A method for improving the freeze resistance of saccharomyces cerevisiae

By constructing recombinant Saccharomyces cerevisiae and utilizing the expression of the ARO9 gene and the S.cry-EGFP-KanMX vector, the problem of insufficient freeze resistance of Saccharomyces cerevisiae was solved, and the efficient application of Saccharomyces cerevisiae in frozen environments was realized.

CN120665907BActive Publication Date: 2025-11-25GUANGZHOU RESTAURANT GRP LIKOUFU FOOD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511191824.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-25
Publication Date
2025-11-25
Estimated Expiration
2045-08-25

AI Technical Summary

Technical Problem

Saccharomyces cerevisiae has poor freeze resistance, which limits its application in frozen foods, frozen pharmaceuticals, and frozen cosmetics, affecting the quality and efficacy of these products.

Method used

By constructing a recombinant Saccharomyces cerevisiae, the ARO9 gene and recombinant expression vector S.cry-EGFP-KanMX were used to induce the expression of the ARO9 protein to enhance the freeze resistance of Saccharomyces cerevisiae.

Benefits of technology

It significantly improves the freeze resistance of brewer's yeast, making it suitable for preparing highly freeze-resistant foods, pharmaceuticals, and cosmetics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665907B_ABST
    Figure CN120665907B_ABST
Patent Text Reader

Abstract

The application provides a method for improving the anti-freezing property of Saccharomyces cerevisiae. The method comprises the following steps: constructing recombinant Saccharomyces cerevisiae by using specific biological materials, and then inducing expression of the recombinant Saccharomyces cerevisiae, so that the anti-freezing property of the Saccharomyces cerevisiae is effectively improved. The application first finds that the anti-freezing property of the recombinant Saccharomyces cerevisiae constructed by transferring a recombinant plasmid containing an ARO9 gene into the Saccharomyces cerevisiae is significantly improved compared with the Saccharomyces cerevisiae, and the recombinant Saccharomyces cerevisiae is suitable for preparing food, medicine, cosmetics and other products with high anti-freezing property.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of microorganisms. More particularly, it relates to a method for improving the freeze resistance of Saccharomyces cerevisiae. BACKGROUND

[0002] Saccharomyces cerevisiae has poor freeze resistance, mainly due to: (1) ice crystal damage: during freezing, water in Saccharomyces cerevisiae cells will form ice crystals, directly piercing the cell wall and cell membrane, leading to leakage of cell contents; (2) metabolic activity stagnation: low temperature (<0 ℃) will completely stop the metabolism of Saccharomyces cerevisiae, and long-term freezing will lead to loss of function of organelles, making it difficult to restore normal fermentation capacity even after thawing; (3) osmotic pressure imbalance: freezing will cause a dramatic change in the distribution of water inside and outside Saccharomyces cerevisiae cells, leading to an imbalance in osmotic pressure, and further causing cell dehydration or swelling and rupture.

[0003] Moreover, the low freeze resistance of Saccharomyces cerevisiae will directly or indirectly affect its application in frozen foods, frozen drugs, and frozen cosmetics, such as: (1) in the field of frozen foods, it may lead to a decrease in the fermentation performance of dough, affecting the volume, texture, and taste of finished products such as bread and steamed buns; (2) in the field of frozen drugs, it may lead to a decrease in the survival rate of Saccharomyces cerevisiae cells, or a decrease in the beneficial ingredients that can be produced, thereby affecting the stability and efficacy of the drug; (3) in the field of frozen cosmetics, it may lead to a decrease in the active ingredients that can be produced by yeast cells, thereby reducing the yield or efficacy of the cosmetic.

[0004] Therefore, it is necessary to find a method for improving the freeze resistance of Saccharomyces cerevisiae, which is essential for frozen products such as food, medicine, and cosmetics. SUMMARY

[0005] The present application aims to provide a method for improving the freeze resistance of Saccharomyces cerevisiae, by using specific biological materials to construct recombinant Saccharomyces cerevisiae, and then inducing expression of the recombinant Saccharomyces cerevisiae, which can effectively improve the freeze resistance of Saccharomyces cerevisiae, and is suitable for preparing high freeze resistance products such as food, medicine, and cosmetics.

[0006] The first object of the present application is to provide a method for improving the freeze resistance of Saccharomyces cerevisiae.

[0007] The second object of the present application is to provide a method for constructing recombinant Saccharomyces cerevisiae.

[0008] The third object of the present application is to provide recombinant Saccharomyces cerevisiae constructed by the above method.

[0009] The fourth object of the present application is to provide the use of the above recombinant Saccharomyces cerevisiae in the preparation of high freeze resistance products.

[0010] The fifth objective of this invention is to provide the application of the ARO9 gene or ARO9 protein in enhancing the freeze resistance of Saccharomyces cerevisiae.

[0011] The above-mentioned objective of this invention is achieved through the following technical solution:

[0012] This invention provides a method for improving the freeze resistance of brewing yeast, namely: first constructing recombinant brewing yeast, and then inducing expression in the recombinant brewing yeast;

[0013] Among them, recombinant brewer's yeast is constructed using one or more of the following biological materials:

[0014] (1) ARO9 gene (nucleotide sequence as shown in SEQ ID NO:11);

[0015] (2) An expression box containing (1);

[0016] (3) Recombinant expression vectors containing (1) and / or (2).

[0017] Preferably, the recombinant expression vector is S.cry-EGFP-KanMX.

[0018] Preferably, the brewing yeast is *Saccharomyces cerevisiae* (Saccharomyces cerevisia Saccharomyces cerevisiae The LKF-01 strain was deposited on March 26, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 66058, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0019] Based on this, the present invention also provides a method for constructing recombinant Saccharomyces cerevisiae, namely: first constructing a recombinant plasmid containing the ARO9 gene, and then transferring the recombinant plasmid into Saccharomyces cerevisiae for induced expression.

[0020] Preferably, the brewing yeast is brewing yeast strain LKF-01, which was deposited on March 26, 2025 at the Guangdong Provincial Microbial Culture Collection Center with accession number GDMCC No: 66058, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0021] This invention is the first to discover that transferring a recombinant plasmid containing the aromatic amino acid transaminase ARO9 gene into *Saccharomyces cerevisiae* significantly enhances the freeze resistance of the resulting recombinant *Saccharomyces cerevisiae* compared to the original *Saccharomyces cerevisiae*, making it suitable for preparing highly freeze-resistant food, pharmaceutical, and cosmetic products. Therefore, the recombinant *Saccharomyces cerevisiae* constructed using the above method, its application in preparing highly freeze-resistant products, and the application of the ARO9 gene or ARO9 protein (amino acid sequence as shown in SEQ ID NO: 12) in enhancing the freeze resistance of *Saccharomyces cerevisiae* should all be within the scope of protection of this invention.

[0022] Preferably, the product is one or more of food, medicine, and cosmetics.

[0023] Preferably, the brewing yeast is brewing yeast strain LKF-01, which was deposited on March 26, 2025 at the Guangdong Provincial Microbial Culture Collection Center with accession number GDMCC No: 66058, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0024] The present invention has the following beneficial effects:

[0025] This invention is the first to discover that transferring a recombinant plasmid containing the ARO9 gene into Saccharomyces cerevisiae results in a recombinant Saccharomyces cerevisiae with significantly improved freeze resistance compared to regular Saccharomyces cerevisiae, making it suitable for preparing highly freeze-resistant food, pharmaceutical, cosmetic and other products. Attached Figure Description

[0026] Figure 1 The image shows an agarose gel electrophoresis result of plasmid S.cry-EGFP-KanMX used to verify Example 1. In the image, 1 represents the PCR product band, and M represents the marker band.

[0027] Figure 2 The image shown is an agarose gel electrophoresis diagram to verify plasmid S.cry-TEF1-ARO9-EGFP-KanMX in Example 1. In the image, 1 represents the PCR product band, and M represents the marker band.

[0028] Figure 3 This is an agarose gel electrophoresis image from Example 2. In the image, 1 represents the PCR product band, and M represents the marker band.

[0029] Figure 4 This is a fluorescence microscope image of Example 2. Detailed Implementation

[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0031] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0032] Example 1: Construction of recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX

[0033] (1) Using the genomic DNA of Saccharomyces cerevisiae LKF-01 strain (deposited at Guangdong Provincial Microbial Culture Collection Center on March 26, 2025, with accession number GDMCC No: 66058) as a template, the upstream rDNA homologous sequence was amplified with primer F1 / R1, the downstream rDNA homologous sequence was amplified with primer F2 / R2, the ARO9 gene was amplified with primer F3 / R3, and the promoter TEF1 was amplified with primer F4 / R4.

[0034] The primers are shown in Table 1.

[0035] Table 1

[0036]

[0037] The nucleotide sequence of the upstream rDNA homologous sequence is shown in SEQ ID NO:9:

[0038]

[0039] The nucleotide sequence of the downstream rDNA homolog is shown in SEQ ID NO:10:

[0040]

[0041] The nucleotide sequence of the ARO9 gene is shown in SEQ ID NO:11, and the amino acid sequence it encodes is shown in SEQ ID NO:12.

[0042] SEQ ID NO:11:

[0043]

[0044] SEQ ID NO:12:

[0045] MTAGSAPPVDYTSLKKNFQPFLSRRVENRSLKSFWDASDISDDVIELAGGMPNERFFPIESMDLKISKVPFNDNPKWHNSFTTAHLDLGSPSELPIARSFQYAETKGLPPLLHFVKDFVSRINRPAFSDETESNWDVILSGGSNDSMFKVFETICDESTTVMIEEFTFTPAMSNVEATGAKVIPIKMNLTFDRESQGIDVEYLTQLLDNWSTGPYKDLNKPRVLYTIATGQNPTGMSVPQWKREKIYQLAQRHDFLIVEDDPYGYLYFPSYNPQEPLENPYHSSDLTTERYLNDFLMKSFLTLDTDARVIRLETFSKIFAPGLRLSFIVANKFLLQKILDLADITTRAPSGTSQAIVYSTIKAMAESNLSSSLSMKEAMFEGWIRWIMQIASKYNHRKNLTLKALYETESYQAGQFTVMEPSAGMFIIIKINWGNFDRPDDLPQQMDILDKFLLKNGVKLVLGYKMAVCPNYSKQNSDFLRLTIAYARDDDQLIEASKRIGSGIKEFFDNYKS。

[0046] The nucleotide sequence of the promoter TEF1 is shown in SEQ ID NO:13:

[0047] ccacacaccatagcttcaaaatgtttctactccttttttactcttccagattttctcggactccgcgcatcgccgtaccacttcaaaacacccaagcacagc atactaaattccccctctttcttcctctagggtgtcgttaattacccgtactaaaggtttggaaaagaaaaaagagaccgcctcgtttctttttcttcgtcg aaaaaggcaataaaaatttttatcacgtttctttttcttgaaaatttttttttttgatttttttctctttcgatgacctcccattgatatttaagttattaa atggtcttcaatttctcaagtttcagtttcatttttcttgttctattacaactttttttacttcttgctcattagaaagaaagcatagcaatctaatctaa.

[0048] (2) Using plasmid pAUR123-EGFP as a template, the EGFP+ terminator ADH1 fragment sequence was amplified with primers F5 / R5.

[0049] The primers are:

[0050] Primer F5 (SEQ ID NO: 14): tctaacccgggtgatatcatggtgagcaagggcgagg;

[0051] Primer R5 (SEQ ID NO:15): ctgtcgattcgatactaacg.

[0052] The nucleotide sequence of the EGFP+ terminator ADH1 fragment is shown in SEQ ID NO:16:

[0053]

[0054] (3) Using plasmid pRCC-k as a template, the promoter TEF1+KanMX+ terminator TEF1 fragment sequence was amplified with primer F6 / R6, and the Amp+ori fragment sequence was amplified with primer F7 / R7.

[0055] The primers are shown in Table 2.

[0056] Table 2

[0057]

[0058] The nucleotide sequence of the promoter TEF1+KanMX+ terminator TEF1 fragment is shown in SEQ ID NO:21:

[0059]

[0060] The nucleotide sequence of the Amp+ori fragment is shown in SEQ ID NO:22:

[0061]

[0062] (4) The upstream rDNA homologous sequence, the EGFP+ terminator ADH1 fragment sequence, the promoter TEF1+KanMX+ terminator TEF1 fragment sequence, the downstream rDNA homologous sequence and the Amp+ori fragment sequence are recombined to obtain the plasmid S.cry-EGFP-KanMX.

[0063] (5) The plasmid S.cry-EGFP-KanMX obtained in (4) was transformed into Escherichia coli DH5α by heat shock, and then plated on LB plates containing 100 μg / mL ampicillin (Amp). After incubation at 37 ℃ for 24 h, single clones were picked. Using the single clones as templates, PCR verification was performed using primers F1 (SEQ ID NO:1) and R2 (SEQ ID NO:4) as PCR verification primers. The PCR products were then subjected to agarose gel electrophoresis. The results are as follows: Figure 1 As shown in the figure, the PCR product band is above 4000 bp, indicating that the plasmid S.cry-EGFP-KanMX was successfully constructed.

[0064] (6) After double digestion with SmaI and EcoRV, the plasmid S.cry-EGFP-KanMX obtained in (4) is recombined with the promoter TEF1 and ARO9 genes to obtain the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX.

[0065] (7) The recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX obtained in (6) was transformed into Escherichia coli DH5α by heat shock, and then plated on LB plates containing 100 μg / mL ampicillin (Amp). After incubation at 37 ℃ for 24 h, single clones were picked. Using the single clones as templates, PCR verification was performed using primers F4 (SEQ ID NO:7) and R3 (SEQ ID NO:6) as PCR verification primers. The PCR products were then subjected to agarose gel electrophoresis. The results are as follows: Figure 2 As shown in the figure, the PCR product band is around 2000 bp, indicating that the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX was successfully constructed.

[0066] Example 2 Construction and screening of recombinant brewer's yeast

[0067] (1) Using the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX obtained in Example 1 as a template, and primers F1 (SEQ ID NO:1) and R2 (SEQ ID NO:4) as PCR-specific primers, rDNA was amplified. up-TEF1-ARO9-EGFP-KanMX-rDNA down sequence.

[0068] (2) Take the rDNA obtained in (1) up -TEF1-ARO9-EGFP-KanMX-rDNA down The sequence was electroporated into the Saccharomyces cerevisiae LKF-01 strain to construct recombinant Saccharomyces cerevisiae.

[0069] (3) The recombinant Saccharomyces cerevisiae obtained in (2) was spread on yeast extract peptone glucose agar medium (YPD plate) containing 400 μg / mL genimycin (G418) and 1 mol / L sorbitol. After being cultured at 30 ℃ for 72 h, the transformants were picked and inoculated into 1 mL yeast extract peptone glucose medium (YPD liquid medium). The medium was cultured at 30 ℃ and 180 rpm for 24 h with shaking to obtain the culture solution.

[0070] (4) Take the transformant from (3), extract its genomic DNA, use the genomic DNA as a template, and use primers F4 (SEQ ID NO:7) and R5 (SEQ ID NO:15) as PCR verification primers to perform PCR verification. Then, perform agarose gel electrophoresis on the PCR products. The results are as follows: Figure 3 As shown in the figure, the PCR product band is around 3000 bp, and sequencing confirmed that it contains the nucleotide sequence shown in SEQ ID NO:11, indicating that the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX has been successfully transformed into the Saccharomyces cerevisiae LKF-01 strain, and the recombinant Saccharomyces cerevisiae has been successfully constructed.

[0071] (5) Take the culture medium obtained in (3) and observe it under a fluorescence microscope (excitation wavelength 465-495 nm, emission filter wavelength 512-558 nm, 10x objective lens). The results are as follows. Figure 4 As shown in the image, since the recombinant plasmid S.cry-TEF1-ARO9-EGFP-KanMX is expressed in fusion with the ARO9 protein, and EGFP is a green fluorescent protein, the green fluorescence in the fluorescence microscope image proves that the ARO9 protein has been successfully expressed in the recombinant Saccharomyces cerevisiae.

[0072] Example 3: Freeze Resistance Test of Recombinant Saccharomyces cerevisiae

[0073] I. Reagent Preparation

[0074] Methylene blue staining solution: Mix 0.025 g methylene blue, 0.048 g calcium chloride hexahydrate, 1.0 g glucose, 0.042 g potassium chloride, and 0.02 g sodium bicarbonate, then add sterile physiological saline to a final volume of 100 mL.

[0075] II. Testing Methods

[0076] (1) The recombinant Saccharomyces cerevisiae and Saccharomyces cerevisiae LKF-01 strain obtained in Example 2 were inoculated into yeast extract peptone glucose medium (YPD liquid medium) containing 200 mg / mL genimycin (G418). After shaking culture at 30 ℃ and 180 rpm for 24 h, 1 mL of culture medium was dispensed into each tube and centrifuged at 8000 rpm for 5 min to remove the supernatant.

[0077] (2) After centrifuging, the precipitated bacterial cells were stored in a -20 ℃ freezer for 2, 10, 16 and 20 days respectively. After thawing at room temperature (25 ℃), 1 mL of PBS was added to resuspend the bacterial cells. After 30 min, 10 μL was mixed with methylene blue staining solution (990 μL) and stained for 10 min. Based on the principle that live cells can reduce the staining agent that has entered the cell without being stained, the number of live cells was determined by counting them under a microscope using a hemocytometer. Finally, the cell survival rate was determined by the formula "survival rate / % = number of live cells / (number of live cells + number of dead cells) × 100%".

[0078] III. Test Results

[0079] The results showed that the survival rates of the recombinant *Saccharomyces cerevisiae* after storage at -20 °C for 2, 10, 16, and 20 days were 78.0%, 46.8%, 32.4%, and 21.4%, respectively, while the survival rates of *Saccharomyces cerevisiae* strain LKF-01 after storage at -20 °C for 2, 10, 16, and 20 days were 64.6%, 15.4%, 10.0%, and 4.8%, respectively. Therefore, the present invention, by transferring a recombinant plasmid containing the ARO9 gene into *Saccharomyces cerevisiae*, significantly improves the freeze resistance of the recombinant *Saccharomyces cerevisiae* compared to the original *Saccharomyces cerevisiae*, making it suitable for preparing highly freeze-resistant food, pharmaceutical, and cosmetic products.

[0080] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A method for improving the freeze resistance of brewing yeast, characterized in that, First, a recombinant Saccharomyces cerevisiae was constructed, and then its expression was induced. The Saccharomyces cerevisiae strain was Saccharomyces cerevisiae LKF-01, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on March 26, 2025, with the accession number GDMCC No:66058. Among them, recombinant Saccharomyces cerevisiae was constructed using any of the following biological materials: (1) ARO9 gene; (2) Expression box containing (1); (3) Recombinant expression vectors containing (1) and / or (2).

2. The application of overexpression of the ARO9 gene or overexpression of the ARO9 protein in improving the freeze resistance of Saccharomyces cerevisiae, characterized in that, The brewing yeast is Saccharomyces cerevisiae strain LKF-01, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on March 26, 2025, with accession number GDMCC No:66058.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae genetic engineering strain and construction method and application thereof

    CN113151028A

  • Application of MET14 gene or MET14 protein in improving freezing resistance of saccharomyces cerevisiae

    CN119979362A