Method for increasing yield of L-tryptophan of corynebacterium glutamicum

Abstract

The invention belongs to the technical field of biochemical engineering, and provides a method for increasing the yield of L-tryptophan of corynebacterium glutamicum. The invention provides a new gene target gluA closely associated with synthesis of L-tryptophan in corynebacterium glutamicum, the yield of L-tryptophan of recombinant corynebacterium glutamicum is remarkably increased by knocking out the gene, and meanwhile, the invention also provides a method for increasing the yield of L-tryptophan of recombinant corynebacterium glutamicum by coupling gluA knockout, glnK knockout and sugR overexpression. By regulating and controlling the expression level of the gluA gene in the recombinant corynebacterium glutamicum for high yield of the L-tryptophan and coupling with expression regulation and control of glnK and sugR, the concentration of the L-tryptophan in fermentation liquor is remarkably improved, efficient synthesis of the L-tryptophan in the recombinant corynebacterium glutamicum is achieved through an optimized fermentation scheme, and the L-tryptophan has very wide application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemical engineering, and in particular relates to a method for increasing the L-tryptophan production of Corynebacterium glutamicum. Background Art

[0002] L-tryptophan is an essential amino acid for humans and animals. It not only participates in protein synthesis but also regulates various physiological functions. L-tryptophan is widely used in industries such as feed, medicine, and health supplements. Its compound annual growth rate ranks first among all amino acids, demonstrating its broad market prospects.

[0003] Currently, L-tryptophan is primarily produced through microbial fermentation, using metabolically engineered L-tryptophan-producing strains to directly ferment L-tryptophan using inexpensive raw materials such as glucose and sugarcane molasses as carbon sources. This method offers advantages such as high production efficiency, low cost, and mild reaction conditions. However, the L-tryptophan yields of commonly used recombinant Escherichia coli and Corynebacterium glutamicum remain far below the theoretical maximum. One of the main reasons for this is that our understanding of the L-tryptophan biosynthesis, regulation, and transport mechanisms of these microorganisms is still insufficient, and there are still unknown key gene targets in the chassis microorganisms that need to be modified. Therefore, the discovery and expression optimization of unknown L-tryptophan high-yield gene targets is crucial. Summary of the Invention

[0004] The present invention aims to provide a method for increasing the L-tryptophan production of Corynebacterium glutamicum, in particular to provide a novel L-tryptophan high-yielding gene target in Corynebacterium glutamicum, and to increase the L-tryptophan production of the recombinant microorganism by regulating its expression.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides an engineered bacterium I of Corynebacterium glutamicum, which is a knockout gluA The gene of Corynebacterium glutamicum ( Corynebacterium glutamicum ).

[0006] The present invention also provides an engineered bacterium II of Corynebacterium glutamicum, which is a knockout gluA and glnK Genes that are overexpressed sugR genes of Corynebacterium glutamicum.

[0007] In the present invention, the Corynebacterium glutamicum-derived gluA The gene is a gene encoding the following protein (a1) or (b1): (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or (b1) A protein derived from (a1) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 1.

[0008] Corynebacterium glutamicum gluA The gene is the same as that described in claim 1; Corynebacterium glutamicum glnK The gene is a gene encoding the following protein (a2) or (b2): (a2) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; or (b2) A protein derived from (a2) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 2.

[0009] Corynebacterium glutamicum sugR The gene is a gene encoding the following protein (a3) ​​or (b3): (a3) a protein consisting of the amino acid sequence shown in SEQ ID NO: 3; or (b3) A protein derived from (a3) ​​with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 3.

[0010] The starting strain of the engineered bacteria is Corynebacterium glutamicum having the ability to produce tryptophan, for example, recombinant Corynebacterium glutamicum TR26 (Synthetic and Systems Biotechnology 10 (2025) 511–522).

[0011] In the second aspect, the present invention provides a method for constructing the engineered bacteria I, wherein homologous recombination or gene editing technology is used to knock out the gluA Gene.

[0012] The present invention also provides a method for constructing the engineered bacteria II, wherein homologous recombination or gene editing technology is used to knock out the gluA and glnK Gene; Overexpression sugR The gene method can be selected from the following 1) to 4), or any combination thereof: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the chromosome; 3) Enhanced by operably linking a strong promoter to the gene; 4) Enhancement by using genes or alleles encoding high activity of the corresponding enzymes or proteins.

[0013] Preferably, the gene editing technology can be selected from CRISPR, TALEN and ZFN, etc.

[0014] In a third aspect, the present invention provides the use of the engineered bacteria in the fermentation production of L-tryptophan.

[0015] In a fourth aspect, the present invention provides a method for increasing L-tryptophan production in Corynebacterium glutamicum, comprising: a) culturing the engineered bacteria I or II to obtain a microbial culture; b) collecting the produced L-tryptophan from the culture obtained in step a).

[0016] In a fifth aspect, the present invention provides gluA Application of gene deletion in improving L-tryptophan production in Corynebacterium glutamicum.

[0017] In a sixth aspect, the present invention provides gluA and glnK Gene deletion and sugR Application of gene enhancement in improving L-tryptophan production in Corynebacterium glutamicum.

[0018] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention provides a new gene target closely related to L-tryptophan synthesis in Corynebacterium glutamicum gluA The L-tryptophan production of recombinant Corynebacterium glutamicum was significantly improved by knocking out this gene, and a coupling gluA Knockout and glnK Knockout and sugR A method for increasing the L-tryptophan production of recombinant Corynebacterium glutamicum by overexpression. gluA Gene expression levels and glnK 、 sugR The coupling of expression regulation significantly increased the L-tryptophan concentration in the fermentation broth, and achieved efficient synthesis of L-tryptophan in recombinant Corynebacterium glutamicum through optimized fermentation scheme, which has very broad application prospects. DETAILED DESCRIPTION

[0019] The present invention mainly provides a novel L-tryptophan high-yield associated gene of Corynebacterium glutamicum and develops a method for increasing the L-tryptophan fermentation yield of recombinant Corynebacterium glutamicum by regulating its expression level.

[0020] The present invention realizes the efficient fermentation production of L-tryptophan by recombinant Corynebacterium glutamicum by the following method, which mainly includes: (1) knocking out gluA ; or, knockout gluA , glnK , while overexpressing sugR ; (2) The recombinant Corynebacterium glutamicum was fermented in shake flasks to detect its L-tryptophan production.

[0021] In one embodiment of the present invention, by inhibiting gluA expression to increase L-tryptophan production.

[0022] In another embodiment of the present invention, by inhibiting gluA Simultaneous inhibition of expression glnK and overexpression sugR To increase L-tryptophan production 。

[0023] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0024] The recombinant strain TR26 of Corynebacterium glutamicum used in the following examples was provided by Associate Professor Chen Zhen of the Department of Chemical Engineering, Tsinghua University. Plasmids pK18mobsacB and pEC-K18mob2 were purchased from Addgene.

[0025] Example 1 Expression Optimization of a Novel L-Tryptophan High-Yield Target In this example, gene knockout gluA (The amino acid sequence and nucleic acid sequence are shown in SEQ ID NO: 1 and SEQ ID NO: 4, respectively) significantly improve the L-tryptophan production of recombinant Corynebacterium glutamicum. gluA The knockout method is as follows: The suicide plasmid pK18mobsacB (Chen et al., Metab Eng, 39, 151-158, 2017) was used to genetically modify the L-tryptophan high-producing recombinant strain TR26 (Synthetic and Systems Biotechnology 10 (2025) 511–522). gluA First, the plasmid pK18-ΔgluA was electroporated into TR26 competent cells, and primary recombinant bacteria were obtained on LBHIS (LBHIS-kan25) plates containing 25 mg / L kanamycin. Subsequently, the correct primary recombinant bacteria verified by PCR were cultured in 5 mL of antibiotic-free liquid culture medium to allow secondary recombination. Secondary recombinant bacteria that failed to grow on LB-kan25 (LB culture medium containing 25 mg / L kanamycin) plates were selected for colony PCR verification to identify the target gene knockout strain. The resulting strain was named TR26-ΔgluA.

[0026] The plasmid pK18-ΔgluA was constructed as follows: plasmid pK18mobsacB (Synthetic and Systems Biotechnology 10 (2025) 511–522) was digested with EcoRI and XbaI to obtain a linearized plasmid backbone. A 1089 bp PCR fragment was amplified using primers gA-1.FOR (aggaaacagctatgacatgattacgggatcaacaaagttcacgccgtaag) and gA-1.REV (gcgcagccaaaaaaagggtagcttaaagcagtttgtgc) and TR26 strain as a template to generate the upstream homology arm. Using primers gA-2.FOR (taagctaccctttttttggctgcgcctctatcttcag) and gA-2.REV (aagcttgcatgcctgcaggtcgacttcacactagcttgcgtcgagg) and TR26 as template, a 1047-bp PCR fragment was generated, which served as the downstream homology arm. The three fragments were assembled using Gibson assembly to generate plasmid pK18-ΔgluA.

[0027] The following steps are further performed to efficiently produce L-tryptophan by fermentation using recombinant Corynebacterium glutamicum: (1) Activation of strains: Streak the Corynebacterium glutamicum strain stored at -70°C onto an LB plate and place it in a 30°C incubator for activation culture for 14-16 hours.

[0028] (2) Seed culture: Use a 250 mL baffled shake flask with a 20 mL liquid volume. Pick a loop of newly activated bacteria with an inoculating loop and inoculate it into the shake flask. Incubate at 30°C and 200 rpm for 14-16 h. The composition of the seed culture medium is: sucrose 50 g / L, corn steep liquor 10 g / L, ammonium sulfate 8.3 g / L, potassium dihydrogen phosphate 2 g / L, urea 1 g / L, magnesium sulfate heptahydrate 0.83 g / L, ferrous sulfate heptahydrate 10 mg / L, zinc sulfate heptahydrate 10 mg / L, copper sulfate pentahydrate 1 mg / L, β-alanine 10 mg / L, thiamine hydrochloride 1.5 mg / L, niacin 5 mg / L, D-biotin 0.5 mg / L, calcium carbonate 30 g / L, pH = 7.2.

[0029] (3) Fermentation culture: Use a 500 mL baffled shake flask with a liquid volume of 30 mL. Inoculate the cultured seed liquid into the fermentation medium at an inoculum volume of 5% (v / v). Cultivate at 30 °C and 200 rpm for 72 h. The composition of the fermentation medium is as follows: glucose 100 g / L, corn steep liquor 10 g / L, ammonium sulfate 45 g / L, potassium dihydrogen phosphate 0.5 g / L, urea 4.5 g / L, magnesium sulfate heptahydrate 0.5 g / L, ferrous sulfate heptahydrate 10 mg / L, manganese sulfate tetrahydrate 1 mg / L, β-alanine 10 mg / L, thiamine hydrochloride 5 mg / L, nicotinic acid 5 mg / L, D-biotin 0.3 mg / L, calcium carbonate 30 g / L, pH = 7.2.

[0030] (4) Product Analysis: The fermentation sample was centrifuged at 12,000 rpm for 5 min. The supernatant was diluted with high-purity water to a concentration of 0.1-1.0 g / L, and filtered through a 0.22 μm filter. L-tryptophan concentration was determined using the 2,4-dinitrofluorobenzene derivatization method and detected using a diamonsil AAA column. The actual concentration of each component was calculated based on the standard curve.

[0031] The shake flask fermentation results showed that the L-tryptophan production of TR26 was 15.3 g / L. gluA The L-tryptophan production of the knockout strain TR26-ΔgluA increased by 7.2% compared with that of strain TR26, reaching 16.4 g / L, indicating that the gene in the recombinant Corynebacterium glutamicum gluA Knockout of β-catenin is beneficial to increase L-tryptophan production.

[0032] Example 2 Combination Regulation of Novel L-Tryptophan High-Production Targets The present invention further discovered that the new target for high tryptophan production in Example 1 gluA Knockout and glnK (The amino acid sequence and nucleic acid sequence are shown in SEQ ID NO: 2 and SEQ ID NO: 5, respectively) knockout and sugR (The amino acid sequence and nucleic acid sequence are shown in SEQ ID NO: 3 and SEQ ID NO: 6, respectively.) Overexpression coupling can further increase L-tryptophan production.

[0033] The recombinant strain TR26-ΔgluA constructed in Example 1 was genetically modified using plasmid pK18-ΔglnK. glnK The strain TR26-ΔgluA-ΔglnK was obtained by knocking out the gene, and the gene knockout method was the same as in Example 1.

[0034] Further overexpression sugRThe plasmid pEC-K18-lac-sugR was electroporated into the strain TR26-ΔgluA-ΔglnK to obtain the recombinant strain named TR26-ΔgluA-ΔglnK-sugR.

[0035] The specific plasmid construction method is as follows: Construction of plasmid pK18-ΔglnK: Plasmid pK18mobsacB was digested with EcoRI and XbaI to obtain a linearized plasmid backbone. A 1067-bp PCR fragment was amplified using primers gK-1.FOR (aggaaacagctatgacatgattacgccgttatctccactgcactgatctc) and gK-1.REV (gattattcataagtttgatcgtctccttcaaaaagacattcgg) and TR26 strain as template, serving as the upstream homology arm. Using primers gK-2.FOR (gagacgatcaaacttatgaataatccagcccagctgc) and gK-2.REV (aagcttgcatgcctgcaggtcgactctggagagaatccgaaagaagtcccc) and TR26 as template, a 1065-bp PCR fragment was generated, which served as the downstream homology arm. The three fragments were assembled using Gibson assembly to generate plasmid pK18-ΔglnK.

[0036] Construction of plasmid pEC-K18-lac-sugR: Plasmid pEC-K18mob2 (Tauch et al., CurrMicrobiol, 45(5), 362-367, 2002) was digested with EcoRI and XbaI endonucleases to obtain a linearized plasmid backbone. 830 bp of the plasmid was amplified using primers sugR.FOR (accatgattacgaaaggaggttgtcatgtacgcagaggagcgcc) and sugR.REV (ttctctcatccgccaaaacagccactcattctgcaatcacaacttctacatcgc) and TR26 as a template. sugRGene fragment. Using primers T.FOR (tgtagaagttgtgattgcagaatgagtggctgttttggcggatgag) and T.REV (aagcttgcatgcctgcaggtcgactagagtttgtagaaacgcaaaaaggcc) and plasmid pXMJ19 as a template, a 478-bp terminator rrnB fragment was amplified. The three fragments were assembled using Gibson assembly to generate the plasmid pEC-K18-lac-sugR.

[0037] The same method as in Example 1 was used to perform shake flask fermentation on the novel L-tryptophan high-yield combination control strain TR26-ΔgluA-ΔglnK-sugR, and its L-tryptophan production was detected. The fermentation results showed that the L-tryptophan production of strain TR26-ΔgluA-ΔglnK-sugR increased by 17.6% compared with strain TR26-ΔgluA (16.4 g / L) to 19.3 g / L, indicating that the L-tryptophan production of strain TR26-ΔgluA-ΔglnK-sugR increased by 17.6% compared with strain TR26-ΔgluA (16.4 g / L), reaching 19.3 g / L. glnK Knockout and sugR Overexpression, new targets gluA The L-tryptophan production of the knockout strain was further significantly improved.

[0038] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. An engineered bacterium of Corynebacterium glutamicum, characterized in that Knockout gluA The gene of Corynebacterium glutamicum ( Corynebacterium glutamicum ); Corynebacterium glutamicum gluA The gene is a gene encoding the following protein (a1) or (b1): (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or (b1) A protein derived from (a1) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:

1.

2. An engineered bacterium of Corynebacterium glutamicum, characterized in that Knockout gluA and glnK Genes that are overexpressed sugR gene of Corynebacterium glutamicum; Corynebacterium glutamicum gluA The gene is the same as that described in claim 1; Corynebacterium glutamicum glnK The gene is a gene encoding the following protein (a2) or (b2): (a2) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; or (b2) a protein derived from (a2) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 2; Corynebacterium glutamicum sugR The gene is a gene encoding the following protein (a3) ​​or (b3): (a3) a protein consisting of the amino acid sequence shown in SEQ ID NO: 3; or (b3) A protein derived from (a3) ​​with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:

3.

3. The engineered bacteria according to claim 1 or 2, characterized in that The starting strain of the engineering bacteria is Corynebacterium glutamicum which has the ability to produce tryptophan.

4. The method for constructing the engineered bacteria according to claim 1 or 3, characterized in that: Knockout from Corynebacterium glutamicum using homologous recombination or gene editing technology gluA Gene.

5. The method for constructing an engineered bacterium according to claim 2 or 3, characterized in that: Knockout from Corynebacterium glutamicum using homologous recombination or gene editing technology gluA and glnK Gene; Overexpression sugR The gene method is selected from the following 1) to 4), or any combination thereof: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the chromosome; 3) Enhanced by operably linking a strong promoter to the gene; 4) Enhancement by using genes or alleles encoding high activity of the corresponding enzymes or proteins.

6. The method according to claim 4 or 5, characterized in that The gene editing technology is selected from CRISPR, TALEN and ZFN.

7. Use of the engineered bacteria according to any one of claims 1 to 3 in the fermentative production of L-tryptophan.

8. A method for increasing the L-tryptophan production of Corynebacterium glutamicum, characterized in that: include: a) culturing the engineered bacteria according to any one of claims 1 to 3 to obtain a culture of the microorganism; b) collecting the produced L-tryptophan from the culture obtained in step a).

9. gluA Application of gene deletion in increasing L-tryptophan production in Corynebacterium glutamicum; Corynebacterium glutamicum gluA The gene is the same as that described in claim 1.

10. gluA and glnK Gene deletion and sugR Application of gene enhancement in increasing L-tryptophan production in Corynebacterium glutamicum; Corynebacterium glutamicum gluA 、 glnK and sugR The gene is the same as that described in claim 2.