Fenton and functional additives, by adding functional additives to forestry residues to improve the application of in-situ photo-Fenton technology in composting. The functional additive not only eliminates the drawbacks of the in-situ photo-Fenton technology, but also improves the efficiency of forestry residue composting. Specifically, it solves the problems such as the slow conversion rate of iron ions, breaks through the bottleneck of free radical generation, further improves the degradation ability of free radicals on lignocellulose, improves composting efficiency and quality, shortens the composting cycle, has significant advantages in the composting process of forestry residues, and is conducive to promoting the process of resource utilization.

[0102] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A composting method based on the coordinated regulation of in-situ photo-Fenton and functional additives, characterized in that: The following steps are involved: In situ photo-Fenton reagent and functional additives are added to forestry residues, the C / N ratio and moisture content are adjusted, EM inoculum is added, mixed evenly and then aerobic composting is carried out under sunlight. Composting is completed when the pile approaches room temperature. The in-situ photo-Fenton reagent includes pyrite and ascorbic acid, and the functional additive includes at least one of tea waste and biochar.

2. The composting method according to claim 1, wherein The added amounts of the pyrite and ascorbic acid are respectively 1% of the dry weight of the forestry residue.

3. The composting method according to claim 1, wherein The amount of the tea waste added is 0-15% of the dry weight of the forestry residues, and the amount of the biochar added is 0-20% of the dry weight of the forestry residues.

4. The composting method according to claim 3, wherein: The amount of the tea waste added is 5% of the dry weight of the forestry residues, and the amount of the biochar added is 10% of the dry weight of the forestry residues.

5. The composting method according to claim 1, wherein: The C / N ratio is 25%-30%, and the moisture content is 60%.

6. The composting method according to claim 1, wherein: According to the dry weight of the forestry residues, 10 g of the EM microbial agent was added to every 1 kg of the forestry residues.

7. An in-situ photo-Fenton reagent for composting, characterized in that The in-situ photo-Fenton reagent includes pyrite and ascorbic acid, and the weight ratio of the pyrite to the ascorbic acid is 1:

1.

8. A functional additive for composting, characterized in that: The functional additive includes at least one of tea waste and biochar, and the weight ratio of the tea waste to the biochar is 0-15:0-20.

9. Use of the composting method according to any one of claims 1 to 6, the in-situ photo-Fenton reagent according to claim 7, or the functional additive according to claim 8 in improving the iron ion conversion rate or composting efficiency.

10. Use of the composting method according to any one of claims 1 to 6, the in-situ photo-Fenton reagent according to claim 7, or the functional additive according to claim 8 in improving the safety of compost products or improving the seed germination index.

Images