Liquid-phase synthesis method of RNA (Ribonucleic Acid) modified by 5 '-end cap structure

Abstract

The invention relates to a liquid-phase synthesis method of RNA (Ribonucleic Acid) modified by a 5'end cap structure, and belongs to the technical field of oligonucleotide synthesis. The liquid phase synthesis method comprises the following steps: mixing 5 '-terminal phosphoric acid modified RNA, imidazole modified 7-methyl guanosine diphosphate and a solvent for reaction to obtain 5'-terminal cap structure modified RNA. According to the designed liquid phase synthesis method of the RNA modified by the 5'end cap structure, the RNA modified by the 5 'end cap structure can be synthesized safely, simply, conveniently and cheaply, the coupling efficiency is high, the production scale is easy to expand, commercialization and industrialization can be better achieved, and the liquid phase synthesis method has important application prospects in the field of nucleic acid connection.

Description

Technical Field

[0001] The invention belongs to the technical field of oligonucleotide synthesis and relates to a liquid phase synthesis method of RNA modified with a 5' end cap structure. Background Art

[0002] The 5' cap structure found at the 5' end of messenger RNA (mRNA) consists of an N7-methylguanosine nucleotide ( 7m G) is connected to the rest of the eukaryotic mRNA through a 5'-5' triphosphate. This cap structure is called Cap-0 ( 7m GpppN1), which can be further methylated. The most common methylation occurs at the 2'-hydroxyl position of the first nucleotide, and sometimes also at the 2'-hydroxyl position of the second nucleotide, forming Cap-1 ( 7m GpppN1 m ) and Cap-2( 7m GpppN1 m N2 m This capping modification is crucial for mRNA recognition by the translation factor eIF4E and translation into protein in the ribosome. It also protects mRNA from degradation by 5' exonucleases. RNA capping is also important for other processes, such as RNA splicing and export from the nucleus, as well as protecting mRNA from recognition by the cell's innate immune system.

[0003] However, RNA synthesized by traditional in vitro transcription (IVT) methods usually lacks this cap structure. Currently, two enzymatic methods are commonly used to prepare RNA with a cap structure; the first method is co-transcriptional capping, in which a cap analog is introduced into the 5' end of the RNA transcript by co-transcription, and anti-reversed cap analogs (ARCAs) are modified cap analogs that 7m The 3'-hydroxyl group of the G nucleotide is replaced by a methoxy group, which can effectively avoid the synthesis of RNA with a reverse cap structure. The second method is post-transcriptional capping, using a viral-derived capping enzyme to add a cap structure to the 5' end of the RNA transcript. The cowpox virus capping enzyme is an effective enzyme that catalyzes the formation of the cap structure. It has RNA triphosphatase activity, guanylate transferase activity and methyltransferase activity, which can convert the 7-methylguanine cap structure ( 7m Gppp) is attached to the 5' end of the RNA. This post-transcriptional capping method uses S-adenosylmethionine (SAM) as a methyl donor during methylation, and 2'-O-methyltransferase is required to form Cap-1. The introduction of additional enzymes and substrates makes the overall production process more complicated and costly. The co-transcriptional method, which completes RNA capping in a single step, reduces the number of production steps and the number of enzymes required, but remains costly.

[0004] In summary, how to safely, simply and cheaply synthesize RNA modified with a 5' end cap structure is one of the urgent problems to be solved in the field of nucleic acid ligation. Summary of the Invention

[0005] In view of the deficiencies of the existing technology and actual needs, the present invention provides a liquid phase synthesis method for RNA modified with a 5' end cap structure, so as to achieve safe, simple and inexpensive synthesis of RNA modified with a 5' end cap structure.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a liquid phase synthesis method for RNA modified with a 5' end cap structure, comprising: mixing 5' end phosphate modified RNA, imidazole modified 7-methylguanosine diphosphate and a solvent for reaction to obtain the 5' end cap modified RNA.

[0008] The present invention develops a liquid-phase synthesis method for RNA modified with a 5' end cap structure. The method utilizes 5' end phosphate-modified RNA and imidazole-modified 7-methylguanosine diphosphate for a coupling reaction, thereby effectively modifying the RNA's 5' end cap structure. The cap structure modification type can be Cap-0, Cap-1, or Cap-2, and the efficiency of the cap structure modification coupling reaction is above 88%.

[0009] In the present invention, the 5'-end phosphate-modified RNA refers to RNA with a phosphate group connected to the 5' end.

[0010] In the present invention, imidazole-modified 7-methylguanosine diphosphate refers to a molecule in which the hydroxyl group in the second phosphate group of 7-methylguanosine diphosphate is replaced by imidazole.

[0011] It can be understood that the specific liquid-phase synthesis method designed in the present invention can modify RNA of any sequence. The specific sequence and length can be selected according to needs, such as 20 to 50 nt. RNA with different methylation modifications (methylation of the first nucleotide at the 5' end or methylation of both the first and second nucleotides) can also be used to prepare Cap-1 or Cap-2.

[0012] Preferably, the molar ratio of the 5'-terminal phosphate-modified RNA to the imidazole-modified 7-methylguanosine diphosphate is 1 nmol:(100-300) nmol, for example, 1:110, 1:120, 1:130, 1:140, 1:150, 1:160, 1:200, 1:240, 1:250, 1:260, 1:270, 1:280 or 1:290, etc.

[0013] Preferably, the solvent includes at least one of N,N-dimethylformamide, tetrahydrofuran, dimethyl sulfoxide or 1,4-dioxane.

[0014] Preferably, the 5'-terminal phosphate-modified RNA is in the form of a quaternary ammonium salt, which has good solubility in organic solvents and is therefore simple to operate and easy to expand the production scale.

[0015] Preferably, the reaction temperature is 30-80°C, for example, 35, 40, 55, 60, 65, 70 or 75°C, and the reaction time is 60-360 min, for example, 65, 70, 75, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340 or 350 min.

[0016] Preferably, the method for preparing the 5'-end phosphate-modified RNA comprises solid phase synthesis, 5'-end phosphorylation treatment and post-treatment.

[0017] In the present invention, RNA can be synthesized based on the existing solid-phase synthesis method using phosphoramidite monomers such as A, U, C, and G as raw materials (methylated monomers can be used to prepare corresponding methylated RNA), and further 5'-end phosphorylation treatment is performed to obtain 5'-end phosphate-modified RNA.

[0018] Preferably, the solid phase synthesis comprises: deprotection, coupling, oxidation and capping.

[0019] Preferably, the deprotection reagent comprises trichloroacetic acid solution.

[0020] Preferably, the coupling reagent includes ethylthiotetrazolium solution.

[0021] Preferably, the oxidizing agent comprises an iodine solution.

[0022] Preferably, the capping reagent comprises acetic anhydride solution and N-methylimidazole solution.

[0023] Preferably, the 5' end phosphorylation treatment comprises mixing the solid phase synthesized RNA with a 5' end phosphorylation reagent, wherein the 5' end phosphorylation reagent comprises 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite.

[0024] In the present invention, the RNA with 5' phosphorylated end can be synthesized first by solid phase synthesis, and then the RNA with 5' cap structure modified can be synthesized by liquid phase synthesis.

[0025] Preferably, the post-treatment includes aminolysis treatment, removal of tert-butyldimethylsilyl protecting group (TBDMS) treatment and impurity removal treatment of the carrier connected to the RNA after solid phase synthesis.

[0026] Preferably, the aminolysis treatment comprises mixing the RNA with an aminolysis reagent.

[0027] Preferably, the ammonolysis reagent is an AMA ammonolysis solution, which includes aqueous ammonia and a methylamine ethanol solution, and the volume ratio of the aqueous ammonia to the methylamine ethanol solution is 1:1.

[0028] Preferably, the aminolysis treatment specifically comprises mixing the RNA with an aminolysis agent, heating in a water bath, cooling, and centrifuging to obtain a supernatant for concentration.

[0029] Preferably, the water bath heating temperature is 65° C. and the heating time is 150 min.

[0030] Preferably, the cooling temperature is -20°C and the cooling time is 10 minutes.

[0031] Preferably, the concentration temperature is 65° C. and the concentration time is 60 minutes.

[0032] Preferably, the concentration is carried out in a vacuum environment at a speed of 13000 rpm.

[0033] Preferably, the ratio of the aminolytic agent to the solid phase carrier is 1 μL:1 nmol.

[0034] Preferably, the treatment to remove the tert-butyldimethylsilyl protecting group comprises mixing the RNA after aminolysis treatment with a deprotection reagent, and the deprotection reagent comprises triethylamine trihydrofluoride.

[0035] Preferably, the deprotection treatment specifically includes: adding dimethyl sulfoxide to the RNA after aminolysis for a first water bath heating, then adding triethylamine trihydrofluoride for a second water bath heating, adding sodium chloride solution and ethanol for ethanol precipitation, then centrifuging again to remove the supernatant, heating and draining, and then dissolving.

[0036] Preferably, the temperature of the first water bath heating is 65° C. and the time is 10 minutes.

[0037] Preferably, the temperature of the second water bath heating is 65° C. and the time is 150 min.

[0038] Preferably, the concentration of the sodium chloride solution is 5 mol / L.

[0039] Preferably, the ethanol precipitation temperature is -20°C and the time is 1 hour.

[0040] Preferably, the temperature of the heating and drying is 65° C. and the time is 10 minutes.

[0041] Preferably, the heating and drying is performed in a vacuum environment.

[0042] Preferably, the impurity removal treatment comprises salting out the RNA, wherein the salting out agent comprises a quaternary ammonium salt solution. Specifically, the treatment comprises mixing the RNA with the ammonium salt solution, centrifuging to remove the supernatant, adding anhydrous ethanol, and then heating and draining again.

[0043] Preferably, the quaternary ammonium salt aqueous solution includes at least one of a cetyltrimethylammonium bromide aqueous solution, a tetradecyltrimethylammonium bromide aqueous solution, a dodecyltrimethylammonium bromide aqueous solution or an n-octyltrimethylammonium bromide aqueous solution.

[0044] Preferably, the temperature of the reheating and drying is 65° C. and the time is 30 minutes. Preferably, the reheating and drying is performed in a vacuum environment.

[0045] Preferably, the quaternary ammonium salt content in the quaternary ammonium salt aqueous solution is 8% (w / v).

[0046] Preferably, the reaction further includes a purification step.

[0047] Preferably, the purification treatment includes ethanol precipitation treatment, which includes mixing the reacted RNA with a sodium chloride solution and ethanol to obtain a mixed solution, allowing the mixed solution to stand, and then centrifuging and collecting the precipitate.

[0048] Preferably, the concentration of the sodium chloride solution is 5 mol / L.

[0049] Preferably, the standing temperature is -20°C, and the standing time is 1 hour.

[0050] As a preferred technical solution, the liquid phase synthesis method comprises the following steps:

[0051] (1) using a solid phase synthesis column, synthesizing RNA in sequence by deprotection, coupling, oxidation, and capping, wherein the deprotection reagent comprises a trichloroacetic acid solution, the coupling reagent comprises an ethylthiotetrazole solution, the oxidation oxidant comprises an iodine solution, and the capping reagent comprises an acetic anhydride solution and an N-methylimidazole solution; mixing the solid phase synthesized RNA with a 5' end phosphorylation reagent, wherein the 5' end phosphorylation reagent comprises 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite;

[0052] (2) taking the RNA-linked vector after solid phase synthesis and mixing it with an aminolysis reagent for aminolysis treatment, wherein the aminolysis reagent is AMA aminolysis solution;

[0053] (3) mixing the RNA obtained in step (2) with triethylamine trihydrofluoride to remove the tert-butyldimethylsilyl protecting group;

[0054] (4) mixing the RNA obtained in step (3) with a quaternary ammonium salt aqueous solution for salting out;

[0055] (5) mixing the RNA obtained in step (4) with imidazole-modified 7-methylguanosine diphosphate and a solvent for reaction;

[0056] (6) The RNA obtained in step (6) is mixed with a sodium chloride solution and ethanol to obtain a mixed solution, the mixed solution is allowed to stand, and then centrifuged and the precipitate is collected to obtain RNA modified with a 5' end cap structure.

[0057] Compared with the prior art, the present invention has at least the following beneficial effects:

[0058] The liquid phase method provided by the present invention does not involve the use of enzymes, and is therefore low-cost and simple in process; does not involve the use of highly toxic substances and 2'-O-PrOM-modified ribonucleoside phosphoramidite monomers, and is therefore safe, low-cost, and easy to commercialize; does not involve the use of catalysts, and RNA in the form of a quaternary ammonium salt has good solubility in organic solvents, and is therefore simple to operate and easy to achieve scale-up of production; can achieve safe, simple, and low-cost synthesis of RNA modified with a 5' end cap structure, has high coupling efficiency, is easy to scale up, and can better achieve commercialization and industrialization, and has important application prospects in the field of nucleic acid ligation. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is the TIC spectrum of the crude RNA modified with the 5' end cap structure in Example 1.

[0060] Figure 2 This is the TIC spectrum of the crude RNA modified with the 5' end cap structure in Example 2.

[0061] Figure 3 This is the TIC spectrum of the crude RNA modified with the 5' end cap structure in Example 3.

[0062] Figure 4 This is the TIC spectrum of the crude RNA modified with the 5' end cap structure in Example 4.

[0063] Figure 5 This is the TIC spectrum of the crude RNA modified with the 5' end cap structure in Example 5.

[0064] Figure 6 This is the TIC spectrum of the crude RNA modified with the 5' end cap structure in Example 6.

[0065] Figure 7This is the TIC spectrum of the crude RNA modified with the 5' end cap structure in Example 7.

[0066] Figure 8 This is the TIC spectrum of the crude RNA modified with the 5' end cap structure in Example 8. DETAILED DESCRIPTION

[0067] The technical solution of the present invention will be further described below with reference to the accompanying drawings and through specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0068] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0069] The LC-MS analysis method for RNA with a 5' end cap structure is shown in Table 1 below.

[0070] Table 1

[0071]

[0072] The calculation method of coupling reaction efficiency includes: coupling efficiency = peak area of ​​RNA modified with 5' end cap structure / (peak area of ​​RNA not modified with 5' end cap structure + peak area of ​​RNA modified with 5' end cap structure) × 100%.

[0073] Example 1

[0074] In this example, a 20-base RNA was used as an example to perform a 5' end cap structure modification reaction. The RNA sequence was ACAAGCACACGACCACAGGA (SEQ ID NO. 1), and the target molecular weight was 6935.1 Da.

[0075] Here are the steps:

[0076] 1. Synthesis of RNA with 5'-terminal phosphate modification

[0077] The above sequence was synthesized by solid-phase synthesis using a packed 200 nmol universal CPG (controlled pore glass) synthesis column. The activator was 0.25 M 5-ethylthiotetrazolium (ETT) in acetonitrile, the deprotection reagent was 3% trichloroacetic acid (TCA) in dichloromethane, the capping reagent was 10% acetic anhydride in acetonitrile (10% acetic anhydride / acetonitrile) and N-methylimidazole / pyridine / acetonitrile (volume ratio 14:10:76), the oxidation reagent was 0.05 M (mol / L) iodine in tetrahydrofuran / pyridine / water (volume ratio 70:20:10), and the phosphorylation reagent was 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0078] 2. Ammonolysis

[0079] Remove the CPG from the synthesis column and place it in a threaded tube. Then add 200 μL of AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1) (the carrier and ammonolysis solution ratio is 1 nmol:1 μL) and tighten the threaded tube cap. Place the threaded tube in a 65°C water bath and heat for 120 minutes. After the reaction is complete, place the threaded tube in a -20°C refrigerator and cool for 10 minutes. Aspirate the liquid in the threaded tube and add it to the spin column. Then place the spin column in a centrifuge and centrifuge at 13,000 rpm for 2 minutes. Transfer the filtrate from the centrifugation to a new threaded tube and place it in a 65°C vacuum centrifuge dryer and heat and dry it at 13,000 rpm for 60 minutes.

[0080] 3. Removal of TBDMS protecting group

[0081] Add 100 μL of DMSO to the threaded tube, then heat it in a water bath at 65°C for 10 minutes. Remove the threaded tube and add 125 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 minutes. Then, add 20 μL of 5 mol / L NaCl and 1 mL of ethanol. Cool it in a -20°C refrigerator for 1 hour, remove the threaded tube, centrifuge it for 3 minutes, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 minutes and dissolve it in 100 μL of primary water.

[0082] 4. Salting out

[0083] From the concentrated RNA, 100 nmol of RNA was separated and placed in a new screw-threaded tube. Then, 9 μL of an 8% (w / v) solution of cetyltrimethylammonium bromide was added and shaken. After centrifugation for 2 minutes, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the screw-threaded tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 minutes.

[0084] 5. Conjugation of 7-methylguanosine diphosphate

[0085] 200 μL N,N-dimethylformamide and 5 mg imidazole-modified 7-methylguanosine diphosphate (Shanghai Zhaowei Technology Development Co., Ltd., R2-066) were added to the screw-threaded tube, and the screw-threaded tube was placed in a 35° C. water bath and heated for 60 min.

[0086] 6. Ethanol precipitation

[0087] Remove the threaded tube, centrifuge, aspirate the supernatant and transfer it to a new threaded tube. Add 20 μL of 5 mol / L NaCl solution and 1 mL of ethanol to the threaded tube, shake and place in a -20°C refrigerator to cool for 1 hour. Remove the threaded tube and place it in a centrifuge and centrifuge at 13,000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifugal dryer, heat and dry at 13,000 rpm for 10 minutes. Add 400 μL of first-grade water and shake to dissolve. The liquid contains the target 5' end cap structure modified RNA, which is then analyzed by LC-MS.

[0088] The total ion chromatogram (TIC) of the crude RNA modified with a 5' end cap structure of 20 bases in length is as follows Figure 1 As shown, the target product has a retention time of 1.44 minutes, a molecular weight of 6938.7 Da, and a peak area percentage of 76.1%, indicating a crude product purity of 76.1%. A substance with a retention time of 1.44 minutes, a molecular weight of 6553.0 Da, and a peak area percentage of 6.9% is presumably RNA with an imidazole group attached to the 5' end without 7-methylguanosine diphosphate conjugated thereto. The coupling reaction efficiency is 91.7%, demonstrating that the liquid phase method of the present invention can effectively synthesize RNA modified with a 5' end cap structure.

[0089] Example 2

[0090] In this example, a 30-base RNA was used as an example to perform a 5' end cap structure modification reaction. The RNA sequence was GUCUUAAUGAACAAGUAGUCUGCAACCACC (SEQ ID NO. 2), and the target molecular weight was 10057.9 Da.

[0091] Here are the steps:

[0092] 1. Synthesis of RNA with 5'-terminal phosphate modification

[0093] The above sequence was synthesized by solid-phase synthesis using a packed 200 nmol universal CPG synthesis column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazolium (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) solution in dichloromethane, the capping reagent was a mixture of 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile (volume ratio of 14:10:76), the oxidation reagent was tetrahydrofuran / pyridine / water containing 0.05 M iodine (volume ratio of 70:20:10), and the phosphorylation reagent was 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0094] 2. Ammonolysis

[0095] Remove the CPG from the synthesis column and place it in a threaded tube. Then add 200 μL of AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1) (the carrier and ammonolysis solution ratio is 1 nmol:1 μL) and tighten the threaded tube cap. Place the threaded tube in a 65°C water bath and heat for 120 minutes. After the reaction is complete, place the threaded tube in a -20°C refrigerator and cool for 10 minutes. Aspirate the liquid in the threaded tube and add it to the spin column. Then place the spin column in a centrifuge and centrifuge at 13,000 rpm for 2 minutes. Transfer the filtrate from the centrifugation to a new threaded tube and place it in a 65°C vacuum centrifuge dryer and heat and dry it at 13,000 rpm for 60 minutes.

[0096] 3. Removal of TBDMS protecting group

[0097] Add 100 μL of DMSO to the threaded tube, then heat it in a water bath at 65°C for 10 minutes. Remove the threaded tube and add 125 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 minutes. Then, add 20 μL of 5 mol / L NaCl and 1 mL of ethanol. Cool it in a -20°C refrigerator for 1 hour, remove the threaded tube, centrifuge it for 3 minutes, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 minutes and dissolve it in 100 μL of primary water.

[0098] 4. Salting out

[0099] 100 nmol of RNA was separated from the concentrated RNA and placed in a new screw-threaded tube. 14 μL of an 8% (w / v) tetradecyltrimethylammonium bromide solution was then added and shaken. After centrifugation for 2 minutes, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the screw-threaded tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 minutes.

[0100] 5. Conjugation of 7-methylguanosine diphosphate

[0101] 200 μL of N,N-dimethylformamide and 6 mg of imidazole-modified 7-methylguanosine diphosphate were added to the screw-threaded tube, and the screw-threaded tube was placed in a water bath at 45° C. and heated for 120 min.

[0102] 6. Ethanol precipitation

[0103] Remove the threaded tube, centrifuge, aspirate the supernatant and transfer it to a new threaded tube. Add 20 μL of 5 mol / L NaCl solution and 1 mL of ethanol to the threaded tube, shake and place in a -20°C refrigerator to cool for 1 hour. Remove the threaded tube and place it in a centrifuge and centrifuge at 13,000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifugal dryer, heat and dry at 13,000 rpm for 10 minutes. Add 400 μL of first-grade water and shake to dissolve. The liquid contains the target 5' end cap structure modified RNA, which is then analyzed by LC-MS.

[0104] The TIC spectrum of the crude RNA modified with a 5' end cap structure of 30 bases in length is as follows Figure 2 As shown, the target product has a retention time of 1.68 minutes, a molecular weight of 10,062.8 Da, and a peak area percentage of 81.8%, indicating a crude product purity of 81.8%. A substance with a retention time of 1.68 minutes, a molecular weight of 9,676.5 Da, and a peak area percentage of 9.7% is presumably RNA with an imidazole group attached to the 5' end without 7-methylguanosine diphosphate conjugated to it. The coupling reaction efficiency is 89.4%, demonstrating that the liquid phase method of the present invention can effectively synthesize RNA modified with a 5' end cap structure.

[0105] Example 3

[0106] In this example, a 40-base RNA was used as an example to perform a 5' end cap structure modification reaction. The RNA sequence was GUCUUAAUGAACAAGUAGUCUGCAACCACCACCAGCAGAG (SEQ ID NO. 3), and the target molecular weight was 13325.9 Da.

[0107] Here are the steps:

[0108] 1. Synthesis of RNA with 5'-terminal phosphate modification

[0109] The above sequence was synthesized by solid-phase synthesis using a packed 200 nmol universal CPG synthesis column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazolium (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) solution in dichloromethane, the capping reagent was a mixture of 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile (volume ratio of 14:10:76), the oxidation reagent was tetrahydrofuran / pyridine / water containing 0.05 M iodine (volume ratio of 70:20:10), and the phosphorylation reagent was 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0110] 2. Ammonolysis

[0111] Remove the CPG from the synthesis column and place it in a threaded tube. Then add 200 μL of AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1) (the carrier and ammonolysis solution ratio is 1 nmol:1 μL) and tighten the threaded tube cap. Place the threaded tube in a 65°C water bath and heat for 120 minutes. After the reaction is complete, place the threaded tube in a -20°C refrigerator and cool for 10 minutes. Aspirate the liquid in the threaded tube and add it to the spin column. Then place the spin column in a centrifuge and centrifuge at 13,000 rpm for 2 minutes. Transfer the filtrate from the centrifugation to a new threaded tube and place it in a 65°C vacuum centrifuge dryer and heat and dry it at 13,000 rpm for 60 minutes.

[0112] 3. Removal of TBDMS protecting group

[0113] Add 100 μL of DMSO to the threaded tube, then heat it in a water bath at 65°C for 10 minutes. Remove the threaded tube and add 125 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 minutes. Then, add 20 μL of 5 mol / L NaCl and 1 mL of ethanol. Cool it in a -20°C refrigerator for 1 hour, remove the threaded tube, centrifuge it for 3 minutes, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 minutes and dissolve it in 100 μL of primary water.

[0114] 4. Salting out

[0115] 100 nmol of RNA was separated from the concentrated RNA and placed in a new screw-threaded tube. 19 μL of an 8% (w / v) aqueous solution of dodecyltrimethylammonium bromide was then added and shaken. After centrifugation for 2 minutes, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the screw-threaded tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 minutes.

[0116] 5. Conjugation of 7-methylguanosine diphosphate

[0117] 200 μL of tetrahydrofuran and 8 mg of imidazole-modified 7-methylguanosine diphosphate were added to the screw thread tube, and the screw thread tube was placed in a water bath at 50° C. and heated for 180 min.

[0118] 6. Ethanol precipitation

[0119] Remove the threaded tube, centrifuge, aspirate the supernatant and transfer it to a new threaded tube. Add 20 μL of 5 mol / L NaCl solution and 1 mL of ethanol to the threaded tube, shake and place in a -20°C refrigerator to cool for 1 hour. Remove the threaded tube and place it in a centrifuge and centrifuge at 13,000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifugal dryer, heat and dry at 13,000 rpm for 10 minutes. Add 400 μL of first-grade water and shake to dissolve. The liquid contains the target 5' end cap structure modified RNA, which is then analyzed by LC-MS.

[0120] The TIC spectrum of the crude RNA modified with a 5' end cap structure of 40 bases is as follows Figure 3 As shown, the target product has a retention time of 1.90 min, a molecular weight of 13,331.6 Da, and a peak area percentage of 83.0%, indicating a crude product purity of 83.0%. A substance with a retention time of 1.90 min, a molecular weight of 12,944.8 Da, and a peak area percentage of 10.6% is presumably RNA with an imidazole group attached to the 5' end without 7-methylguanosine diphosphate conjugated to it. The coupling reaction efficiency is 88.7%, demonstrating that the liquid phase method of the present invention can effectively synthesize RNA modified with a 5' end cap structure.

[0121] Example 4

[0122] In this example, a 50-base RNA was used as an example to perform 5' end cap structure modification reaction. The RNA sequence was: GUCUUAAUGAACAAGUAGUCUGCAACCACCACCAGCAGAGGGC GUUGUCC (SEQ ID NO. 4), and the target molecular weight was 16540.8 Da.

[0123] Here are the steps:

[0124] 1. Synthesis of RNA with 5'-terminal phosphate modification

[0125] The above sequence was synthesized by solid-phase synthesis using a packed 200 nmol universal CPG synthesis column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazolium (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) solution in dichloromethane, the capping reagent was a mixture of 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile (volume ratio of 14:10:76), the oxidation reagent was tetrahydrofuran / pyridine / water containing 0.05 M iodine (volume ratio of 70:20:10), and the phosphorylation reagent was 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0126] 2. Ammonolysis

[0127] Remove the CPG from the synthesis column and place it in a threaded tube. Then add 200 μL of AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1) (the carrier and ammonolysis solution ratio is 1 nmol:1 μL) and tighten the threaded tube cap. Place the threaded tube in a 65°C water bath and heat for 120 minutes. After the reaction is complete, place the threaded tube in a -20°C refrigerator and cool for 10 minutes. Aspirate the liquid in the threaded tube and add it to the spin column. Then place the spin column in a centrifuge and centrifuge at 13,000 rpm for 2 minutes. Transfer the filtrate from the centrifugation to a new threaded tube and place it in a 65°C vacuum centrifuge dryer and heat and dry it at 13,000 rpm for 60 minutes.

[0128] 3. Removal of TBDMS protecting group

[0129] Add 100 μL of DMSO to the threaded tube, then heat it in a water bath at 65°C for 10 minutes. Remove the threaded tube and add 125 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 minutes. Then, add 20 μL of 5 mol / L NaCl and 1 mL of ethanol. Cool it in a -20°C refrigerator for 1 hour, remove the threaded tube, centrifuge it for 3 minutes, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 minutes and dissolve it in 100 μL of primary water.

[0130] 4. Salting out

[0131] From the concentrated RNA, 100 nmol of RNA was separated and placed in a new screw-threaded tube. Then, 23 μL of an 8% (w / v) aqueous solution of n-octyltrimethylammonium bromide was added and shaken. After centrifugation for 2 minutes, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the screw-threaded tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 minutes.

[0132] 5. Conjugation of 7-methylguanosine diphosphate

[0133] 200 μL of tetrahydrofuran and 10 mg of imidazole-modified 7-methylguanosine diphosphate were added to the screw thread tube, and the screw thread tube was placed in a water bath at 55° C. and heated for 240 min.

[0134] 6. Ethanol precipitation

[0135] Remove the threaded tube, centrifuge, aspirate the supernatant and transfer it to a new threaded tube. Add 20 μL of 5 mol / L NaCl solution and 1 mL of ethanol to the threaded tube, shake and place in a -20°C refrigerator to cool for 1 hour. Remove the threaded tube and place it in a centrifuge and centrifuge at 13,000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifugal dryer, heat and dry at 13,000 rpm for 10 minutes. Add 400 μL of first-grade water and shake to dissolve. The liquid contains the target 5' end cap structure modified RNA, which is then analyzed by LC-MS.

[0136] The TIC spectrum of the crude RNA modified with a 5' end cap structure of 50 bases in length is as follows Figure 4 As shown, the target product has a retention time of 2.01 min, a molecular weight of 16549.9 Da, and a peak area percentage of 83.2%, indicating a crude product purity of 83.2%. The substance with a retention time of 2.01 min, a molecular weight of 16160.0 Da, and a peak area percentage of 8.2% is presumably RNA that has not been conjugated to 7-methylguanosine diphosphate at its 5' end and has been attached to an imidazole group. The coupling reaction efficiency is 91.0%, demonstrating that the liquid phase method of the present invention can effectively synthesize RNA modified with a 5' end cap structure.

[0137] Example 5

[0138] In this example, a 20-base RNA was used as an example to perform a 5' end cap structure modification reaction. The RNA sequence with methylation modification was: mACAAGCACACGACCACAGGA (SEQ ID NO. 5), and the target molecular weight was 6951.1 Da.

[0139] Here are the steps:

[0140] 1. Synthesis of RNA with 5'-terminal phosphate modification

[0141] The above sequence was synthesized by solid-phase synthesis using a packed 200 nmol universal CPG synthesis column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazolium (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) solution in dichloromethane, the capping reagent was a mixture of 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile (volume ratio of 14:10:76), the oxidation reagent was tetrahydrofuran / pyridine / water containing 0.05 M iodine (volume ratio of 70:20:10), and the phosphorylation reagent was 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0142] 2. Ammonolysis

[0143] Remove the CPG from the synthesis column and place it in a threaded tube. Then add 200 μL of AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1) (the carrier and ammonolysis solution ratio is 1 nmol:1 μL) and tighten the threaded tube cap. Place the threaded tube in a 65°C water bath and heat for 120 minutes. After the reaction is complete, place the threaded tube in a -20°C refrigerator and cool for 10 minutes. Aspirate the liquid in the threaded tube and add it to the spin column. Then place the spin column in a centrifuge and centrifuge at 13,000 rpm for 2 minutes. Transfer the filtrate from the centrifugation to a new threaded tube and place it in a 65°C vacuum centrifuge dryer and heat and dry it at 13,000 rpm for 60 minutes.

[0144] 3. Removal of TBDMS protecting group

[0145] Add 100 μL of DMSO to the threaded tube, then heat it in a water bath at 65°C for 10 minutes. Remove the threaded tube and add 125 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 minutes. Then, add 20 μL of 5 mol / L NaCl and 1 mL of ethanol. Cool it in a -20°C refrigerator for 1 hour, remove the threaded tube, centrifuge it for 3 minutes, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 minutes and dissolve it in 100 μL of primary water.

[0146] 4. Salting out

[0147] From the concentrated RNA, 100 nmol of RNA was separated and placed in a new screw-threaded tube. Then, 9 μL of an 8% (w / v) solution of cetyltrimethylammonium bromide was added and shaken. After centrifugation for 2 minutes, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the screw-threaded tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 minutes.

[0148] 5. Conjugation of 7-methylguanosine diphosphate

[0149] 200 μL of dimethyl sulfoxide and 12 mg of imidazole-modified 7-methylguanosine diphosphate were added to the screw-threaded tube, and the screw-threaded tube was placed in a water bath at 60° C. and heated for 270 min.

[0150] 6. Ethanol precipitation

[0151] Remove the threaded tube, centrifuge, aspirate the supernatant and transfer it to a new threaded tube. Add 20 μL of 5 mol / L NaCl solution and 1 mL of ethanol to the threaded tube, shake and place in a -20°C refrigerator to cool for 1 hour. Remove the threaded tube and place it in a centrifuge and centrifuge at 13,000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifugal dryer, heat and dry at 13,000 rpm for 10 minutes. Add 400 μL of first-grade water and shake to dissolve. The liquid contains the target 5' end cap structure modified RNA, which is then analyzed by LC-MS.

[0152] The TIC spectrum of the crude RNA modified with a 5' end cap structure of 20 bases is as follows Figure 5 As shown, the target product has a retention time of 1.81 minutes, a molecular weight of 6952.4 Da, and a peak area percentage of 95.3%, indicating a crude product purity of 95.3%. A substance with a retention time of 1.81 minutes, a molecular weight of 6566.6 Da, and a peak area percentage of 1.7% is presumably RNA with an imidazole group attached to the 5' end without 7-methylguanosine diphosphate conjugated to it. The coupling reaction efficiency is 98.2%, demonstrating that the liquid phase method of the present invention can effectively synthesize RNA modified with a 5' end cap structure.

[0153] Example 6

[0154] In this example, a 30-base RNA was used as an example to perform a 5' end cap structure modification reaction. The RNA sequence with methylation modification was: mGUCUUAAUGAACAAGUAGUCUGCAACCACC (SEQ ID NO. 6), and the target molecular weight was 10073.9 Da.

[0155] Here are the steps:

[0156] 1. Synthesis of RNA with 5'-terminal phosphate modification

[0157] The above sequence was synthesized by solid-phase synthesis using a packed 200 nmol universal CPG synthesis column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazolium (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) solution in dichloromethane, the capping reagent was a mixture of 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile (volume ratio of 14:10:76), the oxidation reagent was tetrahydrofuran / pyridine / water containing 0.05 M iodine (volume ratio of 70:20:10), and the phosphorylation reagent was 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0158] 2. Ammonolysis

[0159] Remove the CPG from the synthesis column and place it in a threaded tube. Then add 200 μL of AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1) (the carrier and ammonolysis solution ratio is 1 nmol:1 μL) and tighten the threaded tube cap. Place the threaded tube in a 65°C water bath and heat for 120 minutes. After the reaction is complete, place the threaded tube in a -20°C refrigerator and cool for 10 minutes. Aspirate the liquid in the threaded tube and add it to the spin column. Then place the spin column in a centrifuge and centrifuge at 13,000 rpm for 2 minutes. Transfer the filtrate from the centrifugation to a new threaded tube and place it in a 65°C vacuum centrifuge dryer and heat and dry it at 13,000 rpm for 60 minutes.

[0160] 3. Removal of TBDMS protecting group

[0161] Add 100 μL of DMSO to the threaded tube, then heat it in a water bath at 65°C for 10 minutes. Remove the threaded tube and add 125 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 minutes. Then, add 20 μL of 5 mol / L NaCl and 1 mL of ethanol. Cool it in a -20°C refrigerator for 1 hour, remove the threaded tube, centrifuge it for 3 minutes, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 minutes and dissolve it in 100 μL of primary water.

[0162] 4. Salting out

[0163] 100 nmol of RNA was separated from the concentrated RNA and placed in a new screw-threaded tube. 14 μL of an 8% (w / v) tetradecyltrimethylammonium bromide solution was then added and shaken. After centrifugation for 2 minutes, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the screw-threaded tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 minutes.

[0164] 5. Conjugation of 7-methylguanosine diphosphate

[0165] 200 μL of dimethyl sulfoxide and 13 mg of imidazole-modified 7-methylguanosine diphosphate were added to the screw thread tube, and the screw thread tube was placed in a water bath at 65° C. and heated for 300 min.

[0166] 6. Ethanol precipitation

[0167] Remove the threaded tube, centrifuge, aspirate the supernatant and transfer it to a new threaded tube. Add 20 μL of 5 mol / L NaCl solution and 1 mL of ethanol to the threaded tube, shake and place in a -20°C refrigerator to cool for 1 hour. Remove the threaded tube and place it in a centrifuge and centrifuge at 13,000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifugal dryer, heat and dry at 13,000 rpm for 10 minutes. Add 400 μL of first-grade water and shake to dissolve. The liquid contains the target 5' end cap structure modified RNA, which is then analyzed by LC-MS.

[0168] The TIC spectrum of the crude RNA modified with a 5' end cap structure of 30 bases in length is as follows Figure 6 As shown, the target product has a retention time of 1.77 minutes, a molecular weight of 10075.8 Da, and a peak area percentage of 93.2%, indicating a crude product purity of 93.2%. A substance with a retention time of 1.77 minutes, a molecular weight of 9689.7 Da, and a peak area percentage of 5.5% is presumably RNA with an imidazole group attached to the 5' end without 7-methylguanosine diphosphate conjugated to it. The coupling reaction efficiency is 94.4%, demonstrating that the liquid phase method can effectively synthesize RNA with a 5' end cap.

[0169] Example 7

[0170] In this example, a 20-base RNA was used as an example to perform a 5' end cap structure modification reaction. The RNA sequence with methylation modification was: mAmUAAGCACACGACCACAGGA (SEQ ID NO. 7), and the target molecular weight was 6966.1 Da.

[0171] Here are the steps:

[0172] 1. Synthesis of RNA with 5'-terminal phosphate modification

[0173] The above sequence was synthesized by solid-phase synthesis using a packed 200 nmol universal CPG synthesis column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazolium (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) solution in dichloromethane, the capping reagent was a mixture of 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile (volume ratio of 14:10:76), the oxidation reagent was tetrahydrofuran / pyridine / water containing 0.05 M iodine (volume ratio of 70:20:10), and the phosphorylation reagent was 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0174] 2. Ammonolysis

[0175] Remove the CPG from the synthesis column and place it in a threaded tube. Then add 200 μL of AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1) (the carrier and ammonolysis solution ratio is 1 nmol:1 μL) and tighten the threaded tube cap. Place the threaded tube in a 65°C water bath and heat for 120 minutes. After the reaction is complete, place the threaded tube in a -20°C refrigerator and cool for 10 minutes. Aspirate the liquid in the threaded tube and add it to the spin column. Then place the spin column in a centrifuge and centrifuge at 13,000 rpm for 2 minutes. Transfer the filtrate from the centrifugation to a new threaded tube and place it in a 65°C vacuum centrifuge dryer and heat and dry it at 13,000 rpm for 60 minutes.

[0176] 3. Removal of TBDMS protecting group

[0177] Add 100 μL of DMSO to the threaded tube, then heat it in a water bath at 65°C for 10 minutes. Remove the threaded tube and add 125 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 minutes. Then, add 20 μL of 5 mol / L NaCl and 1 mL of ethanol. Cool it in a -20°C refrigerator for 1 hour, remove the threaded tube, centrifuge it for 3 minutes, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 minutes and dissolve it in 100 μL of primary water.

[0178] 4. Salting out

[0179] From the concentrated RNA, 100 nmol of RNA was separated and placed in a new screw-threaded tube. Then, 9 μL of an 8% (w / v) aqueous solution of dodecyltrimethylammonium bromide was added and shaken. After centrifugation for 2 minutes, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the screw-threaded tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 minutes.

[0180] 5. Conjugation of 7-methylguanosine diphosphate

[0181] 200 μL of 1,4-dioxane and 14 mg of imidazole-modified 7-methylguanosine diphosphate were added to the screw thread tube, and the screw thread tube was placed in a water bath at 70° C. and heated for 330 min.

[0182] 6. Ethanol precipitation

[0183] Remove the threaded tube, centrifuge, aspirate the supernatant and transfer it to a new threaded tube. Add 20 μL of 5 mol / L NaCl solution and 1 mL of ethanol to the threaded tube, shake and place in a -20°C refrigerator to cool for 1 hour. Remove the threaded tube and place it in a centrifuge and centrifuge at 13,000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifugal dryer, heat and dry at 13,000 rpm for 10 minutes. Add 400 μL of first-grade water and shake to dissolve. The liquid contains the target 5' end cap structure modified RNA, which is then analyzed by LC-MS.

[0184] The TIC spectrum of the crude RNA modified with a 5' end cap structure of 20 bases is as follows Figure 7 As shown, the target product has a retention time of 1.63 minutes, a molecular weight of 6967.6 Da, and a peak area percentage of 95.6%, indicating a crude product purity of 95.6%. A substance with a retention time of 1.63 minutes, a molecular weight of 6448.7 Da, and a peak area percentage of 3.3% is presumably RNA that has not been coupled to 7-methylguanosine diphosphate at the 5' end and has lost its 5' phosphate group. The coupling reaction efficiency is 96.7%, demonstrating that the liquid phase method of the present invention can effectively synthesize RNA modified with a 5' end cap structure.

[0185] Example 8

[0186] In this example, a 30-base RNA was used as an example to perform a 5' end cap structure modification reaction. The RNA sequence with methylation modification was: mGmUCUUAAUGAACAAGUAGUCUGCAACCACC (SEQ ID NO. 8), and the target molecular weight was 10087.9 Da.

[0187] Here are the steps:

[0188] 1. Synthesis of RNA with 5'-terminal phosphate modification

[0189] The above sequence was synthesized by solid-phase synthesis using a packed 200 nmol universal CPG synthesis column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazolium (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) solution in dichloromethane, the capping reagent was a mixture of 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile (volume ratio of 14:10:76), the oxidation reagent was tetrahydrofuran / pyridine / water containing 0.05 M iodine (volume ratio of 70:20:10), and the phosphorylation reagent was 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0190] 2. Ammonolysis

[0191] Remove the CPG from the synthesis column and place it in a threaded tube. Then add 200 μL of AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1) (the carrier and ammonolysis solution ratio is 1 nmol:1 μL) and tighten the threaded tube cap. Place the threaded tube in a 65°C water bath and heat for 120 minutes. After the reaction is complete, place the threaded tube in a -20°C refrigerator and cool for 10 minutes. Aspirate the liquid in the threaded tube and add it to the spin column. Then place the spin column in a centrifuge and centrifuge at 13,000 rpm for 2 minutes. Transfer the filtrate from the centrifugation to a new threaded tube and place it in a 65°C vacuum centrifuge dryer and heat and dry it at 13,000 rpm for 60 minutes.

[0192] 3. Removal of TBDMS protecting group

[0193] Add 100 μL of DMSO to the threaded tube, then heat it in a water bath at 65°C for 10 minutes. Remove the threaded tube and add 125 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 minutes. Then, add 20 μL of 5 mol / L NaCl and 1 mL of ethanol. Cool it in a -20°C refrigerator for 1 hour, remove the threaded tube, centrifuge it for 3 minutes, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 minutes and dissolve it in 100 μL of primary water.

[0194] 4. Salting out

[0195] 100 nmol of RNA was separated from the concentrated RNA and placed in a new screw-threaded tube. 14 μL of an 8% (w / v) aqueous solution of n-octyltrimethylammonium bromide was then added and shaken. After centrifugation for 2 minutes, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the screw-threaded tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 minutes.

[0196] 5. Conjugation of 7-methylguanosine diphosphate

[0197] 200 μL of 1,4-dioxane and 15 mg of imidazole-modified 7-methylguanosine diphosphate were added to the screw-threaded tube, and the screw-threaded tube was placed in a water bath at 75° C. and heated for 360 min.

[0198] 6. Ethanol precipitation

[0199] Remove the threaded tube, centrifuge, aspirate the supernatant and transfer it to a new threaded tube. Add 20 μL of 5 mol / L NaCl solution and 1 mL of ethanol to the threaded tube, shake and place in a -20°C refrigerator to cool for 1 hour. Remove the threaded tube and place it in a centrifuge and centrifuge at 13,000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifugal dryer, heat and dry at 13,000 rpm for 10 minutes. Add 400 μL of first-grade water and shake to dissolve. The liquid contains the target 5' end cap structure modified RNA, which is then analyzed by LC-MS.

[0200] The TIC spectrum of the crude RNA modified with a 5' end cap structure of 30 bases in length is as follows Figure 8 As shown, the retention time of the target product is 1.81 min, the molecular weight is 10090.3 Da, and its peak area accounts for 88.5%, that is, the purity of the crude product is 88.5%. The substance with a retention time of 1.81 min, a molecular weight of 9704.0 Da, and a peak area accounting for 3.9% is speculated to be RNA that is not coupled to 7-methylguanosine diphosphate at the 5' end and is connected to an imidazole group. The substance with a retention time of 1.81 min, a molecular weight of 9571.3 Da, and a peak area accounting for 4.0% is speculated to be RNA that is not coupled to 7-methylguanosine diphosphate at the 5' end and has lost the 5' end phosphate group. The efficiency of the coupling reaction is 91.8%, which proves that the liquid phase method of the present invention can effectively synthesize RNA modified with a 5' end cap structure.

[0201] The efficiency of the coupling reactions of Examples 1-8 is shown in Table 2.

[0202] Table 2

[0203] serial number Cap modification type Base length Efficiency of coupling reaction Example 1 Cap-0 20 91.7％ Example 2 Cap-0 30 89.4％ Example 3 Cap-0 40 88.7％ Example 4 Cap-0 50 91.0％ Example 5 Cap-1 20 98.2％ Example 6 Cap-1 30 94.4％ Example 7 Cap-2 20 96.7％ Example 8 Cap-2 30 91.8％

[0204] The cap-modification coupling reaction efficiencies for Examples 1-8 in Table 2 demonstrate that the liquid-phase method provided herein is effective for 5'-end cap modification of RNA. The cap modification type can be Cap-0, Cap-1, or Cap-2. The RNA base length ranges from 20 to 50 nt, and the cap-modification coupling reaction efficiency is above 88%.

[0205] In summary, the liquid-phase method of the present invention allows for the safe, simple, and inexpensive synthesis of 5'-end-capped RNA. Furthermore, this method boasts high coupling efficiency and ease of scale-up for commercialization and industrialization, demonstrating its promising application in the field of nucleic acid ligation.

[0206] The applicant declares that the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the scope of protection and disclosure of the present invention.

Claims

1. A liquid phase synthesis method for RNA modified with a 5' end cap structure, characterized in that: The liquid phase synthesis method comprises: mixing RNA modified with 5' end phosphate, imidazole-modified 7-methylguanosine diphosphate and a solvent to react, thereby obtaining RNA modified with a 5' end cap structure.

2. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to claim 1, characterized in that: The molar ratio of the 5'-terminal phosphate-modified RNA to the imidazole-modified 7-methylguanosine diphosphate is 1 nmol:(100-300) nmol.

3. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to claim 1 or 2, characterized in that: The solvent includes at least one of N,N-dimethylformamide, tetrahydrofuran, dimethyl sulfoxide or 1,4-dioxane.

4. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to any one of claims 1 to 3, characterized in that: The reaction temperature is 30-80° C., and the reaction time is 60-360 min.

5. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to any one of claims 1 to 4, characterized in that: The preparation method of the 5'-end phosphate-modified RNA includes solid phase synthesis, 5'-end phosphorylation treatment and post-treatment.

6. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to claim 5, characterized in that: The solid phase synthesis includes: deprotection, coupling, oxidation and capping; Preferably, the deprotection reagent comprises trichloroacetic acid solution; Preferably, the coupling reagent includes ethylthiotetrazolium solution; Preferably, the oxidizing agent comprises an iodine solution; Preferably, the capping reagent comprises acetic anhydride solution and N-methylimidazole solution.

7. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to claim 5 or 6, characterized in that: The 5' end phosphorylation treatment comprises mixing the solid phase synthesized RNA with a 5' end phosphorylation reagent, wherein the 5' end phosphorylation reagent comprises 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite.

8. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to any one of claims 5 to 7, characterized in that: The post-treatment includes taking the carrier connected to the RNA after solid phase synthesis and performing aminolysis treatment, removing the tert-butyldimethylsilyl protecting group treatment and removing impurities; Preferably, the aminolysis treatment comprises mixing the RNA with an aminolysis reagent; Preferably, the ammonolysis reagent is an AMA ammonolysis solution, and the AMA ammonolysis solution comprises ammonia water and methylamine ethanol solution; Preferably, the treatment to remove the tert-butyldimethylsilyl protecting group comprises mixing the RNA after aminolysis treatment with a deprotection reagent, wherein the deprotection reagent comprises triethylamine trihydrofluoride; Preferably, the impurity removal treatment comprises salting out the RNA, and the salting-out reagent comprises a quaternary ammonium salt aqueous solution; Preferably, the quaternary ammonium salt aqueous solution includes at least one of a cetyltrimethylammonium bromide aqueous solution, a tetradecyltrimethylammonium bromide aqueous solution, a dodecyltrimethylammonium bromide aqueous solution or an n-octyltrimethylammonium bromide aqueous solution.

9. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to any one of claims 1 to 8, characterized in that: The reaction also includes a purification step; Preferably, the purification treatment includes ethanol precipitation treatment, which includes mixing the reacted RNA with a sodium chloride solution and ethanol to obtain a mixed solution, allowing the mixed solution to stand, and then centrifuging and collecting the precipitate.

10. The liquid phase synthesis method of RNA modified with a 5' end cap structure according to any one of claims 1 to 9, characterized in that: The liquid phase synthesis method comprises the following steps: (1) using a solid phase synthesis column, synthesizing RNA in sequence by deprotection, coupling, oxidation, and capping, wherein the deprotection reagent comprises a trichloroacetic acid solution, the coupling reagent comprises an ethylthiotetrazole solution, the oxidation oxidant comprises an iodine solution, and the capping reagent comprises an acetic anhydride solution and an N-methylimidazole solution; mixing the solid phase synthesized RNA with a 5' end phosphorylation reagent, wherein the 5' end phosphorylation reagent comprises 2-[2-(4,4'-dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite; (2) taking the RNA-linked vector after solid phase synthesis and mixing it with an aminolysis reagent for aminolysis treatment, wherein the aminolysis reagent is AMA aminolysis solution; (3) mixing the RNA obtained in step (2) with triethylamine trihydrofluoride to remove the tert-butyldimethylsilyl protecting group; (4) mixing the RNA obtained in step (3) with a quaternary ammonium salt aqueous solution for salting out; (5) mixing the RNA obtained in step (4) with imidazole-modified 7-methylguanosine diphosphate and a solvent for reaction; (6) The RNA obtained in step (6) is mixed with a sodium chloride solution and ethanol to obtain a mixed solution, the mixed solution is allowed to stand, and then centrifuged and the precipitate is collected to obtain RNA modified with a 5' end cap structure.

Images