A biological macromolecule scanning direct-reading sequencing system and method

Abstract

This invention provides a scanning direct-read sequencing system and method for biomolecules. Combining dual-beam optical tweezers, tunneling probe sensing, and single-molecule plasmon optical tweezers technology, the two ends of the biomolecules to be sequenced, such as nucleic acids, peptides, or proteins, are connected to microspheres. The position and distance between the two microspheres are controlled by dual-potential-tweezers, thereby controlling the position and state of the biomolecule. Under the action of plasmon optical tweezers, a portion of the biomolecule's sequence is induced to enter the tunneling region. Sequencing of nucleic acid or amino acid sequences, or real-time detection of single-molecule proteins, is performed based on changes in the tunneling signal. Repeated scanning direct-read sequencing is possible, enabling the detection of bases or amino acids one by one. The scanning accuracy reaches the sub-nanometer level, effectively improving sequencing accuracy.

Description

Technical Field

[0001] This invention relates to the field of biosensing and analysis technology, specifically to a direct-read sequencing system and method for scanning biological macromolecules. Background Technology

[0002] Currently, the development of sequencing technology mainly focuses on two important directions: DNA sequencing and protein sequencing. First-generation and second-generation DNA sequencing technologies are mainly based on polymerase chain reaction (PCR) to amplify DNA fragments in large quantities, thereby identifying the base sequence. Although this method can achieve sequence identification accuracy of over 99.9%, it is limited by the PCR method, can only perform short-read sequencing of DNA strands, and is costly and time-consuming.

[0003] In order to achieve long-read, high-throughput, and low-cost DNA sequencing, third-generation DNA sequencing technologies, represented by nanopore technology and other electrical sequencing technologies, have gradually developed. These technologies identify the signal of the DNA strand passing through the pore by changing the intensity of the ionic current in the nanopore due to the blockage of DNA at the nanopore position. However, the following problems exist: (1) The current nanopore technology has the problem of the DNA strand translocation speed during the test process, which leads to a decrease in signal reading accuracy; (2) The current signal generated when the DNA strand passes through the nanopore is often formed by the superposition of multiple base fragments in the nanopore, which leads to a slight deficiency in the single-base accuracy of the nanopore; (3) The measurement of single DNA strands through the pore is an irreversible process, and the measurement cannot be repeated. Therefore, a large number of measurement events are needed for statistical and data analysis to obtain the corresponding DNA sequence, and the test accuracy is improved by methods such as data statistical analysis and machine learning algorithms; (4) When reading DNA fragment sequences using nanopore technology, since the diameter of double-stranded DNA is large, it exceeds the physical space limit of most nanopores. Usually, it is necessary to first unwind the double-stranded DNA to obtain single-stranded DNA before it can be easily read in the nanopore, which limits the direct sequencing of double-stranded DNA.

[0004] Another type of DNA electrochemical sequencing technology is based on quantum tunneling current signals, represented by scanning tunneling microscopy (STM). DNA is placed within the nanometer gaps of a tunneling electrode pair, and a bias voltage is applied to the electrode pair. Changes in the tunneling current are monitored to identify base signals. Theoretical studies have shown that the differences in electronic structure between adenine (A), thymine (T), cytosine (C), and guanine (G) affect the tunneling current to varying degrees, and these differences can be distinguished by the distribution of the tunneling current, thus laying the foundation for DNA tunneling sequencing. There are two methods for sequencing using STM. One method involves pre-modifying the DNA strand onto an STM substrate and then scanning individual DNA strands under low-temperature vacuum. This method relies on the scanning precision of STM motion control and struggles to locate single-base positions (where the distance between bases is on the sub-nanometer scale). The other method uses recognition tunneling, functionalizing the STM probe and substrate, and then identifying base fragments in solution. However, this recognition tunneling method can only identify single bases or short fragments, and reading long DNA sequences remains a challenge.

[0005] The development of protein sequencing technology is still in its early stages. Most protein analysis techniques rely on mass spectrometry, but its ability to analyze low-abundance protein samples is insufficient, making it impossible to obtain accurate information from single protein samples. Therefore, the advancement of protein sequencing research urgently requires the development of single-molecule protein analysis.

[0006] Single-molecule fluorescently labeled protein analysis relies on complex fluorescent labeling methods, typically involving chemical synthesis or enzymatic reactions to label and cleave unfolded peptides, thereby identifying the fluorescent signals of specifically labeled amino acids to achieve sequencing. This fluorescent labeling method depends on the design and synthesis of specific fluorescent groups, resulting in high analysis costs and hindering the expansion of protein sequencing applications. For nanopore technology, protein nanopore sequencing faces similar challenges to DNA nanopore sequencing: difficulty in controlling the permeation speed of the test sample and the mismatch between the protein's folded state and the nanopore size, easily leading to nanopore blockage. Furthermore, compared to DNA molecules composed of only four base types, protein molecules have more than twenty types of amino acids, some of which are similar in size and charge characteristics, increasing the difficulty of sequencing proteins through pore ion currents. Direct analysis and sequencing of proteins or polypeptide chains in solution using quantum tunneling sequencing technology is rarely reported. This is because the structure of proteins in solution is dynamically changing, making direct imaging with STM difficult. Moreover, if a point-by-point scanning imaging method is used to read the protein sequence, the imaging speed is slower than the time it takes for the protein to undergo conformational changes. Furthermore, scanning tunneling microscopy requires maintaining a single-atom-level sharp needle tip for atomic-level resolution scanning, which increases the operational difficulty.

[0007] US7279337B2 provides a sequencing method for DNA polymers using nanopores or nanochannels. It employs optical tweezers to generate localized gradient forces near the nanopore gaps, controlling the DNA polymer to flow through the channel for signal acquisition. However, this optical tweezers manipulation has low precision, making it impossible to accurately manipulate the DNA polymer during sequencing. Furthermore, it still suffers from problems such as excessively rapid DNA polymer translocation during passage, irreversible and unrepeatable processes, easy blockage, and inability to detect double strands.

[0008] Therefore, there is an urgent need to find a new sequencing method with high-precision positioning and identification capabilities, higher detection accuracy, and the ability to perform repeated back-and-forth detections. Summary of the Invention

[0009] To address the problems existing in the prior art, this invention provides a scanning direct-read sequencing system and method for biomolecules. Combining dual-beam optical tweezers, tunneling probe sensing, and single-molecule plasmon optical tweezers technology, the two ends of the biomolecules to be sequenced (such as nucleic acids, peptides, or proteins) are connected to microspheres. The position and distance between the two microspheres are controlled by dual-potential-well optical tweezers, thereby controlling the position and state of the biomolecule. Under the action of plasmon optical tweezers, a portion of the biomolecule's sequence is induced to enter the tunneling region. Sequencing of nucleic acid or amino acid sequences, or real-time detection of single-molecule proteins, is performed based on changes in the tunneling signal. Repeated scanning direct-read sequencing is possible, enabling the detection of bases or amino acids one by one, with scanning accuracy reaching the sub-nanometer level, effectively improving sequencing precision.

[0010] On one hand, the present invention provides a scanning direct-read sequencing system for biological macromolecules. The system includes a dual-potential-well optical tweezers excitation module, a plasmonic optical tweezers excitation module, and a tunneling probe. The two ends of the biological macromolecule are respectively connected to microspheres. The dual-potential-well optical tweezers excitation module is used to control the position and distance between the two microspheres, thereby controlling the position and state of the biological macromolecule. The plasmonic optical tweezers excitation module is used to induce the biological macromolecule to enter the tunneling sensing region of the tunneling probe.

[0011] The biomolecular scanning direct-read sequencing system provided by this invention combines tunneling sensing technology and optical tweezers technology.

[0012] In tunneling sensing technology, the distance between tunneling electrode pairs is usually in the sub-5nm range. Under the drive of an external bias voltage, a tunneling current is formed between the tunneling electrode pairs. The tunneling current is very sensitive to the medium located in the tunneling sensing region, and can identify and distinguish target objects located in the tunneling sensing region based on the fluctuation of the tunneling current signal.

[0013] In optical tweezers, a focused Gaussian beam can be used to form an optical tweezer potential well in a sample cell, enabling the capture and manipulation of materials ranging in size from hundreds of nanometers to micrometers. Dual-potential-well optical tweezers, also known as dual-beam optical tweezers, can simultaneously and independently control two micro- or nano-materials, such as microspheres.

[0014] By irradiating the surface of a nanostructure with a laser of resonant wavelength, the surface plasmon resonance effect of the nanostructure can be excited. This effect is divided into propagating surface plasmon resonance (SPP) and localized surface plasmon resonance (LSPR). The tunneling electrode pair can be regarded as a nanostructure with a nano-gap. Therefore, under the excitation of the resonant wavelength laser, LSPR can be excited on the tunneling electrode pair, and then an electromagnetic field enhancement of up to 3 orders of magnitude is formed in the nano-gap. This generates an optical gradient force field of pN order of magnitude pointing towards the center of the nano-gap. Through the optical force, the nearby target object is pulled into the nano-gap, i.e., the tunneling sensing region, for identification and detection. This technology is called plasmon optical tweezers.

[0015] This invention achieves reproducible scanning direct-read sequencing of long-chain DNA or polypeptide chains by combining tunneling sensing, dual-potential-well optical tweezers, and plasmon optical tweezers technologies. Specifically, the target sequence (DNA or polypeptide chain) is functionalized and attached to two microspheres at both ends. Then, dual-potential-well optical tweezers are used to capture and manipulate the two microspheres attached to the target sequence. The two microspheres act like grippers, flattening the target sequence in the middle and moving it along with the sequence in the sample cell. Therefore, by controlling the position of the optical tweezers potential wells, the target sequence can be moved to the vicinity of the tunneling electrode pair at the tip of the tunneling probe. Then, under the action of plasmon optical tweezers, the segment of the target sequence located near the tunneling sensing region is subjected to an optical gradient force pointing towards the nano-gap of the tunneling probe, and is pulled into the nano-gap for signal detection. Since different bases cause different tunneling current fluctuations in the tunneling sensing region, different base units or amino acid units in the target sequence can be identified through the tunneling current signal. Then, by controlling the position of the dual-potential-trap optical tweezers, the positional movement of the sequence to be tested relative to the tunneling probe can be achieved, enabling the identification of different segments in the sequence to be tested, and ultimately realizing sequencing.

[0016] There are two ways to control the positional movement of the sequence to be tested relative to the tunneling probe. One is to keep the optical tweezers potential well stationary and use a three-dimensional nanopiezoelectric platform to control the positional movement of the tunneling probe. This method is limited by the movement precision of the three-dimensional nanopiezoelectric platform, which is usually at the nanometer level, ranging from a few nanometers to tens of nanometers (this method of controlling the movement of the tunneling probe using nanopiezoelectricity is similar to using piezoelectricity to control the movement of the STM tip for scanning in an STM instrument). The second method is to keep the tunneling probe stationary and control the position of the optical tweezers potential well through a spatial light modulator (which can also be a galvanometer, digital micromirror array, or acousto-optic modulator). This method has higher positional precision, reaching sub-nanometer levels. Since the distance between single bases in a DNA sequence is 0.3 nm and the distance between single amino acids in a polypeptide chain is 0.38 nm, the second method is more conducive to achieving direct reading with single base and single amino acid precision, and it can also be repeatedly moved back and forth to achieve repeated direct reading.

[0017] Once the relative positions of the sequence to be tested and the tunneling probe can be controlled, and the tunneling signal can be read, the relative motion trajectory between the two can be set to achieve repetitive scanning direct reading sequencing of DNA with single-base precision and polypeptide segments with single-amino acid precision.

[0018] This invention utilizes optical tweezers combined with tunneling sequencing to sequence biomolecules such as nucleic acids. Methodologically, the microspheres employing dual optical tweezers technology can immobilize both single-stranded and double-stranded DNA, as well as peptides and protein molecules, making it suitable for testing single- and double-stranded DNA, peptides, and protein molecules. Simultaneously, the tunneling sensing region used in the tunneling assay is a semi-open spatial structure, unrestricted by the diameter of the DNA or peptide. The quantum tunneling current is sensitive to the electronic structure of the target analyte, enabling base recognition in double-stranded DNA. In summary, this invention allows direct sequencing of DNA or peptides, regardless of whether they are single- or double-stranded, offering higher precision in localization and identification, higher detection accuracy, and lower cost.

[0019] Existing sequencing methods based on tunneling probes attempt to detect the sequence by moving it directionally within the tunneling region while keeping the target sequence as linear as possible. However, such sequencing methods cannot guarantee that the target sequence remains within the tunneling region, making it difficult to ensure sequencing accuracy.

[0020] This invention cleverly combines two optical tweezers techniques: dual-trap optical tweezers and plasmonic optical tweezers. First, dual-trap optical tweezers hold the sequence to be tested in a straight line and fix it in place. Then, plasmonic optical tweezers apply a lateral force to the sequence, pulling a portion of the sequence (approximately 1-3 bases or 1-3 amino acids) into the tunneling region. After sequencing a single base or amino acid, dual-trap optical tweezers move the sequence along the direction of the straight line by a distance equal to one base or amino acid, thus pulling the moved portion of the sequence laterally into the tunneling region. This process is repeated to ensure that each base or amino acid in the sequence is sequentially queued and enters the tunneling region for accurate detection, thereby guaranteeing the accuracy of the sequencing.

[0021] The plasmonic optical tweezers described herein originate from a plasmonic optical tweezers system successfully constructed by our research team in previous studies. This system utilizes a plasma-enhanced photocurrent detection unit to achieve efficient photoelectric coupling, enhancing the effect of single-molecule plasmonic optical tweezers. When integrated with quantum tunneling sensing technology, it enables in-situ capture and real-time monitoring of sub-5nm level chemical and biological single molecules, as detailed in domestic invention patent CN118671956A. This invention, based on the in-situ capture capability of plasmonic optical tweezers for sub-5nm level chemical and biological single molecules, can sequentially capture portions of the bases or amino acids in the target sequence, pulling them one by one into the tunneling region for detection. This truly achieves precise direct reading of each base or amino acid in the target sequence, thereby realizing accurate and efficient scanning direct-read sequencing, which is of epoch-making significance in the field of tunneling sequencing.

[0022] In some embodiments, the tunneling probe is formed by further electrodepositing gold nanoclusters at the tip of a tapered glass needle drawn from a double-hole quartz glass tube. The glass tube is 110 mm long, with an outer diameter of 1.2 mm and an inner diameter of 0.9 mm. The tunneling electrode pair at the tip of the tunneling probe consists of two gold nanoclusters with a diameter of 100 nm, and the distance between the gold nanoclusters is in the sub-5 nm range. Therefore, when an external wire is connected to the tunneling probe and a diameter bias voltage is applied, a tunneling current will be formed between the tunneling electrode pair according to the principle of quantum tunneling effect. The tunneling current is highly sensitive to the electronic structure of the target object located in the tunneling sensing region, enabling the identification and detection of the target object at the single-molecule level.

[0023] Furthermore, the dual-potential-well optical tweezers excitation module includes a laser source, a laser collimating lens, a half-wave plate, a polarizing beam splitter prism, a non-polarizing beam splitter prism, a spatial light modulator, a lens, and a dichroic mirror.

[0024] The dual-potential-well optical tweezers excitation module functions to form two independent optical tweezer potential wells in the sample cell, thereby capturing microspheres in the sample cell solution. This invention uses dual-potential-well optical tweezers to immobilize the target sequence with microspheres, and then uses a tunneling probe combined with plasmon optical tweezers to scan the immobilized target sequence in the solution.

[0025] The dual-potential-well optical tweezers excitation module includes: a laser source, a laser collimating lens, a half-wave plate, a polarizing beam splitter prism, a non-polarizing beam splitter prism, a spatial light modulator, a lens, and a dichroic mirror. Specifically, there are three half-wave plates: a first half-wave plate, a second half-wave plate, and a third half-wave plate; two polarizing beam splitters: a first polarizing beam splitter prism and a second polarizing beam splitter prism; two spatial light modulators: a first spatial light modulator and a second spatial light modulator; and two lenses: a first lens and a second lens.

[0026] Linearly polarized laser light emitted from a laser source is collimated into a parallel beam by a laser collimating lens.

[0027] The first half-wave plate and the first polarizing beam splitter prism are combined as a power control module. The first polarizing beam splitter prism only allows horizontally polarized lasers to be transmitted. The first half-wave plate changes the polarization angle of the linearly polarized laser, which can continuously change the proportion of the horizontally polarized component in the laser, thereby achieving continuous control of the laser power.

[0028] After rigorous power control, the horizontally polarized laser beam is split into two beams by a 5:5 unpolarized beam splitter prism: a transmission beam and a reflection beam. The transmission beam is reflected by a spatial light modulator and then passes through a second half-wave plate for linear polarization angle adjustment; the reflection beam is reflected by a spatial light modulator and then passes through a third half-wave plate for linear polarization angle adjustment.

[0029] The function of the first and second spatial light modulators is to control the polarization of the laser beam and achieve position control of the optical tweezer potential trap.

[0030] The two laser beams are combined by a second polarizing beam-splitting prism. This prism allows vertically polarized laser beams to be reflected and horizontally polarized laser beams to be transmitted. Therefore, the polarization angles of the two laser beams can be adjusted independently using a second and third half-wave plate, allowing for independent control of their power and thus the intensity of the two optical tweezer potential wells. Furthermore, it enables the separation of the polarization states of the laser beams in the two optical tweezer potential wells, facilitating subsequent position detection of the captured microsphere. The combined laser beam is then expanded by a beam-expanding module composed of a first and second lens.

[0031] Two laser beams, one from the second half-wave plate and the other from the third half-wave plate, are used to control two optical tweezer potential wells. However, there is a common path in the optical path, and both beams need to be focused through the same objective lens. Therefore, beam combining is necessary. This beam combining does not mean that the two laser beams are always perfectly aligned during use. When controlling the potential well positions separately, the two laser beams will deviate at the beam combining element. Beam combining means that they must pass through the same element in the subsequent optical path to reach the final sample surface. Furthermore, during the process of controlling the optical path deflection with the spatial light modulator, the spatial light modulator is placed on the conjugate plane of the objective lens's back focal plane. This means that the scanning angle deflection of the spatial light modulator or galvanometer translates into the displacement of the focusing potential well on the sample surface. This also avoids spot distortion or energy loss during scanning. High-NA objectives must completely fill their back aperture to achieve diffraction-limited focusing. When the scanner is on the conjugate plane, its deflection does not change the beam size entering the objective lens, ensuring that the pupils are always matched. Therefore, the control of the conjugate plane is achieved through a 4f system.

[0032] The dichroic mirror of the dual-potential-well optical tweezers excitation module is a long-pass dichroic mirror, which transmits the excitation beam of the dual-potential-well optical tweezers module and reflects the excitation beam of the plasmonic optical tweezers excitation module, the excitation beam of the fluorescence excitation module, and the excitation beam and signal beam of the detection module.

[0033] Furthermore, the plasmonic optical tweezers excitation module includes a laser source, a laser collimating lens, a half-wave plate, a polarizing beam splitter prism, a reflector, a lens, and a dichroic mirror.

[0034] Based on previous research, this invention combines the constructed plasmonic optical tweezers system with a dual-potential-trap optical tweezers system and a tunneling system to achieve more accurate and efficient scanning direct-read sequencing.

[0035] The plasmon optical tweezers excitation module provided by this invention is used to excite the local surface plasmon resonance effect of the nanostructure at the tip of the tunneling probe, thereby obtaining an enhanced electromagnetic field in the nanostructure and forming an optical gradient force field pointing to the nano gap at the tip of the tunneling probe. This attracts nearby targets (such as sequence fragments in DNA chains or peptide chains located near the nano gap) to the tunneling test area for electrical signal testing.

[0036] The plasmonic optical tweezers excitation module includes: a laser source, a laser collimating lens, a half-wave plate, a polarizing beam splitter prism, a reflector, a lens, and a dichroic mirror. There are two half-wave plates: the fourth and fifth half-wave plates; two reflectors: the first and second reflectors; and two lenses: the third and fourth lenses.

[0037] The wavelength of the laser source meets the requirement of exciting the localized surface plasmon resonance effect of the metal tunneling electrode pair. The linearly polarized laser emitted by the laser source is collimated into a parallel beam by a laser collimating lens.

[0038] The first half-wave plate and polarizing beam splitter prism are combined to form a power control module. After strict power control, the laser beam path direction is adjusted by a mirror group consisting of the first and second reflectors. Then it passes through the second half-wave plate, which is used to control the linear polarization direction of the laser beam to be parallel to the local surface plasmon resonance coupling direction of the tunneling electrode pair. The polarization-controlled laser beam is then expanded by a beam expander module consisting of the first and second lenses. The expanded laser beam is reflected by a dichroic mirror and enters the main optical path.

[0039] The local surface plasmon resonance coupling direction of a tunneling electrode pair refers to the laser polarization direction in which the nano-gap of the tunneling electrode pair obtains the maximum electromagnetic field enhancement under laser excitation. For a tunneling electrode pair with a nano-gap in the middle, it is usually along the direction from one end electrode to the other end electrode.

[0040] The dichroic mirror of the plasmonic optical tweezers excitation module is a short-pass dichroic mirror, which reflects the excitation light of the plasmonic optical tweezers excitation module and transmits the excitation light and signal light of the fluorescence excitation and detection modules.

[0041] Furthermore, in the optical tweezers potential well region, the power of the dual potential well optical tweezers excitation module needs to be controlled within the range of 0.5~1W, and the power of the plasmonic optical tweezers excitation module needs to be controlled within the range of 0.5~20mW.

[0042] Dual-trap optical tweezers control two microspheres to keep the sequence to be tested in a straight line and fix it in place, while plasmonic optical tweezers pull some bases into the tunneling region. In other words, dual-trap optical tweezers provide two longitudinal forces, while plasmonic optical tweezers provide a lateral force. The sequence to be tested is subjected to three forces, which need to be kept in a certain balance. For example, the force of the dual-trap optical tweezers cannot be too large, making it difficult for the plasmonic optical tweezers to pull; conversely, the force of the plasmonic optical tweezers cannot be too large, causing the dual-trap optical tweezers to fail to fix the sequence, or the entire sequence to be completely folded and pulled into the tunneling region. Therefore, the power of the dual-trap optical tweezers excitation module and the plasmonic optical tweezers excitation module must be controlled. The power of the dual-trap optical tweezers excitation module should be controlled within the range of 0.5~1W, and the power of the plasmonic optical tweezers excitation module should be controlled within the range of 0.5~20 mW, so that the three forces acting on the sequence to be tested are within a suitable control range, thus successfully achieving direct-read sequencing.

[0043] Furthermore, it also includes a sample stage module, which includes a microfluidic chip liquid pool, wherein the microfluidic chip liquid pool is provided with mutually separated tunneling probe channels and sample liquid channels.

[0044] In some embodiments, the sample stage module includes: a stage, a microfluidic chip liquid pool, a three-dimensional nanopiezoelectric platform, and an electromagnetic signal shielding box.

[0045] The microfluidic chip liquid pool and tunneling probe are fixed on a stage, and a three-dimensional nanopiezoelectric platform controls the movement of the stage to adjust the position of the microfluidic chip liquid pool. The three-dimensional nanopiezoelectric platform is an extremely precise motion control device that uses the piezoelectric effect as its driving principle to achieve nanoscale displacement, positioning, and scanning motion in three mutually perpendicular directions: X, Y, and Z.

[0046] The entire stage is placed inside an electromagnetic signal shielding box to ensure that the collected electrical signals are not affected by external electromagnetic noise, thereby improving the signal-to-noise ratio.

[0047] The microfluidic chip liquid reservoir includes a sample liquid channel, a tunneling probe channel, and a waste liquid channel. The microfluidic chip liquid reservoir provided by this invention separates the probe channel from the sample liquid channel. This means that when the sample flows through the sample liquid channel, it maintains a certain distance from the tunneling electrode, thus ensuring that the tunneling probe electrode is not disturbed during the process of entering and exiting the sample liquid.

[0048] Furthermore, the sample liquid channel includes a first channel, a second channel, and a third channel, which are located on the same horizontal plane. Through the laminar flow effect, the liquid in the three channels flows independently without interfering with each other.

[0049] The sample solution channel is divided into three channels: the first channel is for injecting the microsphere sample solution, the second channel is for injecting the sample solution of the sequence to be tested, and the third channel is for injecting a buffer solution without samples. The three channels are located on the same horizontal plane, and the laminar flow effect allows the liquids in each channel to flow independently without interference. The laminar flow effect refers to the phenomenon where fluids in different layers move in a parallel, orderly, and unmixed manner during flow. Fluid molecules in laminar flow generally flow along fixed paths with no significant lateral mixing.

[0050] In actual operation, the dual-potential-trap optical tweezers are first positioned in the third channel. After capturing the microspheres, the stage is moved to move the position of the dual-potential-trap optical tweezers to the second channel. The sequence to be tested is functionalized and connected to the microspheres of the two optical tweezer potential traps at both ends, forming a dumbbell-shaped test structure with a long chain (such as DNA or peptide) in the middle and microsphere grippers at both ends.

[0051] The test structure (the sequence to be tested connected to microspheres at both ends) is then moved to the buffer solution channel of the first channel via a stage. In this channel, a force curve stretching experiment of the sequence to be tested is performed for verification, or fluorescence signal detection is conducted using a fluorescently labeled group to ensure successful ligation of the sequence to be tested within the test structure. After verifying successful construction of the test structure, it is moved to the tunneling probe channel via a stage. Then, based on feedback from photocurrent and tunneling current signals, the sequence fragment to be tested in the middle of the test structure is brought close to the tunneling sensing region of the tunneling electrode pair, followed by scanning and direct-read sequencing.

[0052] In some configurations, the entire microfluidic chip liquid reservoir, including the sample inlet of the sample liquid channel and the waste liquid outlet of the waste liquid channel, is connected to the microfluidic control module, forming a sealed structure. The tunneling probe channel employs a threaded seal. The tip of the tunneling probe extends into the channel, and an O-ring is installed at the channel opening. Tightening the threads deforms the O-ring at the channel opening, completely securing the tunneling probe within the channel and ensuring the microfluidic chip liquid reservoir remains sealed within this channel.

[0053] During use, the sample solution injection at each inlet of the microfluidic chip is controlled by a separate injection pump system. Initially, the top buffer solution inlet can be opened while the middle and lower inlets are closed. This allows the buffer solution to fill all channels of the microfluidic chip's liquid reservoir, including the tunneling probe channel. When the first, second, and third channels are injected simultaneously, the laminar flow ensures that the sample solutions injected into the three channels do not interfere with each other. During testing, the sample solution is injected through the inlet and flows out through the waste outlet, achieving microfluidic chip sample solution circulation.

[0054] Furthermore, the liquid pool of the microfluidic chip is made of quartz glass, and the surface of the liquid pool needs to be passivated using a phospholipid bilayer.

[0055] To achieve the accuracy of direct-read sequencing, the structure and materials of the microfluidic chip's liquid pool are very important.

[0056] Firstly, in terms of structure, this invention makes the following design improvements to the microfluidic chip liquid pool: 1. The probe channel and the sample liquid channel are separated in the microfluidic chip liquid pool. That is, when the sample flows in the sample liquid channel, it maintains a certain distance from the tunneling electrode, so that the tunneling probe electrode is not disturbed during the process of entering and exiting the sample liquid; 2. Three laminar flow channels are set up. During use, the liquid in the three laminar flow channels maintains a laminar flow state, ensuring that the solution does not mix and become contaminated. Moreover, it is easy to use. The dual potential trap optical tweezers can move between the three laminar flow channels according to the settings, and the operation process is also simpler.

[0057] Since the liquids in the first, second, and third channels all flow in the same plane and do not interfere with each other, it is easier for the dual-potential-trap optical tweezers to control the microsphere to move and change position between the three channels, making the control process easier to implement and the control precision higher.

[0058] Secondly, regarding the material of the liquid pool in the microfluidic chip, since the tunneling probe is rigid as a whole and its tip is very fragile, the liquid pool also needs to use rigid materials in order to protect the probe tip. At the same time, in order to improve the optical transmittance of multiple wavelengths, quartz glass is preferred as the main material for the liquid pool.

[0059] Since the processing cost of quartz microfluidic liquid pools is relatively high, microfluidic chip liquid pools are preferably not disposable devices. The microfluidic chip liquid pool in this invention can be repeatedly disassembled and reused, thereby reducing costs.

[0060] Furthermore, to ensure the accuracy of direct-read sequencing, the microfluidic chip's liquid cell surface needs to be passivated with a phospholipid bilayer (palmitoyl oleoyl phosphatidylcholine, POPC) before use. This prevents the sample to be sequenced from adsorbing onto the liquid cell wall during the sequencing experiment, which would affect the precise control and displacement of the sample. The specific process is as follows: first, inject 200 μL of PBS buffer into the liquid cell through the upper channel to remove air bubbles; then, inject 80 μL of the treated POPC solution, incubate for 10 min, and repeat three times to passivate the liquid cell wall surface and prevent sample adsorption during sequencing.

[0061] This invention compares different passivation methods and selects the optimal passivation method, which can ensure that the sample is not adsorbed and that the light transmittance after passivation is not affected, thus ensuring the accuracy of scanning direct-read sequencing.

[0062] Meanwhile, the tunneling probe is installed using a silicone O-ring mechanical seal. Specifically, the tunneling probe channel in the liquid pool has two different inner diameters. The smaller inner diameter channel, with a diameter of 800μm, connects to the chip body, allowing the probe tip to enter while ensuring sufficient space for subsequent scanning at the potential well location. The larger diameter channel is an M4 threaded hole used for threaded tightening and pressurizing the silicone O-ring to seal the tunneling probe channel.

[0063] The tunneling probe is first inserted into a through hole with a diameter of 1.25 mm in the middle, with the tapered tip protruding from the other end. Then, the screw is screwed into the large-diameter threaded channel. There is a custom silicone O-ring at the transition connection between the large-diameter channel and the small-diameter channel. The screw is screwed in and tightened under pressure, causing the O-ring to deform and seal the channel.

[0064] The microfluidic control module controls the flow of the sample solution within the microfluidic chip's liquid reservoir. The module includes a syringe pump, a waste liquid reservoir, and a flow rate control system. Through this module, each inlet channel of the microfluidic chip's liquid reservoir can be independently controlled according to experimental requirements. Simultaneously, it can collect sample waste liquid, preventing contamination, and achieve sample solution circulation within the microfluidic chip's liquid reservoir.

[0065] Furthermore, the biomolecular scanning direct-read sequencing system also includes a fluorescence excitation and detection module, a position detection module, and an electrical signal acquisition module; the fluorescence excitation and detection module is used to excite and detect fluorescence signals; the position detection module is used to detect the position of the microspheres in the optical tweezers potential trap; the electrical signal acquisition module is used to identify and acquire photocurrent signals to adjust the coupling between the excitation light of the plasmon optical tweezers module and the tunneling probe nanostructure, ensuring the effective excitation of the local surface plasmon resonance effect in the nano-gap.

[0066] In some embodiments, the fluorescence excitation and detection module is used to excite and detect the fluorescence signal of the microspheres, thereby further determining the trapping behavior of the microspheres by the dual-potential-trap optical tweezers. It is understood that the fluorescence excitation and detection module can also be used to excite and detect fluorescent groups located on the target sequence, thereby characterizing the position of the target sequence.

[0067] The fluorescence excitation and detection module includes a laser source, a laser collimating lens, a half-wave plate, a polarizing beam splitter prism, a reflector, a lens, a dichroic mirror, a spatial light modulator, a filter, an aperture stop, and an avalanche photodiode (APD). There are two half-wave plates: the sixth and seventh half-wave plates; five reflectors: the third, fourth, fifth, sixth, and seventh reflectors; and five lenses: the fifth, sixth, seventh, eighth, and ninth lenses.

[0068] The wavelength of the laser source meets the requirement of exciting the fluorescence of microspheres or the fluorescence of fluorescent groups in the target sequence. In the fluorescence excitation optical path, the laser from the laser source is output through a single-mode fiber with a core diameter of 1 μm, acting as a small aperture. The laser passing through the fiber port is equivalent to the laser exiting through a small aperture with a diameter of 1 μm. The linearly polarized laser emitted by the laser source is collimated into a parallel beam by a laser collimating lens. A combination of a sixth half-wave plate and a polarizing beam splitter prism serves as a power control module. After strict power control, the laser beam is oriented by a mirror group consisting of a third and fourth reflecting mirror. Then it passes through a seventh half-wave plate, which is used to control the linear polarization direction of the laser. After polarization control, the laser beam is expanded by a beam-expanding module consisting of a fifth and sixth lens. The expanded laser beam passes through a dichroic mirror, is reflected by a spatial light modulator, and enters the main optical path. The spatial light modulator can control the deflection of the fluorescence excitation beam mirror, realizing the fluorescence scanning function. The fluorescence detection optical path and the fluorescence excitation optical path are connected at the front end, ensuring high-efficiency collection of the returned fluorescence signal. The returned fluorescence signal is separated from the fluorescence excitation optical path after reflection by a dichroic mirror. The reflected fluorescence signal is then reflected by the fifth mirror and passes through a filter. The filter removes non-fluorescent wavelengths from the returned signal. The filtered fluorescence signal is further filtered by a pinhole filter module composed of a seventh lens, an aperture stop, and an eighth lens to remove stray light. After reflection by the sixth and seventh mirrors, it is focused into the avalanche photodiode APD43 by the ninth lens. Signal collection in the APD43 is also achieved via optical fiber; both the output fiber port of the laser source and the collection fiber port of the APD43 act as pinholes, enabling confocal fluorescence excitation and detection.

[0069] The dichroic mirror of the fluorescence excitation and detection module is a short-pass dichroic mirror, which transmits the excitation light of the fluorescence excitation and detection module and reflects the signal light of the fluorescence excitation and detection module.

[0070] The position detection module is used to detect the position of the microsphere in the optical tweezers potential trap, thereby calculating the optical tweezers trapping stiffness of the microsphere and providing real-time feedback on the microsphere's position. The position detection module includes: a microscope objective, a non-polarizing beam splitter prism, a filter, a polarizing beam splitter prism, lenses, and a four-quadrant photodetector (QPD). There are two lenses: the tenth lens and the eleventh lens; and two four-quadrant photodetectors (QPDs): a first four-quadrant photodetector QPD and a second four-quadrant photodetector QPD.

[0071] The signal light transmitted from the liquid pool of the microfluidic chip is collected by a microscope objective and then reflected by a non-polarizing beam splitter prism into the position detection module. The position detection module detects the position of the microsphere, therefore the received light wavelength is the same as the excitation wavelength of the dual-potential-well optical tweezers module. A filter further filters the optical signal from the optical tweezers potential wells. After filtering, the signal light passes through a polarizing beam splitter prism to separate the horizontally polarized and vertically polarized signal light, with each polarization state corresponding to one of the two independent optical tweezers potential wells. The horizontally polarized signal light passes through the polarizing beam splitter prism, is focused by the tenth lens onto the first four-quadrant photodetector (QPD), and is used to detect the position of the microsphere in one optical tweezers potential well. The vertically polarized signal light is reflected by the polarizing beam splitter prism, focused by the eleventh lens onto the second four-quadrant photodetector (QPD), and is used to detect the position of the microsphere in the other optical tweezers potential well.

[0072] The electrical signal acquisition module is used to acquire and identify the photocurrent signal of the target object, and adjust the coupling between the excitation light of the plasmon optical tweezers module and the nanostructure of the tunneling probe according to the photocurrent signal, so as to ensure the effective excitation of the local surface plasmon resonance effect of the nano-gap.

[0073] The electrical signal acquisition module includes a patch-clamp system and a lock-in amplifier system.

[0074] The patch-clamp system is used to acquire tunneling current signals. During the acquisition process, the patch-clamp system applies a DC bias voltage between the two electrodes of the tunneling probe, and then forms a tunneling sensing region in the middle of the tunneling electrode pair with a gap of sub-5 nanometers. The target object in the region is identified by the evolution of the tunneling current.

[0075] The lock-in amplifier system utilizes the principle of phase-sensitive detection to detect photocurrent signals. Specifically, the laser source of the plasmonic optical tweezers excitation module is modulated by a fixed-frequency sinusoidal or square-wave signal output from a signal generator, generating an intensity-modulated pulse beam that irradiates the nanometer gap between the tunneling electrode pairs at the tip of the tunneling probe, generating a tunneling photocurrent signal. The frequency of the signal generator's output signal is used as a reference frequency and input into the lock-in amplifier to extract the signal response related to that frequency, i.e., the photocurrent signal generated by the modulated laser irradiating the tunneling electrode pairs.

[0076] Furthermore, the biomolecular scanning direct-read sequencing system also includes a wide-field illumination module and a wide-field imaging module; the function of the wide-field illumination module is to provide an illumination field of view for wide-field imaging; the function of the wide-field imaging module is to perform imaging characterization of the test area of ​​the microfluidic chip sample cell under the illumination field of view, which can initially perform imaging observation of microspheres in the sample liquid cell, and can also image the position of the tunneling probe in the tunneling probe channel.

[0077] The wide-field illumination module includes an LED light source, lenses, aperture stops, mirrors, dichroic mirrors, and microscope objectives. The lenses include a twelfth lens and a thirteenth lens; the aperture stops include a first aperture stop and a second aperture stop. The wide-field illumination module uses Kohler illumination to ensure uniformity of the illumination field of view. The point light source emitted by the LED light source passes through the entrance pupil of the conjugate microscope objectives of the twelfth and thirteenth lenses. The first and second aperture stops are used to adjust the range and brightness of the illumination field of view, respectively.

[0078] The dichroic mirror of the wide-field illumination module is a short-pass dichroic mirror, which transmits the illumination beam of the wide-field illumination module and reflects the excitation light of the double potential trap optical tweezers module, the excitation light of the plasmonic optical tweezers excitation module, and the excitation light and signal light of the fluorescence excitation and detection module.

[0079] The excitation light from the transmission dual-potential-trap optical tweezers module, the excitation light from the plasmonic optical tweezers excitation module, the excitation light and signal light from the fluorescence excitation and detection module, and the illumination beam from the wide-field illumination module are all focused through the microscope objective of the wide-field illumination module.

[0080] The wide-field imaging module includes a microscope objective, a non-polarizing beam splitter prism, a mirror, a filter, a lens, and a CCD camera. The microscope objective collects the light signal transmitted through the sample cell of the microfluidic chip. After transmission through the non-polarizing beam splitter prism and reflection through the mirror, the light passes through the filter to remove unwanted stray light signals. The filter is mounted on a switchable mount and can be used to filter the excitation wavelengths of the dual-potential-well optical tweezers excitation module and the plasmon optical tweezers excitation module, depending on the requirements. Finally, the signal light is focused onto the CCD camera by the lens for imaging.

[0081] Both the position detection module and the wide-field imaging module use the microscope objective of the wide-field imaging module for signal collection.

[0082] Furthermore, the biomacromolecules include proteins, peptides, and nucleic acids; the nucleic acids include single-stranded or double-stranded nucleic acids.

[0083] Furthermore, the microspheres include any one or more of polystyrene microspheres, silica microspheres, and barium titanate microspheres.

[0084] It is understandable that any microsphere, as long as it can be connected and fixed to the sequence to be tested, can be used to achieve direct-read sequencing using the method provided by this invention. However, microspheres of different materials have a certain impact on the anti-interference ability and detection accuracy of the detection process when used for direct-read sequencing.

[0085] In some embodiments, the present invention preferably uses polystyrene microspheres because polystyrene microspheres have better light transmittance, which can effectively reduce laser scattering interference. At the same time, polystyrene microspheres have good biocompatibility and are easier to chemically modify on their surface, such as by modifying them with streptavidin, antibodies, etc., so that they can stably connect and fix with the target sequence, ensuring that the target sequence is straightened and that a portion of the sequence is stably captured under the action of plasmon optical tweezers, so as to smoothly control each segment of 1 to 3 bases in the target sequence to enter the tunneling region for accurate detection.

[0086] Furthermore, the biomacromolecules are connected to the microspheres via a linker, which includes any one or more of streptavidin-biotin, antibody-antigen, and thiol-coupled covalently linked molecules.

[0087] In theory, any linker that can connect and fix the sequence to be tested to microspheres can be used to construct a scanning direct-read sequencing system.

[0088] However, different linkers have different binding methods and therefore different binding effects. You can choose the appropriate linker based on your specific needs.

[0089] In some methods, the linker is streptavidin-biotin, which has a relatively high binding strength and a wide range of applications.

[0090] In some methods, the linker is an antibody-antigen pair, which also has very good binding strength.

[0091] In some methods, streptavidin-biotin is preferred as a linker, which makes the connection of the test sequence more stable, easier to control and ensure the straightening of the test sequence, and maintains the stable capture of part of the sequence under the action of plasmon optical tweezers, so as to smoothly control each segment of 1 to 3 bases in the test sequence to enter the tunneling region for accurate detection.

[0092] In some methods, when the biomacromolecule is a protein molecule, the dynamic information of the protein can also be detected using the direct-read scanning method provided by this invention. Protein molecules have a three-dimensional spatial structure and require functional modification to fix them between two microspheres. That is, the previously sequenced chain-like biomacromolecule (DNA chain or polypeptide chain) is replaced with a linker-protein complex. The protein is functionalized and positioned in the middle of the linker chain. The linker chain is then fixed using microsphere grippers. The signal feedback obtained by scanning the linker chain is then used to locate the tunneling probe at the protein site bound to the biomacromolecule. The tunneling current is used to perform long-term stable signal monitoring of the protein at the single-molecule level, obtaining the dynamic information of the protein in the solution phase.

[0093] Furthermore, this invention provides a method for direct-read sequencing of biological macromolecules, wherein the method employs the system described above for sequencing and includes the following steps:

[0094] (1) Assemble the microfluidic chip liquid pool;

[0095] (2) Phosphate buffer solution, sequencing sample solution and microsphere sample solution are introduced into the first, second and third channels respectively. The solutions in the three channels are kept flowing, generating a laminar flow effect.

[0096] (3) The two optical tweezer potential traps generated by the dual potential trap optical tweezer excitation module move sequentially from the third channel, the second channel, and finally to the first channel, so that the two ends of the sequence to be tested are connected to the microspheres and enter the first channel under the control of the optical tweezer potential traps;

[0097] (4) Control the two microspheres connected to the sequence to be tested to enter the tunneling probe channel, and control part of the sequence to be tested to enter the tunneling sensing area through the plasmonic optical tweezers excitation module;

[0098] (5) By controlling the movement of the two optical tweezers potential traps, the movement of the two microspheres can be controlled, thereby achieving sub-nanometer precision control of the relative position of the tunneling probe to the sequence fragment to be tested, and realizing scanning direct reading sequencing.

[0099] Furthermore, the reusable scan direct-read biomolecule analysis and sequencing method includes the following steps:

[0100] Step 1: Assemble the microfluidic chip liquid pool, fix the tunneling probe in the tunneling probe channel of the microfluidic chip liquid pool, then install the microfluidic chip liquid pool on the stage, connect the microfluidic chip liquid pool to the injection pump of the microfluidic module using a rubber capillary tube, and then add microsphere sample solution, sequencing sample (peptide chain, DNA, DNA-protein complex) solution, and phosphate buffer solution to the solution pools of the three injection pumps respectively.

[0101] Step 2: Open the first channel of the microfluidic chip liquid pool, keep the second and third channels closed, and introduce phosphate buffer solution into the microfluidic chip liquid pool. At this time, the phosphate buffer solution fills the internal space of the microfluidic chip liquid pool and simultaneously immerses the tip tunneling electrode pair of the tunneling probe.

[0102] Step 3: Move the focus of the microscope objective to the third channel of the microfluidic chip liquid pool. Then, open the first, second, and third inlet channels of the microfluidic chip liquid pool. The three liquids are injected into the microfluidic chip liquid pool through the inlets. Due to laminar flow, the three liquids flow in layers within the microfluidic chip liquid pool without interfering with each other. Open the dual-potential-well optical tweezers and capture a microsphere at each optical tweezer potential well as a gripper.

[0103] Step 4: Control the stage to move the two optical tweezers potential wells that capture the microspheres from the third channel of the microfluidic chip's liquid pool to the second channel. The microspheres in the potential wells move to the second channel and remain in a fixed position. The spatial light modulator in the dual-potential-well optical tweezers module controls the position of the two optical tweezers potential wells and adjusts them to a suitable distance so that the test sequence sample flowing in the second channel can be functionalized and attached to the microspheres. During this process, the position parameters of each microsphere gripper in the x, y, and z directions can be obtained through the position detection module, and the displacement and force changes of the microsphere grippers can be viewed in real time to determine whether the test sequence has been successfully attached to the microsphere grippers.

[0104] Step 5: Control the stage to move the two microsphere grippers connected to the test sequence into the first channel. The solution in the first channel contains only phosphate buffer solution, which can wash away excess test sequence sample. At the same time, fluorescence signal detection and tensile force curve detection of the test sequence are performed in the phosphate buffer solution to ensure that the microsphere grippers are connected to a single test sequence.

[0105] Step 6: Control the movement of the stage (controlling the movement of the stage, rather than using optical tweezers potential traps to move the microspheres into the tunneling channel, is mainly due to the limited travel distance. Controlling the transfer of microspheres between different channels would typically require distances of tens or hundreds of micrometers, or even millimeters, depending on the chip size. The displacement of optical tweezers potential traps is controlled by a spatial light modulator or scanning mirror, which has a limited scanning area, generally only within 50 micrometers depending on the objective lens focal length. Therefore, controlling the movement of the stage is chosen). Move the two microspheres connected to the test sequence into the tunneling probe channel. Turn on the excitation source of the plasmonic optical tweezers excitation module. The laser focus, after prior optical path calibration, is located in the middle of the two optical tweezers potential traps. Use a three-dimensional nanopiezoelectric platform to finely adjust the position of the microfluidic chip's liquid pool. In the electrical signal acquisition module, a lock-in amplifier is used to monitor the photocurrent signal in real time. The feedback of the photocurrent signal determines whether the tunneling electrode pair at the tip of the tunneling probe is located at the focal point of the excitation light.

[0106] When the tunneling electrode pair is located within a certain range of the excitation light field, a photocurrent signal can be collected. However, the closer the tunneling electrode pair is to the focal point of the excitation light field, the stronger the collected photocurrent signal. Therefore, the position of the tunneling electrode pair relative to the focal point of the excitation light can be precisely controlled by the intensity change of the photocurrent signal.

[0107] Meanwhile, the tunneling current signal of the tunneling electrode pair can be monitored in real time using the patch clamp system. When the tunneling electrode pair is located at the focal point of the excitation spot, it means that the tunneling electrode pair has approached the test sequence in the middle of the microsphere gripper. When the distance between the two reaches a certain range (about 10 nm), the test sequence fragment located near the tunneling electrode pair will approach the tunneling electrode pair under the action of plasmonic optical tweezers and enter the tunneling sensing region, generating specific tunneling current fluctuations. At this time, the microsphere position detection system can also observe that the microsphere gripper is subjected to a traction force pointing between the two. By adjusting the intensity of the optical tweezer potential well and the distance between the two optical tweezer potential wells, the process of the test sequence fragment entering the tunneling sensing region can be optimized, thereby improving the signal-to-noise ratio.

[0108] Step 7: By controlling the movement of the two optical tweezer potential traps through the spatial light modulator in the dual-potential-tweezer module, the relative position of the tunneling electrode to the sequence fragment to be tested can be controlled with sub-nanometer precision. Then, the sequence to be tested between the two microsphere grippers is scanned to obtain the base (amino acid) sequence information at different sites, and the sequencing accuracy is improved through repeated scanning.

[0109] The present invention has the following beneficial effects:

[0110] 1. A novel scanning direct-read sequencing method based on tunneling probes is provided. By cleverly combining two optical tweezers technologies, namely dual-potential-trap optical tweezers and plasmonic optical tweezers, microspheres are connected to both ends of the sequence to be measured. The position and distance of the two microspheres are controlled by the dual-potential-trap optical tweezers, and under the action of plasmonic optical tweezers, part of the sequence is induced to enter the tunneling region. Sequencing is performed based on changes in the tunneling signal. This method can achieve scanning direct-read sequencing of bases or amino acids one by one, and can also perform repeated sequencing. The scanning accuracy reaches the sub-nanometer level, which can effectively improve the sequencing accuracy.

[0111] 2. By selecting appropriate power for the dual-potential-trap optical tweezers and plasmonic optical tweezers, the three forces acting on the sequence to be measured are all within a suitable range, thus successfully achieving direct reading sequencing of bases or amino acids one by one.

[0112] 3. The structure of the liquid pool in the microfluidic chip has been improved by separating the tunneling probe channel from the sample liquid channel to ensure that the tunneling probe electrode is not disturbed; three laminar flow channels on the same horizontal plane are set up to facilitate the control of the test sequence and microspheres by the dual potential trap optical tweezers. The microspheres can be controlled to move and change positions between the three channels, making the control process easier to implement and the control accuracy higher.

[0113] 4. Select appropriate reagents to passivate the surface of the microfluidic chip liquid cell. This will ensure that the sample is not adsorbed and that the light transmittance after passivation is not affected, thus ensuring the accuracy of scanning and direct reading sequencing.

[0114] 5. Selecting appropriate microspheres and linkers can effectively reduce laser scattering interference, have good biocompatibility, and can stably connect and fix with the sequence to be tested. It is easier to control and ensure the straightening of the sequence to be tested, and maintain the stable capture of part of the sequence under the action of plasmon optical tweezers. It can smoothly control each segment of 1 to 3 bases in the sequence to be tested to enter the tunneling region for accurate detection. Attached Figure Description

[0115] Figure 1 This is a schematic diagram of a biomolecular scanning direct-read sequencing system combining optical tweezers manipulation and tunneling sensing, as shown in Example 1.

[0116] Figure 2 This is a schematic diagram of the optical path of a biomolecular scanning direct-read sequencing system combining optical tweezers manipulation and tunneling sensing, as shown in Example 1.

[0117] Figure 3 This is a schematic diagram of a microfluidic chip liquid pool in a biomolecular scanning direct-read sequencing system that combines optical tweezers manipulation and tunneling sensing, as shown in Example 1.

[0118] Figure 4 This is a partial structural diagram of the tunneling probe inserted into the liquid pool of the microfluidic chip in Example 1;

[0119] Figure 5 This is a scanning electron microscope image of the tunneling probe of a biomacromolecule scanning direct-read sequencing system that combines optical tweezers manipulation and tunneling sensing in Example 1.

[0120] Figure 6 This is a schematic diagram of the process of detecting DNA tunneling current signals using the biomacromolecule scanning direct-read sequencing method in Example 1;

[0121] Figure 7 This is a schematic diagram of the DNA tunneling scanning and direct reading sequencing method for biomacromolecules in Example 1, which uses a dual optical tweezers potential trap to control the position of the microsphere grippers for direct reading.

[0122] Figure 8 This is a schematic diagram showing the results of photocurrent signal testing using the biomacromolecule scanning direct-read sequencing method in Example 2;

[0123] Figure 9 The tunneling current signals of bases T, C, G, and A were measured by the direct-read sequencing method for biomacromolecules in Example 2.

[0124] Figure 10 The scanning tunneling signal of long-chain DNA obtained by the biomacromolecule scanning direct-read sequencing method in Example 2;

[0125] Figure 11The tunneling current signals of each amino acid were measured by the biomacromolecule scanning direct-read sequencing method in Example 2;

[0126] Figure 12 The results of scanning tunneling signal detection for peptide sequences obtained by the biomacromolecule scanning direct-read sequencing method in Example 2;

[0127] Figure 13 The results show the scanning tunneling signal detection of protein molecules obtained by the direct-read sequencing method for biomacromolecules in Example 2. Detailed Implementation

[0128] To describe the present invention more specifically, the technical solution of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. These descriptions are merely illustrative of how the present invention is implemented and do not limit the specific scope of the present invention. The scope of the present invention is defined in the claims.

[0129] Example 1: The biological macromolecule scanning direct-read sequencing system provided by the present invention

[0130] The schematic diagram of the biomolecular scanning direct-read sequencing system (hereinafter referred to as the detection system) combining optical tweezers manipulation and tunneling sensing provided in this embodiment is shown below. Figure 1 See the optical path diagram. Figure 2 .

[0131] like Figure 1 As shown, the system includes a dual-potential-well optical tweezers excitation module 100, a plasmonic optical tweezers excitation module 200, a fluorescence excitation and detection module 300, a sample stage module 400, a wide-field illumination module 500, an electrical signal acquisition module 600, a position detection module 700, a wide-field imaging module 800, and a microfluidic control module 900. The sample stage module 400 contains a tunneling probe 90. By connecting the two ends of the biomolecule to be tested to microspheres, the dual-potential-well optical tweezers excitation module 100 controls the position and distance between the two microspheres, thereby controlling the position and state of the biomolecule. The plasmonic optical tweezers excitation module 200 is used to induce the biomolecule to enter the tunneling sensing region 91 of the tunneling probe 90.

[0132] The distance between the nanostructures 92 of the tunneling probe 90 (the distance between tunneling electrode pairs) is typically in the sub-5 nm range. Under the drive of an external bias voltage, a tunneling current is formed between the tunneling electrode pairs. The tunneling probe 90 provided in this embodiment is formed by further electrodepositing gold nanoclusters at the tip of a tapered glass needle drawn from a double-hole quartz glass tube. Its scanning electron microscope image is shown below. Figure 5The glass tube is 110 mm long, with an outer diameter of 1.2 mm and an inner diameter of 0.9 mm. The nanostructure 92 (tunneling electrode pair) at the tip of the tunneling probe consists of two gold nanoclusters with a diameter of 100 nm. The distance between the gold nanoclusters is in the sub-5 nm range. Therefore, when an external wire is connected to the tunneling probe 90 to apply a diameter bias voltage, a tunneling current will be formed between the tunneling electrode pair according to the principle of quantum tunneling effect. The tunneling current is very sensitive to the electronic structure of the target analyte located in the tunneling sensing region 91, and can identify and detect the target analyte at the single-molecule level.

[0133] like Figure 2 As shown, the dual-potential-well optical tweezers excitation module 100 includes a laser source 1, a laser collimating lens 2, a first half-wave plate 3, a first polarizing beam splitter prism 4, a non-polarizing beam splitter prism 5, a first spatial light modulator 6, a second spatial light modulator 7, a second half-wave plate 8, a third half-wave plate 9, a second polarizing beam splitter prism 10, a first lens 11, a second lens 12, and a dichroic mirror 13. Its function is to form two independent optical tweezers potential wells in the sample cell, thereby capturing microspheres in the sample cell solution, immobilizing the sequence to be measured with the microspheres, and then scanning the immobilized sequence in the solution using a tunneling probe combined with plasmon optical tweezers.

[0134] The linearly polarized laser emitted from the laser source 1 of the dual-potential-well optical tweezers excitation module 100 is collimated into a parallel beam by the laser collimating lens 2. The first half-wave plate 3 and the first polarizing beam splitter prism 4 combine to form a power control module. The first polarizing beam splitter prism 4 only allows horizontally polarized lasers to pass through. Rotating the first half-wave plate 3 changes the polarization angle of the linearly polarized laser, continuously altering the proportion of the horizontally polarized component in the laser, thus achieving continuous control of the laser power. After strict power control, the horizontally polarized laser is split into two laser beams by a 5:5 non-polarizing beam splitter prism 5. The laser beam in the transmission path is reflected by the first spatial light modulator 6 and then passes through the second half-wave plate 8 for laser linear polarization angle control. The laser beam in the reflection path is reflected by the second spatial light modulator 7 and then passes through the third half-wave plate 9 for laser linear polarization angle control. The first spatial light modulator 6 and the second spatial light modulator 7 control the polarization of the laser beams, achieving position control of the optical tweezers potential well. The two laser beams are then combined by the polarizing beam splitter prism 10. The polarization beam splitter prism 10 allows vertically polarized laser beams to be reflected and horizontally polarized laser beams to be transmitted. Therefore, the polarization angles of the two laser beams can be adjusted independently using the second half-wave plate 8 and the third half-wave plate 9, thus independently controlling the power of the two laser beams and consequently the intensity of the two optical tweezer potential wells. Furthermore, it enables the separation of the polarization states of the laser beams in the two optical tweezer potential wells, facilitating the subsequent detection of the captured microsphere's position. The combined laser beam is then expanded by a beam-expanding module composed of lenses 11 and 12.

[0135] The dichroic mirror 13 of the dual-potential-well optical tweezers excitation module 100 is a long-pass dichroic mirror that transmits the excitation beam of the dual-potential-well optical tweezers excitation module 100 and simultaneously reflects the excitation beam of the plasmonic optical tweezers excitation module 200, the excitation beam of the fluorescence excitation module 300, and the signal beam.

[0136] The plasmonic optical tweezers excitation module 200 includes a laser source 14, a laser collimating lens 15, a fourth half-wave plate 16, a polarizing beam splitter prism 17, a first reflecting mirror 18, a second reflecting mirror 19, a fifth half-wave plate 20, a third lens 21, a fourth lens 22, and a dichroic mirror 23. Its function is to excite the local surface plasmonic resonance effect of the nanostructure 92 at the tip of the tunneling probe 90, obtain an enhanced electromagnetic field in the nanostructure 92, thereby forming an optical gradient force field pointing to the nano gap at the tip of the tunneling probe 90, and pulling the sequence fragments of the nearby DNA chain or peptide chain located near the nano gap to the tunneling sensing region 91 for electrical signal testing.

[0137] The wavelength of the laser source 14 meets the requirement of exciting the local surface plasmon resonance effect of the metal tunneling electrode pair. The linearly polarized laser emitted by the laser source 14 is collimated into a parallel beam by the laser collimating lens 15. The fourth half-wave plate 16 and the polarizing beam splitter prism 17 are combined as a power control module. After strict power control, the laser beam path direction is adjusted by a mirror group consisting of the first reflecting mirror 18 and the second reflecting mirror 19. Then it passes through the fifth half-wave plate 20, which is used to control the linear polarization direction of the laser to be parallel to the local surface plasmon resonance coupling direction of the tunneling electrode pair. After polarization control, the laser beam is expanded by a beam expanding module consisting of the third lens 21 and the fourth lens 22. The expanded laser beam is reflected by the dichroic mirror 23 and enters the main optical path.

[0138] The local surface plasmon resonance coupling direction of the nanostructure 92 at the tip of the tunneling probe 90 refers to the laser polarization direction in which the nano gaps between the nanostructures 92 obtain the maximum electromagnetic field enhancement under laser excitation. For the nanostructure 92 with the nano gap in the middle, it is usually along the direction from one end electrode to the other end electrode.

[0139] The dichroic mirror 23 of the plasmonic optical tweezers excitation module 200 is a short-pass dichroic mirror, which reflects the excitation light of the plasmonic optical tweezers excitation module 200 and transmits the excitation light and signal light of the fluorescence excitation and detection module 300.

[0140] This embodiment achieves repetitive scanning direct-read sequencing of long-chain DNA or polypeptide chains by combining tunneling sensing, dual-potential-well optical tweezers, and plasmon optical tweezers. Specifically, the target sequence (DNA or polypeptide chain) is functionalized and attached to two microspheres at both ends. Then, dual-potential-well optical tweezers are used to capture and manipulate the two microspheres attached to the target sequence. The two microspheres act like grippers, flattening the target sequence in the middle and moving it along with the sequence in the sample cell. Therefore, by controlling the position of the optical tweezers potential well, the target sequence can be moved to the vicinity of the nanostructure 92 at the tip of the tunneling probe 90. Then, under the action of plasmon optical tweezers, the fragment of the target sequence located near the tunneling sensing region 91 is subjected to an optical gradient force pointing towards the nano-gap of the tunneling probe and is pulled into the nano-gap for signal detection. Since different bases cause different tunneling current fluctuations in the tunneling sensing region 91, different base units or amino acid units in the target sequence can be identified through the tunneling current signal. Then, by controlling the position of the dual-potential-trap optical tweezers, the positional movement of the sequence to be tested relative to the tunneling probe 90 can be achieved, enabling the identification of different segments in the sequence to be tested, and ultimately realizing sequencing.

[0141] There are two ways to control the positional movement of the sequence to be tested relative to the tunneling probe 90. The first is to keep the optical tweezer potential well stationary and use a three-dimensional nanopiezoelectric platform to control the positional movement of the tunneling probe 90. The second is to keep the position of the tunneling probe 90 stationary and use a spatial light modulator to control the position of the optical tweezer potential well. This second method has higher positional accuracy, making the distance of each movement precise to the distance of each base or amino acid. That is, each movement is equivalent to moving one unit in the sequence to be tested. Therefore, the second method is more conducive to achieving direct reading of scans with single base and single amino acid precision. Moreover, this movement direction can be forward along the straight line of the sequence to be tested, or backward, so it can be repeated to achieve repeated scanning and direct reading.

[0142] Existing sequencing methods based on tunneling probes attempt to maintain the target sequence as linearly as possible by directional movement within the tunneling region for detection, such as traversing through nanopores or tunneling regions to check for current changes. This approach struggles to guarantee that the target single base or amino acid remains within the tunneling region, compromising sequencing accuracy. This embodiment cleverly combines dual-potential-well optical tweezers and plasmonic optical tweezers. First, dual-potential-well optical tweezers are used to maintain and fix the target sequence in a linear position. Then, plasmonic optical tweezers apply a lateral force to the target sequence, pulling a portion of the sequence (approximately 1-3 bases or 1-3 amino acids) into the tunneling region (e.g., a single base or amino acid). Figures 6-7After sequencing a single base or amino acid, the sequence to be tested is moved one base or amino acid along the linear direction using dual-potential-trap optical tweezers. This causes the next single base or amino acid to be pulled laterally into the tunneling region. This process is repeated to ensure that each base or amino acid in the sequence is sequentially entered into the tunneling region for accurate detection, thus guaranteeing the accuracy of the sequencing.

[0143] Dual-trap optical tweezers control two microspheres to keep the sequence under test in a straight line and fix it in place, while plasmon optical tweezers pull some bases into the tunneling region. In other words, dual-trap optical tweezers provide two longitudinal forces, while plasmon optical tweezers provide lateral forces. The sequence under test is subjected to three forces, and these forces need to be kept in a certain balance. For example, the force of the dual-trap optical tweezers cannot be too large, making it difficult for the plasmon optical tweezers to pull; the force of the plasmon optical tweezers cannot be too large either, causing the dual-trap optical tweezers to fail to fix the sequence under test, or causing the entire sequence under test to be completely folded and pulled into the tunneling region, etc. Therefore, the power of the dual-potential-well optical tweezers excitation module 100 and the plasmonic optical tweezers excitation module 200 must be controlled, with the power of the dual-potential-well optical tweezers excitation module 100 controlled in the range of 0.5~1 W and the power of the plasmonic optical tweezers excitation module 200 controlled in the range of 0.5~20 mW (in this embodiment, the power of the dual-potential-well optical tweezers excitation module 100 is preferably 0.6 W and the power of the plasmonic optical tweezers excitation module 200 is preferably 10 mW), in order to ensure that the three forces on the sequence to be tested are within a suitable control range, thereby successfully achieving scanning direct-read sequencing.

[0144] The sample stage module 400 includes a stage, a microfluidic chip reservoir 80, a three-dimensional nanopiezoelectric platform, and an electromagnetic signal shielding box. The microfluidic chip reservoir 80 and the tunneling probe 90 are fixed on the stage. The three-dimensional nanopiezoelectric platform controls the movement of the stage, adjusting the position of the microfluidic chip reservoir 80. The three-dimensional nanopiezoelectric platform is an extremely precise motion control device that utilizes the piezoelectric effect as its driving principle, enabling nanometer-level displacement, positioning, and scanning motion in three mutually perpendicular directions (X, Y, and Z). The entire stage is placed within the electromagnetic signal shielding box to ensure that the collected electrical signals are not interfered with by external electromagnetic noise, thus improving the signal-to-noise ratio.

[0145] A schematic diagram of the microfluidic chip liquid pool 80 is shown below. Figure 3 The microfluidic chip liquid pool 80 is provided with a tunneling probe channel 81, a sample liquid channel 82 and a waste liquid channel 83. The tunneling probe channel 81 and the sample liquid channel 82 are separated from each other. When the sample flows in the sample liquid channel 82, it maintains a certain distance from the tunneling probe 90, so that the tunneling probe 90 will not be disturbed during the process of entering and exiting the sample liquid.

[0146] like Figure 3As shown, the sample liquid channel 82 includes a first channel 84, a second channel 85, and a third channel 86. The first channel 84 is used to inject the microsphere sample liquid, the second channel 85 is used to inject the sample liquid of the sequence to be tested, and the third channel 86 is used to inject a buffer solution without a sample. The three channels are located in the same horizontal plane (at the same height), and the liquid in each channel flows independently without interfering with each other through the laminar flow effect. The laminar flow effect refers to the phenomenon that during the flow of liquid, the fluids in each layer move in a parallel, orderly, and unmixed manner. The fluid molecules in the laminar flow flow along a basically fixed path, without significant lateral mixing.

[0147] The entire microfluidic chip reservoir 80, after connecting the sample inlet 87 of the sample liquid channel 82 and the waste liquid outlet 88 of the waste liquid channel 83 to the microfluidic control module 900, is in a sealed structure. The tunneling probe channel 81 uses a threaded seal, with the tip of the tunneling probe 90 extending into the channel. An O-ring 89 is installed at the channel opening, and tightening the threads deforms the O-ring 89, completely fixing the tunneling probe 90 in the channel and ensuring the microfluidic chip reservoir 80 is sealed in this channel. During use, the sample liquid injection into each channel inlet of the microfluidic chip reservoir 80 is controlled by a separate injection pump system. Initially, the uppermost buffer solution inlet can be opened, while the middle and lower inlets are closed. This allows the buffer solution to fill all channels of the microfluidic chip reservoir 80, including the tunneling probe channel 81. When the first channel 84, the second channel 85, and the third channel 86 are injected simultaneously, the sample solutions injected into the three channels do not affect each other due to laminar flow. During the test, the sample solution is injected from the sample inlet 87 and flows out from the waste outlet 88, which enables the circulation of the sample solution in the microfluidic chip.

[0148] The microfluidic control module 900 controls the flow of the sample solution within the microfluidic chip reservoir 80. The microfluidic control module 900 includes a syringe pump, a waste liquid reservoir, and a flow rate control system. Through the microfluidic control module 900, each inlet channel of the microfluidic chip reservoir 80 can be independently controlled according to experimental requirements. Simultaneously, it can collect sample waste liquid, preventing waste liquid contamination, and achieve sample solution circulation within the microfluidic chip reservoir 80.

[0149] Preferably, the microfluidic chip reservoir 80 is made of quartz glass, and its surface is passivated using a phospholipid bilayer. Since the tunneling probe 90 is rigid overall and its tip is very fragile, the reservoir also needs to be made of a rigid material to protect the probe tip. Furthermore, to improve the optical transmittance across multiple wavelengths, quartz glass is preferably used as the main material for the reservoir. The fabrication cost of the quartz microfluidic reservoir 80 is relatively high. The microfluidic chip reservoir 80 provided in this embodiment can be repeatedly disassembled and reused, thereby reducing costs. To ensure the accuracy of direct-read sequencing, the microfluidic chip reservoir 80 needs to be passivated with a phospholipid bilayer (1-palmitoyl-2-oleoylphosphatidylcholine, POPC) before use to prevent the sample to be sequenced from adsorbing onto the reservoir wall during sequencing experiments, thus affecting the precise control and displacement of the sample. The specific process is as follows: First, inject 200 μL of PBS buffer into the liquid pool through the upper channel to remove air bubbles. Then, inject 80 μL of pretreated POPC solution. (POPC needs to be pretreated before being used for passivation of microfluidic chips, mainly to remove the organic solvent in the original POPC solution, usually methanol, because commercially available POPC is generally stored dissolved in methanol. The pretreatment method is as follows: 1. Take 80 µL of POPC methanol solution and place it in a centrifuge tube, then blow it dry with nitrogen gas to evaporate the methanol in the solution until a dry lipid film is formed; 2. Add 200 µL of POPC buffer (20 mM Tris pH 7.5 + 100 mM) to the centrifuge tube.) NaCl was used to dissolve and disperse the lipid film by thorough shaking; 3. The solution in the centrifuge tube was further sonicated for 30 minutes until the solution in the centrifuge tube became clear and transparent, so that the lipids were dispersed into uniform small monolayer liposomes, which were then used as the passivation treatment POPC solution. In biological experiments, methanol can damage protein structure and cell membrane integrity, directly affecting subsequent biological experiments (such as protein binding and cell interaction). In addition, reconstructing the liposome structure can obtain smaller and more uniform liposomes (such as 100-200 nm), improve the uniformity of bilayer formation, and enhance the stability of the passivation layer. Incubate for 10 minutes, repeat three times, to passivate the walls of the liquid pool and prevent sample adsorption during sequencing.

[0150] like Figure 3 As shown, the tunneling probe 90 is installed using a silicone O-ring mechanical seal 89. Specifically, the tunneling probe channel 81 of the microfluidic chip's liquid pool 80 is designed with two different inner diameters. The smaller diameter channel 811 connects to the chip body and has a diameter of 800µm, allowing the tip of the tunneling probe 90 to enter while ensuring sufficient space for subsequent scanning at the potential well location. The larger diameter channel 812 is an M4 threaded hole used for tightening screws 813 to pressurize and seal the tunneling probe channel 81.

[0151] During the installation of the tunneling probe 90, the tunneling probe 90 is first inserted into a through hole 814 with a central diameter of 1.25 mm. Figure 4 The tapered tip protrudes from the other end, and then the screw is screwed into the large-diameter channel 812. There is a custom silicone O-ring 89 at the transition connection between the large-diameter channel 812 and the small-diameter channel 811. The tightening screw 813 is screwed in to tighten and pressurize, causing the O-ring to deform and achieve channel sealing.

[0152] The fluorescence excitation and detection module 300 is used to excite and detect the fluorescence signal of the microspheres, thereby further determining the capture behavior of the microspheres by the dual-potential-trap optical tweezers. It is understood that if the target sequence contains a fluorescent group, the fluorescence excitation and detection module 300 can also be used to excite and detect the fluorescent group located on the target sequence, thereby characterizing the position of the target sequence.

[0153] The fluorescence excitation and detection module 300 includes a laser source 24, a laser collimating lens 25, a sixth half-wave plate 26, a polarizing beam splitter prism 27, a third reflecting mirror 28, a fourth reflecting mirror 29, a seventh half-wave plate 30, a fifth lens 31, a sixth lens 32, a dichroic mirror 33, a spatial light modulator 34, a fifth reflecting mirror 35, a filter 36, a seventh lens 37, an aperture stop 38, an eighth lens 39, a sixth reflecting mirror 40, a seventh reflecting mirror 41, a ninth lens 42, and an avalanche photodiode (APD) 43.

[0154] The wavelength of the laser source 24 meets the requirements for fluorescence in microspheres or fluorescent groups in DNA. In the fluorescence excitation optical path, the laser from the laser source 24 is output through a single-mode optical fiber with a core diameter of 1 μm, acting as a small aperture. The laser passing through the fiber port is equivalent to the laser exiting through a small aperture with a diameter of 1 μm. The linearly polarized laser emitted by the laser source 24 is collimated into a parallel beam by the laser collimating lens 25. The sixth half-wave plate 26 and the polarization beam splitter prism 27 are combined as a power control module. After strict power control, the laser beam path direction is adjusted by a mirror group consisting of the third reflecting mirror 28 and the fourth reflecting mirror 29. Then it passes through the seventh half-wave plate 30, which is used to control the linear polarization direction of the laser. After polarization control, the laser beam is expanded by a beam expanding module consisting of the fifth lens 31 and the sixth lens 32. The expanded laser beam passes through the dichroic mirror 33, and then is reflected by the spatial light modulator 34 before entering the main optical path. The spatial light modulator 34 can control the deflection of the fluorescence excitation beam to achieve fluorescence scanning. The front-end optical path of the fluorescence detection optical path is connected to the fluorescence excitation optical path, ensuring high-efficiency collection of the returned fluorescence signal. The returned fluorescence signal is separated from the fluorescence excitation optical path after reflection by the dichroic mirror 33. The reflected fluorescence signal is then reflected by the fifth mirror 35 and passes through the filter 36. The filter 36 filters out non-fluorescent wavelength components from the returned light signal. The filtered fluorescence signal is further filtered by a small-aperture filter module composed of the seventh lens 37, aperture 38, and eighth lens 39 to remove stray light. Then, after reflection by the sixth mirror 40 and the seventh mirror 41, it is focused into the APD 43 by the ninth lens 42. Signal collection in the APD 43 is also achieved through optical fiber; both the output fiber port of the laser source 24 and the collection fiber port of the APD 43 act as small apertures, enabling confocal fluorescence excitation and detection.

[0155] The dichroic mirror 33 of the fluorescence excitation and detection module 300 is a short-pass dichroic mirror that transmits the excitation light of the fluorescence excitation and detection module 300 and reflects the signal light of the fluorescence excitation and detection module 300.

[0156] The position detection module 700 is used to detect the position of the microsphere in the optical tweezers potential trap, thereby calculating the optical tweezers trapping stiffness of the microsphere and providing real-time feedback on the position of the microsphere. The position detection module 700 includes: a second microscope objective 52, a non-polarizing beam splitter prism 53, a filter 54, a polarizing beam splitter prism 55, a tenth lens 56, a first four-quadrant photodetector QPD 57, an eleventh lens 58, and a second four-quadrant photodetector QPD 59.

[0157] The signal light transmitted from the liquid pool 80 of the microfluidic chip is collected by the second microscope objective 52, and then reflected by the non-polarizing beam splitter prism 53 into the position detection module 700. The position detection module 700 is used to detect the position of the microsphere gripper, so the received light wavelength is the excitation wavelength of the dual-potential-well optical tweezers excitation module 100. The filter 54 further filters the optical signal from the optical tweezers potential wells. After filtering, the signal light is separated into horizontally polarized and vertically polarized signal light by the polarizing beam splitter prism 55. The two different polarization states correspond to two independent optical tweezers potential wells. The horizontally polarized signal light passes through the polarizing beam splitter prism 55, is focused by the tenth lens 56 onto the QPD 57 to detect the position of the microsphere in one optical tweezers potential well. The vertically polarized signal light is reflected by the polarizing beam splitter prism 55, focused by the eleventh lens 58 onto the QPD 59 to detect the position of the microsphere in the other optical tweezers potential well.

[0158] The function of the electrical signal acquisition module 600 is to acquire the photocurrent signal of the target object for identification, and adjust the coupling between the excitation light emitted by the plasmon optical tweezers module 200 and the nanostructure 92 of the tunneling probe 90 according to the photocurrent signal, so as to ensure the effective excitation of the local surface plasmon resonance effect of the nano gap.

[0159] The electrical signal acquisition module 600 includes a patch-clamp system and a lock-in amplifier system. The patch-clamp system acquires the tunneling current signal. During acquisition, the patch-clamp system applies a DC bias voltage between the two electrodes of the tunneling probe 90, forming a tunneling sensing region 91 between the tunneling electrodes with a sub-5 nm gap. The evolution of the tunneling current identifies the target object within this region. The lock-in amplifier system detects the photocurrent signal using the principle of phase-sensitive detection. Specifically, the laser source of the plasmonic optical tweezers excitation module 200 is modulated by a fixed-frequency sinusoidal or square-wave signal output from a signal generator, generating an intensity-modulated pulse beam that irradiates the nanometer gap of the nanostructure 92 at the tip of the tunneling probe 90, generating a tunneling photocurrent signal. The frequency of the signal generator's output signal is used as a reference frequency and input to the lock-in amplifier to extract the signal response related to this frequency, i.e., the photocurrent signal generated by the modulated laser irradiating the tunneling electrode pair. The extracted signal is used to adjust the coupling between the 200 excitation beams of the plasmonic optical tweezers module and the nanostructure 92 of the tunneling probe 90, ensuring the effective excitation of the local surface plasmonic resonance effect in the nanogap. The photocurrent signal generated by the laser-excited tunneling probe can be acquired using a lock-in amplifier. The amplitude of the photocurrent signal can be used to determine the degree of coupling between the laser and the tunneling gap. Simply put, it is to adjust the relative position of the tip of the tunneling probe and the focal point of the excitation beam so that the photocurrent reaches its maximum value.

[0160] The wide-field illumination module 500 provides an illumination field of view for wide-field imaging. It includes: an LED light source 44, a twelfth lens 45, a first aperture stop 46, a second aperture stop 47, a reflecting mirror 48, a thirteenth lens 49, a dichroic mirror 50, and a first microscope objective 51. The wide-field illumination module 500 uses Kohler illumination to ensure the uniformity of the illumination field of view. The point light source emitted by the LED light source 44 passes through the entrance pupil of the first microscope objective 51, which is conjugate to the twelfth lens 45 and the thirteenth lens 49. The first aperture stop 46 and the second aperture stop 47 are used to adjust the range and brightness of the illumination field of view, respectively (illumination imaging is used in the initial probe installation and preliminary focusing process).

[0161] The dichroic mirror 50 of the wide-field illumination module 500 is a short-pass dichroic mirror, transmitting the illumination beam from the wide-field illumination module 500 and reflecting the excitation light from the double-potential-well optical tweezers excitation module 100, the plasmon optical tweezers excitation module 200, and the excitation and signal light from the fluorescence excitation and detection module 300. The excitation light from the double-potential-well optical tweezers excitation module 100, the plasmon optical tweezers excitation module 200, the fluorescence excitation and detection module 300, and the illumination beam from the wide-field illumination module 500 are all focused by the first microscope objective 51 of the wide-field illumination module 500.

[0162] The wide-field imaging module 800 is used to image and characterize the test area (the central microfluidic channel, the channel at the tip of the tunneling probe, and the position of the tunneling probe tip) of the microfluidic chip liquid pool 80 under illumination. It can perform preliminary imaging observation of the microspheres in the microfluidic chip liquid pool 80 (imaging is needed to assist in chip installation, determining the position of the tunneling probe, determining the laser focusing position, and preliminary characterization of the microspheres; illumination imaging can be turned off during testing). It can also image the position of the tunneling probe 90 in the tunneling probe channel 81. The wide-field imaging module 800 includes: a second microscope objective 52 (both the position detection module 700 and the wide-field imaging module 800 use the same second microscope objective 52 for signal collection), a non-polarizing beam splitter prism 53, a mirror 60, a filter 61, a lens 62, and a CCD camera 63. The second microscope objective 52 collects the light signal transmitted through the liquid pool 80 of the microfluidic chip. After transmission through the non-polarizing beam splitter prism 53 and reflection through the mirror 60, it passes through a filter 61 to remove unwanted stray light signals. The filter 61 is mounted on a switchable mount and can be used to filter the excitation wavelengths of the dual-potential-well optical tweezers excitation module 100 and the plasmon optical tweezers excitation module 200, depending on the requirements. Finally, the signal light is focused by the lens 62 onto the CCD camera 63 for imaging.

[0163] Preferably, the biomolecules to be tested include proteins, peptides, and nucleic acids; the nucleic acids include single-stranded or double-stranded nucleic acids.

[0164] The microspheres include any one or more of polystyrene microspheres, silica microspheres, and barium titanate microspheres. Any microsphere, as long as it can connect and fix the target sequence, can achieve scanning direct-read sequencing using the method provided in this embodiment. However, different materials of microspheres have a certain impact on the anti-interference ability and detection accuracy of the detection process when used for scanning direct-read sequencing. This embodiment preferably uses polystyrene microspheres because polystyrene microspheres have better light transmittance, which can effectively reduce laser scattering interference. At the same time, polystyrene microspheres have good biocompatibility and are easier to chemically modify on their surface, such as by modifying them with streptavidin, antibodies, etc., so that they can stably connect and fix with the target sequence, ensuring that the target sequence is straightened and that a portion of the sequence is stably captured under the action of plasmon optical tweezers, so as to smoothly control each segment of 1 to 3 bases in the target sequence to enter the tunneling sensing region 91 for accurate detection.

[0165] The target biomolecule is linked to the microspheres via a linker, which can be any one or more of streptavidin-biotin, antibody-antigen, or thiol-coupled covalent binding. Theoretically, any linker that can fix the target sequence to the microspheres can be used to construct a scanning direct-read sequencing system. However, different linkers have different binding methods and binding effects, which can be selected according to actual needs. In this embodiment, the preferred linker is streptavidin-biotin, which has a relatively high binding strength, making the connection of the target sequence more stable, easier to control and ensure the straightening of the target sequence, and maintaining the stable capture of part of the sequence under the action of plasmon optical tweezers. This allows for the smooth control of each segment of 1-3 bases in the target sequence to enter the tunneling sensing region 91 for accurate detection, and has a wide range of applications.

[0166] When the biomacromolecule is a protein molecule, the dynamic information of the protein can also be detected using the direct-read scanning method provided in this embodiment. Protein molecules have a three-dimensional spatial structure and require functional modification to fix them between two microspheres. That is, the previously sequenced chain-like biomacromolecules (DNA chains or polypeptide chains) are replaced with a linker-protein complex. The protein is functionalized and positioned in the middle of the linker chain. The linker chain is then fixed using microsphere grippers. The signal feedback obtained by scanning the linker chain is then used to locate the tunneling probe at the protein site bound to the biomacromolecule. The tunneling current is used to perform long-term stable signal monitoring of the protein at the single-molecule level, obtaining the dynamic information of the protein in the solution phase.

[0167] Example 2: Sequencing method of the biomolecule scanning direct-read sequencing system provided by the present invention

[0168] This embodiment uses the biomolecular scanning direct-read sequencing system provided in Example 1 for sequencing. The specific method is as follows:

[0169] Step 1: Assemble the microfluidic chip reservoir 80, fix the tunneling probe 90 in the tunneling probe channel 81 of the microfluidic chip reservoir 80, and then install the microfluidic chip reservoir 80 on the stage. Connect the microfluidic chip reservoir 80 to the injection pump of the microfluidic control module using a rubber capillary tube. Then, add microsphere sample solution (streptavidin-modified polystyrene microspheres, purchased from Xianfeng Nano, catalog number 103532, particle size 1.0µm) and sequencing sample solution (the sample to be tested can be a polypeptide chain, DNA, protein, etc., in this embodiment, DNA is used as an example, concentration is 50 pM, the solvent of the solution is nucleic acid-free phosphate buffered saline, and the DNA sequence is linked to both ends with a linker, the linker is streptavidin-biotin, wherein the DNA is linked to both ends with biotin (about 3.4 kb) (commercial DNA comes with biotin, purchased from Integrated DNA Technologies, model Biotin-TEG Modified dsDNA (Custom)). Synthesis), specifically the sequence: 5'-Biotin-AGTCGACCTGCAGGCATGCAAGCTT GGCACTGGCCGTCGTTT TACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGC-Biotin-3' ; SEQ ID NO.1), phosphate buffer solution pH 7.3-7.5.

[0170] Step 2: Open the first channel 84 of the microfluidic chip liquid pool 80, keep the second channel 85 and the third channel 86 closed, and introduce phosphate buffer solution into the microfluidic chip liquid pool 80. At this time, the phosphate buffer solution fills the internal space of the microfluidic chip liquid pool 80 and simultaneously immerses the tip tunneling electrode pair of the tunneling probe 93.

[0171] Step 3: Move the focal points of the first microscope objective 51 and the second microscope objective 52 to the third channel 86 of the microfluidic chip liquid pool 80, with the laser incident direction 815 as follows. Figure 3As shown, the first inlet 871 of the first channel 84, the second inlet 872 of the second channel 85, and the third inlet 873 of the third channel 86 of the microfluidic chip liquid pool 80 are then opened. The three liquids are injected into the microfluidic chip liquid pool 80 through the inlets of each channel. Due to laminar flow, the three liquids flow in layers within the microfluidic chip liquid pool 80 without interfering with each other. A dual-potential-well optical tweezer (power 0.6W, potential-well region) is then activated, and a microsphere is captured at each optical tweezer potential well as a gripper.

[0172] Step 4: Control the stage to move the two optical tweezers potential wells that capture the microspheres from the third channel 86 of the microfluidic chip liquid pool 80 to the second channel 85. The microspheres in the potential wells move to the second channel 85 and remain in a fixed position. The positions of the two optical tweezers potential wells are controlled by the first spatial light modulator 6 and the second spatial light modulator 7 in the dual-potential-well optical tweezers excitation module 100, respectively, and adjusted to a suitable spacing so that the test sequence sample flowing in the second channel 85 can be functionalized and attached to the microspheres. During this process, the position parameters of each microsphere gripper in the x, y, and z directions can be obtained through the position detection module 700, and the displacement and force changes of the microsphere grippers can be viewed in real time to determine whether the test sequence has been successfully attached to the microsphere grippers.

[0173] Step 5: Control the stage to move the two microsphere grippers connected to the test sequence into the first channel 84. The solution in the first channel 84 contains only phosphate buffer solution, which can wash away excess test sequence sample. At the same time, the fluorescence signal and tensile force curve of the test sequence are detected in the phosphate buffer solution to ensure that the microsphere grippers are connected to a single test sequence.

[0174] Step 6: Control the stage to move, and move the two microspheres connected to the test sequence into the tunneling probe channel 81. Turn on the excitation source (10mW) of the plasmonic optical tweezers excitation module 200. The laser focus is located in the middle of the two optical tweezers potential wells after the previous optical path calibration. Use the three-dimensional nanopiezoelectric platform to finely adjust the position of the microfluidic chip liquid pool 80. Use a lock-in amplifier in the electrical signal acquisition module 600 to monitor the photocurrent signal in real time. Use the feedback of the photocurrent signal to determine whether the nanostructure 92 at the tip of the tunneling probe 90 is located at the focal point of the excitation light of the plasmonic optical tweezers excitation module 200. When the nanostructure 92 of the tunneling probe 90 is within a certain range of the excitation light field, the photocurrent signal can be collected. However, the closer the nanostructure 92 is to the focal point of the excitation light field, the stronger the collected photocurrent signal (e.g., ...). Figure 8As shown, the 40~50µm region is pulled into the tunneling sensing region 91 under the action of plasmonic optical tweezers, and the photocurrent is significantly increased. Therefore, the position of the tunneling electrode pair and the excitation light focus can be precisely controlled by the intensity change of the photocurrent signal, so that the nanostructure 92 of the tunneling probe 90 is located at the focus position of the excitation light of the plasmonic optical tweezers excitation module 200 before detection.

[0175] Simultaneously, the tunneling current signal of the tunneling probe 90 can be monitored in real time using a patch-clamp system. When the nanostructure 92 of the tunneling probe 90 is located at the focal point of the excitation spot, it means that the nanostructure 92 of the tunneling probe 90 has approached the test sequence in the middle of the microsphere gripper. When the distance between the two reaches a certain range (about 10 nm), the test sequence fragment located near the nanostructure 92 of the tunneling probe 90 will approach the nanostructure 92 of the tunneling probe 90 under the action of plasmonic optical tweezers and enter the tunneling sensing region, generating specific tunneling current fluctuations. At this time, the microsphere position detection system can also observe that the microsphere gripper is subjected to a traction force pointing between the two. By adjusting the intensity of the optical tweezer potential well and the distance between the two optical tweezer potential wells, the process of the test sequence fragment entering the tunneling sensing region 91 can be optimized, thereby improving the signal-to-noise ratio.

[0176] Step 7: By controlling the movement of the two optical tweezer potential traps through the first spatial light modulator 6 and the second spatial light modulator 7 in the dual potential trap optical tweezer excitation module 100, the relative position of the nanostructure 92 of the tunneling probe 90 to the sequence fragment to be tested can be controlled with sub-nanometer precision. Then, the sequence to be tested between the two microsphere grippers is scanned to obtain the base (amino acid) sequence information at different sites, and the sequencing accuracy is improved through repeated scanning.

[0177] For a DNA sequence, the tunneling current signals of the bases T, C, G, and A are different, specifically as follows: Figure 9 As shown. The scanning tunneling signal detection results of the long DNA sequence (SEQ ID NO.1) are as follows. Figure 10 As shown.

[0178] This embodiment also attempts to replace the sample solution with a 20 pM solution containing the peptide (SEQ ID NO.2: DFYDYFDFYFYDDFY), using a nucleic acid-free phosphate buffered saline as the solvent. The tunneling current signals of each amino acid in this solution are different: phenylalanine (Phe, F); aspartic acid (Asp, D); and tyrosine (Tyr, Y), specifically as follows... Figure 11 As shown. The scanning tunneling signal detection results of the peptide sequence (SEQ ID NO.2: DFYDYFDFYFYDDFY) are as follows. Figure 12 As shown.

[0179] This embodiment also attempted to replace the sample solution with a 10 nM solution containing a protein molecule (horseradish peroxidase), using a nucleic acid-free phosphate buffered saline as the solvent. The scanning tunneling signal detection results for the protein molecule are as follows: Figure 13 As shown.

[0180] Example 3: Power Selection of Dual-Potential-Trap Optical Tweezers and Plasmon Optical Tweezers

[0181] This embodiment uses the method provided in Example 2 for scanning direct-read sequencing. The sample solution to be tested is a solution containing DNA sequence SEQ ID NO.1 with a concentration of 50 pM, and the solvent is nucleic acid-free phosphate buffered saline. The power of the dual-potential-trap optical tweezers is 0.5~1W, and the power of the plasmon optical tweezers is 5~20 mW. The influence of the selection of different power of dual-potential-trap optical tweezers and plasmon optical tweezers on the tunneling signal detection results is investigated. The signal-to-noise ratio and sequencing accuracy during the detection process are investigated. The signal-to-noise ratio detection method is the background current comparison method, specifically: (1) When there is no target analyte, a background tunneling current is first collected and defined as I bg (t); (2) Then, when the target analyte enters the nano-gap of the tunneling probe, the real-time tunneling current is collected and defined as I. sig (t); (3) Define the signal-to-noise ratio SNR(t) = |I sig (t) − μ bg | / σ bg , where μ bg The mean background current, σ bg The background current standard deviation is used; the method for detecting sequencing accuracy is as follows: a template with a known sequence is sequenced, and the sequence output by the instrument is compared unit by unit with the actual sequence. Accuracy = (N total -N error ) / N total × 100%; the test results are shown in Table 1.

[0182] Table 1. Effect of power of dual-potential-well optical tweezers and plasmonic optical tweezers on detection results

[0183]

[0184] As shown in Table 1, different power selections of dual-potential-trap optical tweezers and plasmonic optical tweezers directly affect the signal-to-noise ratio and accuracy of scanning direct-read sequencing. This is likely because they must be combined within a suitable power range to be truly usable for scanning direct-read sequencing. If the power of the dual-potential-trap optical tweezers is too high, the microspheres at both ends of the sequence may have strong fixation forces, making it difficult for the plasmonic optical tweezers to pull the sequence into the tunneling detection region, thus hindering accurate sequencing. Conversely, if the power of the plasmonic optical tweezers is too high, the sequence may be difficult to fix at both ends of the two microspheres, resulting in overall folding or skewed positioning, which also affects detection accuracy and signal-to-noise ratio. Therefore, the power of the dual-potential-well optical tweezers needs to be controlled within the range of 0.5~1W, and the power of the plasmonic optical tweezers needs to be controlled within the range of 0.5~20 mW, so that the two types of optical tweezers can be effectively combined to achieve accurate sequencing. The preferred power is controlled within the range of 0.5~0.8W for the dual-potential-well optical tweezers and within the range of 5~15mW for the plasmonic optical tweezers. The most preferred power is 0.6W for the dual-potential-well optical tweezers and 10 mW for the plasmonic optical tweezers, at which point the SNR(t) and Accuracy are both maximized.

[0185] Example 4: Treatment of liquid pools in microfluidic chips

[0186] This embodiment uses the microfluidic chip liquid cell prepared from the quartz glass provided in Example 1, and treats the surface of the microfluidic chip liquid cell in contact with the sample solution using the following four different passivation methods: 1. Passivation using a phospholipid bilayer (1-palmitoyl-2-oleoylphosphatidylcholine, POPC) (Example 1); 2. Passivation using PEG-1000, specifically: first, inject 200µL of PBS buffer into the liquid cell through the upper channel to remove air bubbles, then inject 80µL of PEG-1000 solution (concentration of 1% (w / v)), incubate for 10 min, repeat three times to passivate the liquid cell wall; 3. Passivation using BSA, specifically: first, inject 200µL of PBS buffer into the liquid cell through the upper channel to remove air bubbles, then inject 80µL of BSA solution (concentration of 0.1% (w / v)), incubate for 10 min, repeat three times to passivate the liquid cell wall. Systems were prepared using the processed microfluidic chip liquid pool. The sample solution to be tested contained DNA sequence SEQ ID NO.1 at a concentration of 50 pM, and the solvent was nucleic acid-free phosphate buffered saline. Scanning and direct-read sequencing were performed according to the method provided in Example 2. The signal-to-noise ratio and sequencing accuracy during the detection process were examined, and the results are shown in Table 2.

[0187] Table 2. The impact of microfluidic chip liquid pool treatment on detection results

[0188]

[0189] Therefore, as shown in Table 2, although different passivation methods can all solve the problem of sequence adsorption, different passivation methods affect the transmittance of quartz glass, thus affecting the performance of double-trap optical tweezers and plasmon optical tweezers. This may affect the stability and accuracy of optical tweezers operation, and consequently, the sequencing results. Therefore, it is necessary to select a suitable passivation method to improve sequencing accuracy and signal-to-noise ratio. The optimal passivation method is to use the first type of phospholipid bilayer (1-palmitoyl-2-oleoylphosphatidylcholine, POPC) for passivation.

[0190] Example 5: The effect of different microspheres on scanning direct-read sequencing

[0191] This embodiment uses the method provided in Example 2 for scanning direct-read sequencing. The microspheres connecting the two ends of the sequence to be tested are polystyrene microspheres (Example 2), streptavidin-modified silica microspheres (purchased from Zhongke Keyou, particle size 1.0 µm), and streptavidin-modified barium titanate microspheres (purchased from Shanghai Qifa, model BTGMS-4.15, particle size 1.0 µm). The sample solution to be tested is a solution containing the DNA sequence SEQ ID NO.1 at a concentration of 50 pM, and the solvent is nucleic acid-free phosphate buffered saline. The signal-to-noise ratio and sequencing accuracy during the detection process were investigated, and the results are shown in Table 3.

[0192] Table 3. Effects of different microspheres on detection results

[0193]

[0194] As shown in Table 3, using different types of microspheres to connect the target sequence directly affects the sequencing accuracy and signal-to-noise ratio. This may be because different microspheres exhibit different laser scattering interferences, affecting the signal detection process. Furthermore, the biocompatibility and stability of different microspheres under the action of dual-potential-trap optical tweezers and plasmon optical tweezers also vary. Polystyrene microspheres are the preferred choice, as they effectively reduce laser scattering interference, possess good biocompatibility, can stably connect and fix the target sequence, are easier to control and ensure the straightening of the target sequence, and maintain stable capture of a portion of the sequence under the action of plasmon optical tweezers. This allows for smooth control of each segment of 1-3 bases in the target sequence to enter the tunneling region for accurate detection, significantly improving sequencing accuracy and signal-to-noise ratio.

[0195] While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

Claims

1. A direct-read sequencing system for biological macromolecules, characterized in that, It includes a dual-potential-well optical tweezers excitation module, a plasmonic optical tweezers excitation module, a tunneling probe and a sample stage module, with microspheres connected to both ends of the biomacromolecule; The dual-potential-well optical tweezers excitation module is used to control the position and distance between the two microspheres, thereby controlling the position and state of the biomacromolecules; The plasmon optical tweezers excitation module is used to induce biomolecules to enter the tunneling sensing region of the tunneling probe; in the optical tweezers potential well region, the power of the dual potential well optical tweezers excitation module needs to be controlled in the range of 0.5~1 W, and the power of the plasmon optical tweezers excitation module needs to be controlled in the range of 0.5~20 mW; the microspheres include any one or more of polystyrene microspheres, silica microspheres, and barium titanate microspheres; The sample stage module includes a microfluidic chip liquid pool, which needs to be passivated.

2. The system as described in claim 1, characterized in that, The dual-potential-well optical tweezers excitation module includes a laser source, a laser collimator, a half-wave plate, a polarizing beam splitter prism, a non-polarizing beam splitter prism, a spatial light modulator, a lens, and a dichroic mirror; the plasmonic optical tweezers excitation module includes a laser source, a laser collimator, a half-wave plate, a polarizing beam splitter prism, a reflector, a lens, and a dichroic mirror.

3. The system as described in claim 1, characterized in that, The microfluidic chip liquid pool is equipped with a tunneling probe channel and a sample liquid channel that are separated from each other.

4. The system as described in claim 3, characterized in that, The sample liquid channel includes a first channel, a second channel, and a third channel. The first channel, the second channel, and the third channel are located on the same horizontal plane. Through the laminar flow effect, the liquid in the three channels flows independently without interfering with each other.

5. The system as described in claim 4, characterized in that, The liquid pool of the microfluidic chip is made of quartz material and requires passivation treatment of the liquid pool surface using a phospholipid bilayer.

6. The system as described in claim 1, characterized in that, It also includes a fluorescence excitation and detection module, a position detection module, and an electrical signal acquisition module; the fluorescence excitation and detection module is used to excite and detect fluorescence signals; the position detection module is used to detect the position of the microsphere in the optical tweezers potential trap; the electrical signal acquisition module is used to identify and acquire photocurrent signals to adjust the coupling between the excitation light of the plasmon optical tweezers module and the tunneling probe nanostructure, so as to ensure the effective excitation of the local surface plasmon resonance effect in the nano-gap.

7. The system as described in claim 1, characterized in that, The biomolecules include proteins, peptides, and nucleic acids; the nucleic acids include single-stranded or double-stranded nucleic acids.

8. The system as described in claim 2, characterized in that, The biomacromolecules are connected to the microspheres via a linker, which includes any one or more of streptavidin-biotin, antibody-antigen, and thiol-coupled covalent binding.

9. A method for direct-read sequencing of biological macromolecules, characterized in that, Sequencing using the system described in any one of claims 1 to 8 includes the following steps: (1) Assemble the microfluidic chip liquid pool; (2) Phosphate buffer solution, sequencing sample solution and microsphere sample solution are introduced into the first, second and third channels respectively. The solutions in the three channels are kept flowing, generating a laminar flow effect. (3) The two optical tweezer potential traps generated by the dual potential trap optical tweezer excitation module move sequentially from the third channel, the second channel, and finally to the first channel, so that the two ends of the sequence to be tested are connected to the microspheres and enter the first channel under the control of the optical tweezer potential traps; (4) Control the two microspheres connected to the sequence to be tested to enter the tunneling probe channel, and control part of the sequence to be tested to enter the tunneling sensing area through the plasmonic optical tweezers excitation module; (5) By controlling the movement of the two optical tweezers potential traps, the movement of the two microspheres can be controlled, thereby achieving sub-nanometer precision control of the relative position of the tunneling probe to the sequence fragment to be tested, and realizing scanning direct reading sequencing.

Images