Thyroid cancer noninvasive test kit and application method thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a thyroid cancer noninvasive test kit and an application method thereof. The nucleic acid aptamer capable of being specifically combined with the thyroid cancer is obtained through screening of the CELL-SELEX technology, the affinity is high, the specificity is high, and the nucleic acid aptamer is expected to play an important role in noninvasive detection of the thyroid cancer and preparation of targeted drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a non-invasive detection kit for thyroid cancer and an application method thereof. Background Art

[0002] Thyroid cancer is the most common endocrine malignancy worldwide, with a significant increase in incidence over the past decade (an average annual increase of approximately 5%). While early-stage differentiated thyroid cancer (such as papillary carcinoma) has a favorable prognosis, effective treatments remain lacking for advanced, recurrent, and undifferentiated thyroid cancers. Current diagnostic and treatment technologies have the following limitations: Diagnosis: Ultrasound and fine-needle aspiration (FNA) carry a false-negative risk (approximately 10-15%) and cannot distinguish between benign and malignant follicular lesions; Treatment: Targeted drugs (such as sorafenib and lenvatinib) are prone to drug resistance and have significant side effects; Molecular markers: Traditional markers (such as Tg and TSH) lack specificity and cannot accurately guide individualized treatment.

[0003] Aptamer is a ligand system evolution technology that is developed through exponential enrichment in vitro.

[0004] Aptamers are single-stranded DNA or RNA that binds to a target molecule with high specificity after multiple rounds of screening from a random single-stranded nucleic acid sequence library using SELEX (Evolution of Ligands by Exponential Enrichment). Aptamers are relatively stable relative to protein antibodies, and the preparation process is relatively easy, with no batch-to-batch variability. When aptamers bind to a target, they primarily form stable secondary structures, such as hairpins, stem-loops, and G4 structures, through intermolecular forces such as hydrogen bonding, van der Waals forces, electrostatic interactions, and hydrophobic interactions. The bases that form these structures are typically key sites that influence binding activity.

[0005] The method of screening nucleic acid aptamers by targeting cells is called CELL-SELEX. Its basic principle is to combine target cells with an in vitro synthetic oligonucleotide library, introduce normal cells to remove non-specific binding oligonucleotides, and use PCR technology to expand the capacity of oligonucleotide molecules binding to target cells. After several or even dozens of rounds of repeated screening and enrichment, nucleic acid aptamers with high specificity and high affinity are obtained. Cell-SELEX technology generally uses the identification of subtle molecular differences on the cell membranes of positively screened cells (cancer cells) and negatively screened cells (normal cells) to obtain nucleic acid aptamers that can effectively distinguish cancer cells from normal cells. Further characterization of the properties of these nucleic acid aptamers and identification of their target molecules will help discover new tumor biomarkers for tumor diagnosis and treatment. Throughout the CELL-SELEX process, all molecules expressed by cells are in their native folded state, reflecting a state closer to physiological conditions, which enhances the success rate of nucleic acid aptamer application in vivo. Summary of the Invention

[0006] The first aspect of the present invention is to provide a novel nucleic acid aptamer with high affinity and specificity for thyroid cancer cells. This aptamer is simple to prepare, low in cost, exhibits good selectivity for thyroid cancer cells, strong binding affinity, high detection sensitivity, simple detection procedures, and accurate results.

[0007] A nucleic acid aptamer for detecting thyroid cancer, having a sequence of 5'-AATGACGGGAGGACCTGTTCGATGTCGTATAACTTTATAG-3' (SEQ NO. 1), or primer sequences added to both ends of the sequence, preferably: 5'-AGCAGCACAGAGGTCAGATG AATGACGGGAGGACCTGTTCGATGTCGTATAACTTTATAGCCTATGCGTGCTACCGTGAA-3' (SEQ NO. 2), named TCA-1,

[0008] The nucleic acid aptamer TCA-1 for detecting thyroid cancer was heated at 25°C and 1.0 mM Na + , 0.5 mM Mg 2+ Under these conditions, it has a unique stem-loop structure, and its structural formula is as follows:

[0009]

[0010] ΔG = -4.00 kcal / mol

[0011] Preferably, the thyroid cancer cells are one or more of TPC-1, BTH-231, TSHRO-4, TSHRO-1, TPO-5, and TPO-6.

[0012] It is worth mentioning that the secondary structure of the present invention is only a predicted structure. There may be slight deviations in the prediction results in different prediction software. Therefore, as long as it is the same as the nucleic acid aptamer sequence of the present invention, regardless of the secondary structure, it should be considered to fall within the scope of protection of the present invention.

[0013] Similarly, as long as the sequence similarity with the nucleic acid aptamer of the present invention is above 90%, other sequences that can have the same or extremely similar applications as the nucleic acid aptamer of the present invention, even if there may be individual base modifications that have no effect on the overall function, should also be considered to fall within the scope of protection of the present invention.

[0014] Preferably, when screening the above-mentioned nucleic acid aptamers, the nucleic acid library and primers used are designed as follows:

[0015] Random nucleic acid library (SEQ ID NO: 3): 5'-FAM-AGCAGCACAGAGGTCAGATG-[N40]-CCTATGCGTGCTACCGTGAA-3'

[0016] Upstream primer (SEQ ID NO: 4): 5'-FITC-AGCAGCACAGAGGTCAGATG-3'

[0017] Downstream primer (SEQ ID NO: 5): 5'-biotin-CCTATGCGTGCTACCGTGAA-3'.

[0018] Where N represents any random base among A, T, C, and G.

[0019] Another aspect of the present invention provides the nucleic acid aptamer for detecting thyroid cancer, wherein one or both ends of the sequence are modified or transformed including radioactive labeling, therapeutic drug linkage, fluorescent labeling or biotin labeling to obtain a nucleic acid aptamer derivative having the same ability to bind to thyroid cancer cells as the nucleic acid aptamer.

[0020] Another aspect of the present invention is to provide a non-invasive test kit for thyroid cancer, which comprises the above-mentioned aptamer and commonly used detection reagents.

[0021] Another aspect of the present invention is to provide the use of the above-mentioned aptamer or kit, and the use of the nucleic acid aptamer in preparing various preparations for diagnosing and treating thyroid cancer and related tumor cells and tissues.

[0022] The drugs used to treat thyroid are one or more of thyroid hormone drugs, glucocorticoid drugs, beta-blockers, and antithyroid drugs.

[0023] It can be applied to the detection of related malignancies, including human thyroid cancer, and to the preparation of related therapeutic drugs. Detection aspects include but are not limited to the identification of specific cell lines, the preparation of tumor markers, the preparation of detection kits, and imaging examinations.

[0024] Compared with existing technologies, the advantages of the present invention are: the human thyroid cancer cell aptamer described herein possesses a unique stem-loop structure and, as demonstrated by flow cytometry, exhibits high binding affinity and specificity, specifically recognizing thyroid cancer cells while ignoring normal thyroid cells and most other solid tumor cells. The screened aptamer can be further truncated and optimized, resulting in a smaller molecular weight, lower synthesis costs, increased affinity, ease of modification, non-cytotoxicity, strong binding specificity, no immunogenicity, and high stability.

[0025] The present invention is used to perform cell detection of related tumor diseases and prepare therapeutic drugs and detection kits, and the operation is simple and rapid. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 CELL-SELEX process for screening thyroid cancer aptamers.

[0027] Figure 2 Secondary structure of TCA-1.

[0028] Figure 3 The binding dissociation constant (Kd) of TCA-1 and TPC-1.

[0029] Figure 4 Binding specificity of TCA-1 and TPC-1, where ** indicates P < 0.01. DETAILED DESCRIPTION

[0030] The following examples further illustrate the nucleic acid aptamers for simultaneously identifying multiple malignant tumor cells, including thyroid cancer cells, and their applications. The following examples are illustrative and intended only to explain the present invention, and are not to be construed as limiting the present invention.

[0031] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0032] Example 1 Screening of Aptamers Recognizing Thyroid

[0033] 1. Design of nucleic acid library and primers used:

[0034] Random nucleic acid library (SEQ ID NO: 3): 5'-FAM-AGCAGCACAGAGGTCAGATG-[N40]-CCTATGCGTGCTACCGTGAA-3'

[0035] Upstream primer (SEQ ID NO: 4): 5'-FITC-AGCAGCACAGAGGTCAGATG-3'

[0036] Downstream primer (SEQ ID NO: 5): 5'-biotin-CCTATGCGTGCTACCGTGAA-3'.

[0037] Where N represents any random base among A, T, C, and G.

[0038] 2. Screening process:

[0039] The present invention uses human thyroid cancer cell TPC-1 as a positive screening target and normal thyroid cell Nthy-ori3-1 as a counter-screening target.

[0040] 2.1 Positive screening:

[0041] a. Incubation: Dissolve the random DNA library in binding buffer, denature at 95°C for 5 minutes, anneal on ice for 10 minutes, and then incubate with pre-treated human thyroid cancer cells that have been cultured for more than 24 hours and have a cell confluence of approximately 90% at 4°C for 1 hour.

[0042] b. Separation: Remove the supernatant after incubation, rinse the cells several times with wash buffer, then scrape the washed cells with sterile water and place them in a centrifuge tube. Denature at 95°C for 10 minutes, renature on ice for 10 minutes, and centrifuge at 5500 rpm for 3 minutes. Aspirate the supernatant to obtain the first round of screening nucleic acid library of TPC-1 cells.

[0043] c. PCR amplification of the library: Using the library obtained in step b as a template and the above primers as primers, amplify the library using the following conditions: 95°C for 30 seconds, 55.9°C for 30 seconds, 72°C for 30 seconds for 8 cycles, and 72°C for 5 minutes. A preliminary amplification product is obtained, and then large-scale amplification is performed using the amplified product as a template for an appropriate number of cycles.

[0044] d. Preparation of single-stranded DNA: The antisense strand of the biotin-labeled PCR amplification product from step c was separated using streptavidin-modified agarose beads, and then the double-stranded DNA was denatured with 0.2 M NaOH. The positive single-stranded DNA library labeled with fluorescein isothiocyanate was collected by desalting.

[0045] 2.2 Counter-screening: Incubate the single-stranded DNA library obtained in step d with the counter-screening cells Nthy-ori3-1, collect the supernatant after incubation to exclude non-specifically bound nucleic acid molecules, and continue to incubate the supernatant with the positive screening cells for the next screening step.

[0046] 2.3 Screening Cycle: Repeat the screening process of 2.1 and 2.2 until the aptamer library with strong binding to the target cell TPC-1 is screened. This process needs to be repeated for several to more than ten rounds.

[0047] 2.4 High-throughput Sequencing: The final round of screening combined with the largest nucleic acid library was subjected to high-throughput sequencing. Flow cytometry was used to analyze the resulting sequences for their binding to TPC-1 cells, thereby identifying the aptamers. Fluorescence detection was performed by flow cytometry, using the initial random DNA library as a control. Products from the 13th round of screening reached maximum enrichment and did not bind to thyroid cells.

[0048] The sequence of the obtained specific aptamer TCA-1 is shown below (SEQ ID NO: 2): 5′-AGCAGCACAGAGGTCAGATG AATGACGGGAGGACCTGTTCGATGTCGTATAACTTTATAGCCTATGCGTGCTACCGTGAA-3′.

[0049] Its secondary structure is Figure 2 shown.

[0050] Example 2

[0051] The Cy5-labeled nucleic acid aptamer TCA-1 was prepared into binding solutions with final concentrations of 500nM, 400nM, 300nM, 250nM, 200nM, 100nM, 50nM, 25nM, 12.5nM, 6.25nM, 3.125nM, 1.565nM, 0.785nM, 0.395nM, and 0.195nM, respectively. The solutions were incubated with 500,000 target cells at 4°C for 1 hour, and then washed twice with wash buffer. The fluorescence intensity of the cell surface was detected by flow cytometry. After deducting the fluorescence intensity of the random library at the corresponding concentration, the binding dissociation constant of the nucleic acid aptamer was calculated using the formula Y=BmaxX / (Kd+X). The results are shown in Figure 2. Figure 3 shown.

[0052] The binding dissociation constant Kd of TCA-1 to TPC-1 cells is 6.528 nM.

[0053] Example 3 TCA-1 binding specificity to target cells

[0054] The Cy5-labeled nucleic acid aptamer TCA-1 was prepared into a binding solution with a final concentration of 250nM, and incubated with 500,000 thyroid cancer cell lines TPC-1, breast cancer cell lines MDA-MB-453, gastric cancer cell lines MGC803, lung cancer cell lines A549, rectal cancer cell lines HCT116, and ovarian cancer cell lines A-1847 at 37°C for 1 hour, and then washed twice with washing buffer. The fluorescence intensity of the cell surface was detected by flow cytometry. It was found that the binding intensity with each cell was as follows: Figure 4 shown.

[0055] The binding affinity of the TCA-1 aptamer of the present invention for the thyroid cancer cell line TPC-1 was significantly different from that for other cancer cell lines (P < 0.01). This indicates that the TCA-1 aptamer has strong specificity for recognizing thyroid cancer cell lines. It is expected to be used in kits for the specific detection of thyroid cancer, including but not limited to the identification of specific cell lines, the preparation of tumor markers, the preparation of detection kits, and imaging examinations.

[0056] It can also be used in combination with drugs or antibodies commonly used in the field to treat thyroid cancer in the preparation of targeted therapeutic drugs, and can also be used to find cancer target molecules to carry out research on the mechanism of the disease and targeted diagnosis and treatment of related tumor diseases.

[0057] The preferred embodiments of the present invention have been described in detail above. It should be understood that numerous modifications and variations based on the concepts of the present invention are possible without inventive effort by those skilled in the art. Therefore, any technical solution that can be derived by one skilled in the art through logical analysis, reasoning, or limited experimentation based on the concepts of the present invention and the prior art should be within the scope of protection defined by the claims.

Claims

1. A nucleic acid aptamer for specific detection of thyroid cancer, characterized in that: The specific sequence is shown in SEQ ID NO:

2.

2. The aptamer according to claim 1, characterized in that The upstream primer for nucleic acid aptamer amplification is shown in SEQ ID NO: 4 in the sequence listing, and the downstream primer is shown in SEQ ID NO: 5 in the sequence listing.

3. The nucleic acid aptamer for detecting thyroid cancer according to claim 1, wherein The nucleic acid aptamer with the same function is obtained by deleting or replacing bases at both ends or one end.

4. The nucleic acid aptamer for detecting thyroid cancer according to any one of claims 1 to 3, wherein Modifications or alterations including radioactive labeling, therapeutic drug connection, fluorescent labeling or biotin labeling are performed on both ends or one end of the sequence to obtain nucleic acid aptamer derivatives having the same ability to bind to thyroid cancer cells as the nucleic acid aptamer.

5. A kit for non-invasive detection of thyroid cancer, characterized in that it comprises the nucleic acid aptamer according to any one of claims 1 to 4.

6. A pharmaceutical composition for targeted treatment of thyroid, characterized in that: Comprising the nucleic acid aptamer according to any one of claims 1 to 4 and a drug for treating thyroid cancer.

7. The pharmaceutical composition according to claim 6, wherein the drug for treating thyroid can be one or more of thyroid hormone drugs, glucocorticoid drugs, beta-blockers, and antithyroid drugs.

8. The pharmaceutical composition according to claim 6, wherein the drug for treating thyroid cancer can be one or more of siRNA drugs, ASOs or antibodies.

9. Use of the nucleic acid aptamer according to any one of claims 1 to 4 or the kit according to claim 5 in preparing a preparation for detecting or diagnosing thyroid cancer.

10. Use of the nucleic acid aptamer according to any one of claims 1 to 4 or the pharmaceutical composition according to any one of claims 6 to 8 in the preparation of a preparation for treating thyroid cancer.

Images