A marker, detection reagent, detection method and kit related to the content of glycerol and its related metabolites

Abstract

The application provides a marker related to the content of glycerol and related metabolites, a detection reagent, a detection method and a kit, relates to the technical field of biotechnology, and the marker has an insertion type allele or a deletion type allele on a 3'UTR region of a phospholipase gene Zmhpc1, wherein the nucleotide sequence of the insertion type allele is shown in SEQ ID NO. 1. In the technical scheme of the application, by using an insertion / deletion (InDel) site as a marker, the genotype (insertion type or deletion type) of the InDel site in the sample to be detected is detected, a molecular marker significantly related to the content of glycerol and related metabolites can be developed, early screening of target trait materials is realized, the molecular marker has application potential in sweet corn molecular breeding, and is helpful to improving the nutritional value or stress resistance performance through molecular marker assisted selection (MAS) means.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a marker, detection reagent, detection method, and kit related to the content of glycerol and its related metabolites. Background Technology

[0002] Plants often encounter various abiotic stresses during their growth and development, such as drought, salinity, and waterlogging. These adversities disrupt cellular homeostasis, leading to osmotic imbalances, reactive oxygen species (ROS) bursts, and metabolic disorders. To cope with these stresses, plants have evolved complex adaptive mechanisms, among which the accumulation of compatible solutes is an important physiological strategy. Glycerol, as a polyhydroxy alcohol compatible solute, has received increasing attention in recent years for its role in maize stress resistance. Studies have shown that glycerol not only reduces the attack of free radicals on the cell membrane system through physical isolation but also plays a crucial role in scavenging ROS.

[0003] Recent studies have also found that glycerol may act as a signaling molecule involved in the regulation of plant stress responses. In maize's drought and flood resistance responses, glycerol can activate the SnRK2 protein kinase cascade, promoting the activation of the ABA signaling pathway and thus regulating stomatal movement and the expression of stress-related genes. Proteomics analysis also shows that exogenous glycerol treatment can induce phosphorylation of the 14-3-3 protein in maize leaves, thereby regulating plasma membrane H... + -ATPase activity enhances the plant's ability to maintain ion homeostasis under stress conditions. Furthermore, epigenetic studies have found that under drought stress, the levels of histone modifications in the promoter regions of maize glycerol synthesis-related genes change significantly, showing an increase in activating modifications such as H3K4me3, thereby enhancing gene transcriptional activity.

[0004] Although existing studies have revealed the multiple functions of glycerol in maize stress resistance, its application in maize genetic improvement still faces many challenges. Currently, some quantitative trait loci (QTLs) associated with glycerol content have been identified using QTL mapping technology; however, due to the complex population structure and limited marker density used, molecular markers highly correlated with glycerol accumulation and possessing stable genetic effects have not yet been obtained. Therefore, genetic analysis of glycerol content in maize leaves remains relatively weak, limiting its application in molecular breeding. Summary of the Invention

[0005] The main objective of this invention is to provide a marker, reagent, method and kit for identifying glycerol content, with the aim of screening plant varieties with strong stress resistance.

[0006] To achieve the above objectives, the present invention proposes a marker related to the content of glycerol and its related metabolites, wherein the marker has an insertional or deletional allele in the 3'UTR region of the phospholipase gene Zmhpc1, wherein the nucleotide sequence of the insertional allele is shown in SEQ ID NO.1.

[0007] In one embodiment, the marker is located on the 3'UTR region of the phospholipase gene Zmhpc1, the nucleotide sequence of the coding region of the phospholipase gene Zmhpc1 being shown in SEQ ID NO.2.

[0008] The present invention also proposes the application of the marker described above in the preparation of reagents for screening the content of glycerol and its related metabolites.

[0009] The present invention provides a detection reagent comprising an amplification primer pair for amplifying a marker as described above.

[0010] In one embodiment, the amplification primer pair includes an upstream primer and a downstream primer, the upstream primer being shown in SEQ ID NO.3 and the downstream primer being shown in SEQ ID NO.4.

[0011] This invention also provides a method for identifying glycerol content, the detection steps of which include:

[0012] S10. Using the DNA of the sample to be tested as a template, amplify the sample using the detection reagents described above to obtain the amplification product.

[0013] S20. Sequencing the amplified product and comparing the sequenced sequence with the sequence of the marker as described above;

[0014] S30. Determine the genotype of the sample to be tested based on the comparison results, so as to screen out the sample to be tested that has the potential to be related to the content of glycerol and its related metabolites.

[0015] The present invention also provides a kit for screening the glycerol content in sweet corn leaf tissue, comprising the detection reagents described above.

[0016] In the technical solution of this invention, a marker capable of identifying glycerol content is screened out. This marker has an insertional or deletion allele located in the 3'UTR region of the phospholipase gene Zmhpc1, wherein the nucleotide sequence of the insertional allele is shown in SEQ ID NO.1. By using an insertion / deletion variant (InDel) site as a marker, which is a genetic site related to the content of glycerol and its related metabolites, a molecular marker for screening sweet corn related to the content of glycerol and its related metabolites is finally developed, thereby achieving early screening of target trait materials. This molecular marker has application potential in the molecular breeding of sweet corn, and helps to improve its nutritional value or stress resistance performance through molecular marker-assisted selection (MAS), greatly promoting resistance enhancement breeding related to the content of glycerol and its related metabolites. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 A schematic diagram illustrating the correlation analysis of the content of glycerol and glycerol-related metabolites and their content changes under waterlogging stress.

[0019] Figure 2 This is a schematic diagram showing the genome-wide association analysis results of glycerol and glycerol-related pathway metabolites in the control group.

[0020] Figure 3 A schematic diagram of the gene Zmhpc1 as a functional candidate gene for controlling glycerol content;

[0021] Figure 4 A schematic diagram showing the statistical analysis results of the differences in glycerol and related metabolic contents at the insertion / deletion site InDel_16;

[0022] Figure 5 This is a schematic diagram illustrating the identification of alleles at the InDel_16 locus using Sanger sequencing.

[0023] The objectives, features, and advantages of this invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them.

[0025] It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products. Furthermore, the meaning of "and / or" throughout the text includes three parallel solutions; for example, "A and / or B" includes solution A, solution B, or a solution that simultaneously satisfies A and B. In addition, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or impossible to implement, such a combination should be considered non-existent and not within the scope of protection claimed by this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention.

[0026] Recent studies have found that glycerol can participate in stress responses as a signaling molecule. In maize's drought and flood resistance responses, glycerol promotes the ABA signaling pathway by activating the SnRK2 protein kinase cascade. Proteomics analysis shows that exogenous glycerol treatment can induce phosphorylation of the 14-3-3 protein in maize leaves, regulating H... + -ATPase activity. Epigenetic evidence suggests that drought stress increases histone modification levels in the promoter region of maize glycerol synthesis genes, enhancing transcriptional activity. Glycerol metabolism is cross-regulated with other stress resistance systems in maize; therefore, identifying glycerol content in maize leaves can be helpful in screening for varieties with strong stress resistance.

[0027] In view of this, in order to achieve the above objectives, the present invention proposes a marker related to the content of glycerol and its related metabolites, wherein the marker has an insertional allele or a deletion allele located in the 3'UTR region of the phospholipase gene Zmhpc1, wherein the nucleotide sequence of the insertional allele is shown in SEQ ID NO.1.

[0028] In the technical solution of this invention, a marker related to the content of glycerol and its related metabolites is screened out. The marker has two expression forms: insertion allele and deletion allele. The nucleotide sequence of the insertion allele is shown in SEQ ID NO.1. By using the insertion / deletion variant (InDel) site as the marker, which is a genetic site related to the content of glycerol and its related metabolites, a molecular marker for screening sweet corn related to the content of glycerol and its related metabolites is finally developed. This enables early screening of target trait materials. This molecular marker has application potential in the molecular breeding of sweet corn and helps to improve its nutritional value or stress resistance performance through molecular marker-assisted selection (MAS), greatly promoting resistance enhancement breeding related to the content of glycerol and its related metabolites.

[0029] It should be noted that the marker is named InDel_16; the InDel_16 locus has two allele forms:

[0030] The insertional allele (+) has the nucleotide sequence shown in SEQ ID NO.1, specifically ATGTGCGTCTACAAAC;

[0031] Deletion allele (-), this sequence is missing;

[0032] The missing allele (-) is significantly associated with the content of glycerol and its related metabolites, and can be used for molecular marker-assisted screening of sweet corn materials with content of glycerol and its related metabolites.

[0033] The marker InDel_16 is an insertion / deletion (InDel) variant site, characterized by the possible presence or absence of a 16-base-pair sequence at a specific location: ATGTGCGTCTACAAAC. This specific location is in the 3'UTR region of the gene Zmhpc1, meaning that the insertion / deletion (InDel) variant occurs in the 3' untranslated region of the Zmhpc1 gene. The 3' UTR is the RNA sequence between the stop codon and the transcription end, which is not translated into protein but plays an important role in the stability, localization, and translation efficiency of mRNA.

[0034] Specifically, the nucleotide sequence of the marker is as follows: ATGTGCGTCTACAAAC.

[0035] In some embodiments of the present invention, the marker is located on the 3'UTR region of the phospholipase gene Zmhpc1, and the nucleotide sequence of the coding region of the phospholipase gene Zmhpc1 is shown in SEQ ID NO.2, specifically as follows: SEQ ID NO.2:

[0036]

[0037] It should be noted that the gene ID of the phospholipase gene Zmhpc1 is Zm00001d039542, located in the region 7735469 to 7737566 of chromosome 3 of the maize genome; the reference genome version is B73 V4. The phospholipase gene Zmhpc1 enhances maize's adaptability to cold environments by regulating the content of the metabolite glycerol. Focusing on a key variant site in this gene—a 16bp InDel sequence insertion / deletion—as the source of glycerol content regulation, this study identified regulatory genes and key variant sites controlling glycerol content in sweet maize leaf tissues, and subsequently developed molecular markers.

[0038] The present invention also proposes the application of the markers described above in the preparation of reagents for screening related to the content of glycerol and its related metabolites. Specifically, the InDel_16 variant site, which can be significantly associated with the glycerol content in sweet corn leaf tissue, is used in the preparation of reagents for screening related to the content of glycerol and its related metabolites. This reagent can be applied to screening breeding.

[0039] This invention provides a detection reagent comprising an amplification primer pair for amplifying a marker as described above. In other words, the amplification primer pair for amplifying the marker can be prepared into a detection reagent for detecting whether a sample to be tested contains the marker sequence, thereby enabling screening and breeding.

[0040] Furthermore, the amplification primer pair includes an upstream primer and a downstream primer, wherein the upstream primer is shown in SEQ ID NO.3 and the downstream primer is shown in SEQ ID NO.4.

[0041] Specifically, molecular markers based on PCR and Sanger sequencing were developed for the InDel_16 locus (ATGTGCGTCTACAAAC / -) associated with the levels of glycerol and related metabolites, for screening favorable allele loci for high glycerol and related metabolite levels. Primers for this InDel locus were designed using the NCBI-BLAST program. Two primers were designed for this InDel locus: one forward primer and one reverse primer.

[0042] Primer pair information for InDel_16 markers:

[0043] SEQ ID NO.3: CCGGTGGGTGCTGCC;

[0044] SEQ ID NO.4: CGGCAACAGAGTAACCGACT.

[0045] This invention provides a method for identifying glycerol content, the detection steps of which include:

[0046] S10. Using the DNA of the sample to be tested as a template, amplify the sample using the detection reagents described above to obtain the amplification product.

[0047] S20. Sequencing the amplified product and comparing the sequenced sequence with the sequence of the marker as described above;

[0048] S30. Determine the genotype of the sample to be tested based on the comparison results, so as to screen out the sample to be tested that has the potential to be related to the content of glycerol and its related metabolites.

[0049] In this invention, the sample to be tested is amplified using amplification primers to obtain amplification products. These products are then sequenced. If the sequencing results show a sequence containing the marker (i.e., containing sequence SEQ ID NO.1), it indicates that the sample carries an insertional allele (+) at the InDel_16 locus. This is typically associated with the content of glycerol and its related metabolites, and has a high probability of being related to glycerol and its related metabolites. If the sequencing results lack this sequence (i.e., do not contain sequence SEQ ID NO.1), it indicates that the sample carries a deletional allele (-), which may be associated with lower glycerol content. This method can be applied to selection and breeding programs. It allows for rapid genotyping, is low-cost, easy to operate, and suitable for high-throughput testing. This locus will greatly promote the breeding of high-glycerol-content sweet corn with enhanced biological resistance.

[0050] The present invention also provides a kit comprising the detection reagents described above, for screening sweet corn leaves with content related to glycerol and its related metabolites. Since the detection reagents have the amplification primer pairs described above for amplifying the markers, they also have the beneficial effects of the markers described above, which will not be elaborated further here.

[0051] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0052] Example 1: Genome analysis and marker identification of sweet maize

[0053] 1. Sweet corn planting materials

[0054] The sweet corn population consisted of 200 different super sweet corn inbred lines, including temperate and tropical / subtropical germplasm, collected from China, the United States, Thailand, and other regions. In 2023, the 200 sweet corn lines were cultivated in pots at the Guangdong Academy of Agricultural Sciences' intelligent greenhouse (E113°224, N23°093). A randomized block design was used, with five replicates for each inbred line. Leaves from both the experimental and control groups were sampled 30 days after emergence to determine the content of glycerol and its metabolic pathways in the leaves. A waterlogging tolerance experiment was conducted on the 200 lines, with parallel control experiments also included. Metabolomics differences were then analyzed from seedling leaves of the experimental and control groups. The experimental group underwent 48 hours of waterlogging treatment before sampling, while the control group grew under normal conditions. Leave samples were immediately frozen in liquid nitrogen after sampling and then transferred to a -80°C freezer for subsequent determination of glycerol and related substances in the leaf tissue.

[0055] 2. Determination of glycerol content in leaf tissues

[0056] 2.1 Extraction of glycerol metabolites:

[0057] Prior to glycerol metabolite extraction, five biological replicates of sweet maize leaves (30 days post-emergence) from each line in both the experimental and control groups were harvested and stored at -80°C. The pre-chilled sweet maize leaves were ground for 30 seconds at 30 Hz using a grinder (MM400; Retsch). Sugar metabolite extraction was performed according to the method described in a previous study (Wang H, Yan S, Xin H, et al. A subsidiary cell-localized glucose transporter promotes stomatal conductance and photosynthesis. The Plant Cell, 2019, 31: 1328-1343.). The extracts were centrifuged at 14,000 rpm for 10 minutes at 4°C. Two fixed volumes of 200 μL of the polar phase (lower phase) were transferred to pre-labeled 1.5 mL microcentrifuge tubes. The samples were then dried using a vacuum concentrator (SpeedVac; ThermoFisher) without heating. Two dry 200 μL polar aliquots of each sample were analyzed by GC-MS to determine the content of glycerol and related metabolites.

[0058] 2.2 Determination of glycerol metabolites (gas chromatography-mass spectrometry):

[0059] For glycerol metabolite analysis, as previously described (Yan et al. Comparative metabolomic analysis of seed metabolites associated with seed storability in rice (Oryzasativa L.) during natural aging. Plant Physiology and Biochemistry, 2018 127, 590-598.), the dried treatment was derivatized using N-methyl-N-(trimethylsilyl)trifluoroacetamide and further analyzed using GC-MS (7890A-5975C, Agilent Technologies, USA). One µL of liquid mixture from each sample was injected into the GC-MS in split mode (50:1) at 270 °C with helium carrier gas (>99.999% purity) at a flow rate of 1 mL / min, and passed through a DB Separation-35MS UI (30 m × 0.25 mm, 0.25 µm) capillary column. The temperature was isothermaled at 90℃ for 4 minutes, then increased to 205℃ at a rate of 8℃ per minute, held constant for 2 minutes, and finally increased to 310℃ at a rate of 15℃ per minute and held constant for 5 minutes. The transfer line temperature was set to 300℃, and the ion source temperature was set to 230℃. The mass range of the analysis was 85 to 700 m / z. Glycerol, glycerol glycosides, glycerol-3-phosphate, melibiose, and tetradecanoic acid were identified by characteristic ion analysis using mass spectrometry. The relative contents of these five substances were obtained by analyzing the peak areas of the chromatograms.

[0060] 3. SNP map of sweet corn population

[0061] The initial identification of SNP map data has been completed (Li et al. Unlocking the genetic basis of vitamin E content in sweet corn kernels: Expanding breeding targets through genome-wide association studies. Plant Science, 2024, 348, 112233). In short, through the collection of leaf tissue from seedlings of this sweet corn population, genomic DNA extraction, library construction, and other steps, whole-genome resequencing was performed on the Ilumina Hiseq 2500 platform. The average sequencing depth was 11X. Through filtering, alignment, and variant identification of the raw data, approximately 9.86 million high-quality SNP maps were identified across the entire genome.

[0062] 4. Correlation analysis of glycerol and its related metabolites

[0063] Correlation analysis was conducted on the content of glycerol and its related metabolites in the leaf tissues of sweet corn seedlings. Figure 1 Figure A represents a correlation analysis of glycerol and its related metabolites (glyceroglycosides, glycerol-3-phosphate, melibiose, and tetradecanoic acid) in leaf tissues under normal conditions. Figure 1 Figure B shows the differential changes in glycerol and its related metabolites (glyceroglycosides, glycerol-3-phosphate, melibiose, and tetradecanoic acid) in leaf tissues under flood stress, such as... Figure 1 As shown in Figure A, each cell in the matrix represents the Pearson correlation coefficient between two metabolites, ranging from -1 to 1. Positive numbers (e.g., 0.68, 0.97, etc.) indicate a positive correlation, meaning an increase in one metabolite is accompanied by an increase in the other; negative numbers (not shown) indicate a negative correlation, meaning an increase in one metabolite is accompanied by a decrease in the other; values ​​close to 0 indicate no significant correlation. Through correlation analysis of glycerol content and its related metabolites in the sweet corn control group, this invention found a significant (P-value < 0.05) correlation between glycerol and glycerol-related pathway metabolites (glyceroglycosides, glycerol-3-phosphate, melibiose, and tetradecanoic acid). Figure 1 (A), such as Figure 1 As shown in Figure B, circles represent different metabolites, arrows indicate the direction of metabolic transformation, and the percentage within the circle represents the change in the content of that metabolite in the experimental group (flooding treatment) relative to the control group (normal growth). The metabolic pathway diagram illustrates the changes in the content of glycerol and its constituent substances along the metabolic pathway. Under flooding stress, the contents of glycerol, glyceroglycosides, and melibiose decreased, while the contents of glycerol-3-phosphate and tetradecanoic acid significantly increased. Figure 1 (B) This indicates that under flood stress, maize leaf tissues adapt to the current stress state by regulating the content of glycerol and its related metabolites in the tissues, providing the necessary material basis for the normal growth of maize.

[0064] 5. Genome-wide association analysis

[0065] To identify genetic loci regulating glycerol and its related metabolites and subsequently develop molecular markers for molecular screening, genome-wide association studies (GWAS) were performed on the levels of glycerol and related substances in the control group using TASSEL (3.0) software. A mixed linear model was used to control for population structure and phylogenetic relationships. To determine the genome-wide threshold for GWAS results, the number of valid SNPs was estimated using GEC (Genetic Type I error calculator) software with default parameters. We then selected P = 5.08 × 10⁻⁷ (P = 1 / n, n = number of valid markers) as the significance threshold for GWAS. To determine the independence of significant SNPs, conditional GWAS was performed using the most significant SNP within the QTL region as a covariate.

[0066] Based on the correlation analysis results of glycerol content in maize leaves, such as Figure 2 As shown, the results of a genome-wide association study (GWAS) were used to investigate the association between the levels of different metabolites and genomic variation. Specifically, it displays the distribution of significant association sites for five metabolites in the sweet maize genome. The vertical axis represents -log10 (P-value), where -log10(P-value) is the negative logarithmic transformed P-value. A smaller P-value indicates a stronger association between the locus and the metabolite level, while a larger -log10(P-value) indicates a more significant association. The horizontal axis represents the chromosome position, from chromosome 1 to chromosome 10 from left to right. Each vertical bar represents a SNP locus, and its height reflects the significance of the association between that locus and the level of a specific metabolite. Figure 2 A significant peak is observed on chromosome 2, marked Zmhpc1, indicating a strong correlation between this locus and glycerol content. This locus may be a key gene controlling glycerol synthesis or metabolism. Furthermore, the phospholipase gene Zmhpc1 in this invention is strongly associated with glycerol (P = 5.3 × 10⁻⁶). -18 The levels of ) and its related metabolites were significantly correlated ( Figure 2GWAS analysis revealed the distribution of SNPs in the sweet maize genome that are significantly associated with the content of five metabolites. In particular, a strong association was found between the Zmhpc1 site and glycerol content, providing important clues for further research on the regulatory mechanisms of glycerol metabolism. Resequencing within the Zmhpc1 gene region revealed an InDel site (Chr3: 7737280; allele: ATGTGCGTCTACAAAC / -) in the 3'UTR region of the Zmhpc1 gene, which was significantly correlated with glycerol content in maize leaves. When this sequence was present in the gene, the average relative glycerol content was approximately 0.403, while when the gene did not contain this sequence, the average relative glycerol content was approximately 0.939, a difference of 2.33-fold. Furthermore, the favorable allele of this gene had a low distribution frequency in the population (approximately 57%), indicating that this favorable allele has not been fully utilized in sweet maize breeding and has potential for use in breeding.

[0067] 6. Sequence variation analysis and identification of functional sites in gene Zmhpc1.

[0068] Using deep resequencing data from 200 sweet corn populations, Figure 3 In the diagram, A represents a scatter plot of local association analysis of glycerol content. A Manhattan plot shows SNP sites significantly associated with the target trait across the entire genome, particularly the Zmhpc1 gene on chromosome 3, which is highly associated with glycerol content. Figure 3 Figure B represents the LD block diagram between polymorphic sites within the Zmhpc1 gene region, further detailing the structure and sequence variations of the Zmhpc1 gene. It reveals specific variation sites within the gene and their distribution in the population. This invention analyzed sequence variations in and around the Zmhpc1 gene region. Four SNP sites (A24T, R272L, P437L, V461A) were identified in the Zmhpc1 coding region, which can cause variations in the encoded amino acids. These sites do not affect the expression level of the Zmhpc1 gene. A 16bp (ATGTGCGTCTACAAAC / -) insertion / deletion (InDel_16) variation in the 3'UTR region of the Zmhpc1 gene was significantly correlated with differences in glycerol content. Figure 3 That is, materials containing the 16bp sequence ATGTGCGTCTACAAAC have lower glycerol content, while materials without this sequence have significantly higher glycerol content. Figure 4 ).

[0069] Figure 4To illustrate the effects of different genotypes (insertion-type INS and deletion-type DEL) on the content of five metabolites, scatter plots and statistical analysis were used to demonstrate the significant differences between genotypes and metabolite content. Each subplot represents the distribution of the relative content of one metabolite in the two genotypes (INS and DEL). The horizontal axis represents the genotypes (INS and DEL), corresponding to insertion and deletion types, respectively. INS represents the insertion of the 16bp sequence (ATGTGCGTCTACAAAC), while DEL represents the deletion of this sequence. The vertical axis represents the relative content of the metabolite. Five scatter plots were used to show the effects of different genotypes (INS and DEL) on the content of five metabolites (glyceroglycoside, glycerol, glycerol-3-phosphate, melibiose, and tetradecanoic acid). The p-value was used to demonstrate the statistical significance of these differences. The results showed that individuals with the specific sequence in the INS genotype had significantly higher levels of all five metabolites than individuals with the sequence missing in the DEL genotype. This may reflect the regulatory role of genotype on metabolic pathways. In addition, sequence variation analysis of the sweet corn population revealed that this locus is a stable dialelic locus with stable variation, making it easy to detect and screen. Therefore, this InDel site is an ideal molecular marker identification site for screening materials related to the content of glycerol and its related metabolites.

[0070] Example 2: Application of markers for identifying glycerol content

[0071] Association and correlation analyses validated the function of gene Zmhpc1 in glycerol content in sweet maize leaf tissues. Targeting the InDel site (ATGTGCGTCTACAAAC / -) at the 3'UTR region of gene Zmhpc1, this invention developed a molecular marker based on PCR amplification and Sanger sequencing for screening sweet maize materials associated with glycerol and its related metabolites. In this embodiment, primers for the aforementioned InDel site (ATGTGCGTCTACAAAC / -) were designed and validated. The InDel primer design was performed using the PRIMER-BLAST web-based primer design tool provided by NCBI.

[0072] Primer information is as follows:

[0073] InDel primer sequence F: CCGGTGGGTGCTGCC (SEQ ID NO: 3)

[0074] InDel primer sequence R: CGGCAACAGAGTAACCGACT (SEQ ID NO: 4)

[0075] The PCR amplification reaction system is shown in Table 1 (96-well conventional PCR plate, 15 μl reaction system). The PCR amplification reaction procedure is shown in Table 2.

[0076] Table 1 PCR reaction system

[0077]

[0078] Table 2 PCR amplification reaction procedure

[0079]

[0080] After PCR amplification, electrophoresis was performed on a 2.5% agarose gel at 160V for 45 minutes using GoldView nucleic acid dye. The genotype of InDel_16 was detected by Sanger sequencing of the PCR amplification products. Allele 1 was a deletion allele, and allele 2 was an insertion allele. The Sanger sequencing primers developed in this invention are highly flexible and can rapidly detect the genotypes of small and large quantities of sweet corn materials, enabling rapid screening of sweet corn materials with high glycerol and related metabolite content. Figure 5 As shown, the genotyping results of this Sanger sequencing marker are completely consistent with the high-throughput sequencing results. It exhibits high stability and universality. Combined with GWAS and gene-based association analysis, this locus was confirmed to be significantly associated with glycerol content. Therefore, its application in improving sweet corn by incorporating glycerol and related metabolite content in sweet corn leaf tissues will play an important role in promoting resistance breeding in sweet corn.

[0081] The above description is merely a preferred embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural transformations made using the contents of the present invention under the inventive concept of the present invention, or direct / indirect applications in other related technical fields, are included within the patent protection scope of the present invention.

Claims

1. The application of a reagent for detecting the InDel_16 site on chromosome 3 of the maize genome in the preparation of reagents for screening traits related to the content of glycerol and its related metabolites in sweet maize, wherein the maize genome reference genome version is B73V4, characterized in that, The InDel_16 site is located in the 3' untranslated region of the phospholipase gene Zmhpc1, specifically at Chr3:7,737,280 on chromosome 3 of the reference genome. The InDel_16 site has two allelic forms: an insertion allelic as shown in SEQ ID NO.1, and a deletion allelic where the nucleotide sequence is missing. Maize containing the insertion sequence shown in SEQ ID NO.1 has lower levels of glycerol and its related metabolites, while maize without the insertion sequence has higher levels of glycerol and its related metabolites, including glyceroglycosides, glycerol-3-phosphate, melibiose, and tetradecanoic acid.

2. The application as described in claim 1, characterized in that, The nucleotide sequence of the coding region of the phospholipase gene Zmhpc1 is shown in SEQ ID NO.

2.

3. A method for determining the glycerol content of sweet corn, characterized in that, The detection methods include: S10. Using the DNA of the sample to be tested as a template, amplification is performed using a detection reagent for the InDel_16 site on chromosome 3 of the maize genome to obtain an amplification product. The reference genome version of the maize genome is B73V4, and the InDel_16 site is located in the 3' untranslated region of the gene Zmhpc1. The InDel_16 site is located at Chr3:7,737,280 on chromosome 3 of the reference genome. The InDel_16 site has two allele forms: an insertion allele as shown in SEQ ID NO.1 and a deletion allele in which the nucleotide sequence is deleted. S20. Sequencing the amplified product and comparing the sequenced sequence with the sequence at the InDel_16 site; S30. Determine the genotype of the sample to be tested based on the comparison results. Corn containing the insertion sequence shown in SEQ ID NO.1 has a lower glycerol content, while corn without the insertion sequence has a higher glycerol content.

Images