Molecular marker and method for identifying Shiqi pigeon variety and application
By using multiplex PCR detection and sequencing methods of 50 molecular marker sites in the Shiqi pigeon breed, the accuracy and efficiency problems of Shiqi pigeon breed identification were solved, efficient and objective identification results were achieved, and the genetic resources of Shiqi pigeon were protected.
Patent Information
- Application Number
- CN202510959413.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-11
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-07-11
AI Technical Summary
Existing technologies make it difficult to identify Shiqi pigeon varieties efficiently and accurately, especially as there is mixing and counterfeiting in the market, which affects the purity and protection of its genetic resources, and judgments based on appearance characteristics are highly subjective.
Using 50 molecular marker sites, including SNP sites located in different pigeon genomes, multiplex PCR detection and sequencing are used to count the number of base difference SNP sites to determine the pigeon breed, providing an efficient and accurate identification method.
It has achieved efficient and objective identification of Shiqi pigeon varieties, improved the identification rate, protected the integrity of Shiqi pigeon's genetic resources, and supported the selection and application of fine varieties.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of molecular markers and genetic breeding, and in particular to a molecular marker, method and application for identifying Shiqi pigeon varieties. Background Art
[0002] Under the tide of commercial breeding, high-yield commercial pigeon breeds, with their economic advantages, have significantly impacted the market, squeezing the survival space of the Shiqi pigeon. At the same time, there is a large number of individuals in the market that are hybridized with other breeds, and even unrelated breeds are passed off simply because of their similar phenotypes. This mixing and impersonation not only seriously disrupts market order but also poses a substantial threat to the purity, genetic diversity conservation, and sustainable utilization of this precious genetic resource. Therefore, it is urgent to establish a scientific, accurate, and efficient Shiqi pigeon breed identification method to effectively protect the integrity of its genetic resources and support the selection and application of improved breeds. Summary of the Invention
[0003] The purpose of the present invention is to provide a molecular marker, method and application for identifying Shiqi pigeon varieties, so as to achieve efficient and accurate identification of Shiqi pigeon varieties.
[0004] According to a first aspect of the present invention, a molecular marker for identifying Shiqi pigeon varieties is provided, comprising a G / A mutation at position 34348083 of chromosome 1 on the pigeon genome GCA_028654425.1, an A / T mutation at position 43792470 of chromosome 1, a G / A mutation at position 4662968 of chromosome 2, a T / C mutation at position 4664079 of chromosome 2, a T / C mutation at position 4825319 of chromosome 2, a C / T mutation at position 18182842 of chromosome 2, a T / C mutation at position 20543785 of chromosome 2, an A / G mutation at position 21683679 of chromosome 2, and a C / T mutation at position 18182842 of chromosome 2. 077, T / C mutation at chromosome 2, G / A mutation at chromosome 2, G / A mutation at chromosome 4, T / C mutation at chromosome 4, C / T mutation at chromosome 4, A / C mutation at chromosome 5, A / G mutation at chromosome 5, G / C mutation at chromosome 5, A / C mutation at chromosome 6, A / G mutation at chromosome 7, T / C mutation at chromosome 7, C / T mutation at chromosome 4, A / C mutation at chromosome 5, A / G mutation at chromosome 5, G / C mutation at chromosome 5, A / C mutation at chromosome 6, A / G mutation at chromosome 7, T / C mutation at chromosome 7, C / T mutation at chromosome 4, A / C mutation at chromosome 5, A / G mutation at chromosome 5, G / C mutation at chromosome 5, A / C mutation at chromosome 6, A / G mutation at chromosome 7, T / C mutation at chromosome 7, T / G mutation at 5758, C / A mutation at 35833970 on chromosome 8, A / G mutation at 415891 on chromosome 9, T / C mutation at 5995369 on chromosome 9, C / A mutation at 687812 on chromosome 11, G / A mutation at 31080652 on chromosome 11, T / C mutation at 15095086 on chromosome 16, G / A mutation at 12075890 on chromosome 22, C / T mutation at 5161735 on chromosome 23, T / C mutation at 5119132 on chromosome 25, T / A mutation at 7447512 on chromosome 25, A / C mutation at No. 15848385, T / C mutation at No. 2599218 on chromosome 26, G / A mutation at No. 3700510 on chromosome 27, C / G mutation at No. 9898674 on chromosome 27, A / G mutation at No. 9921138 on chromosome 27, T / C mutation at No. 16395889 on chromosome 27, G / A mutation at No. 16811788 on chromosome 27, G / A mutation at No. 2167347 on chromosome 28, A / G mutation at No. 3077457 on chromosome 28, G / A mutation at No. 8395635 on chromosome 30, C / T mutation at No. 1667143 on chromosome 31,G / C mutation at position 9460737 of chromosome 31, T / G mutation at position 4518546 of chromosome 32, T / C mutation at position 8517446 of chromosome 32, T / G mutation at position 4376601 of chromosome 33, G / C mutation at position 6946030 of chromosome 33, A / C mutation at position 6948563 of chromosome 33, C / A mutation at position 6956676 of chromosome 33, C / G mutation at position 6064675 of chromosome 34, and G / A mutation at position 735599 of chromosome 40. Therefore, the 50 molecular marker sites mentioned above can be used as molecular identification cards for Shiqi pigeon breed identification. By comparing the bases at the corresponding sites to see if they are Shiqi pigeon breed-specific bases, and finally counting the number of SNP sites with different bases, it can be determined whether the pigeon is a Shiqi pigeon breed. This method is accurate and efficient, with a high identification rate, and can effectively identify Shiqi pigeon breeds.
[0005] According to a second aspect of the present invention, the use of the aforementioned molecular markers for identifying Shiqi pigeon breeds is provided. This application overcomes the existing problem of identifying pigeon breeds based on appearance, which makes it difficult to distinguish hybrid offspring or phenotypically similar imposter breeds, and is highly subjective and relies on empirical judgment. Identification using the aforementioned molecular markers offers a high detection rate, is more scientific and effective, and facilitates large-scale adoption.
[0006] According to a third aspect of the present invention, there is provided an application of a product for detecting the molecular markers in identifying Shiqi pigeon breeds. By using the product for detecting the molecular markers in Shiqi pigeon breed identification, the application is convenient and efficient.
[0007] In certain embodiments, the product comprises a probe, primer, or kit capable of detecting the molecular marker of claim 1.
[0008] In certain embodiments, the primers are mixed primers whose sequences are shown as SEQ ID No: 1-100.
[0009] According to a fourth aspect of the present invention, a method for identifying Shiqi pigeon varieties is provided, wherein the method comprises the following steps:
[0010] S1: Sampling the pigeons to be identified and extracting DNA;
[0011] S2: performing multiplex PCR on the DNA extracted in step S1, wherein the multiplex PCR primers are mixed primers with sequences as shown in SEQ ID No: 1-100;
[0012] S3: Sequencing the multiplex PCR test results to determine the bases at the sites where the molecular markers are located;
[0013] S4: Record the number of SNP sites where the bases at the site are different from the Shiqi pigeon breed-specific bases: When the number of SNP sites that are different from the Shiqi pigeon breed-specific bases is less than 3, it can be determined to be the Shiqi pigeon breed; when the number of SNP sites with differences is between 3-5, it is uncertain whether it is the Shiqi pigeon breed; when the number of SNP sites with differences is greater than 5, the breed is not the Shiqi pigeon breed.
[0014] Therefore, this method can be used to identify Shiqi pigeon varieties efficiently, accurately and objectively, with a high identification rate, and can be promoted and used.
[0015] In some embodiments, the Shiqi pigeon breed-specific base includes the G base at 34348083 of chromosome 1 of the pigeon genome GCA_028654425.1, the A base at 43792470 of chromosome 1, the G base at 4662968 of chromosome 2, the T base at 4664079 of chromosome 2, the T base at 4825319 of chromosome 2, the C base at 18182842 of chromosome 2, the T base at 20543785 of chromosome 2, the A base at 21683679 of chromosome 2, the T base at 51365077 of chromosome 2, the T base at 51664520 of chromosome 2. G base, G base at 2274426 on chromosome 4, T base at 2335380 on chromosome 4, C base at 30404232 on chromosome 4, A base at 5410553 on chromosome 5, A base at 21857219 on chromosome 5, G base at 44048740 on chromosome 5, A base at 46273012 on chromosome 6, A base at 42249848 on chromosome 7, T base at 46224259 on chromosome 7, T base at 31125758 on chromosome 8, C base at 35833970 on chromosome 8, The A base on chromosome 9, the T base at 5995369, the C base at 687812 on chromosome 11, the G base at 31080652 on chromosome 11, the T base at 15095086 on chromosome 16, the G base at 12075890 on chromosome 22, the C base at 5161735 on chromosome 23, the T base at 5119132 on chromosome 25, the T base at 7447512 on chromosome 25, the A base at 15848385 on chromosome 25, the T base at 2599218 on chromosome 26, the G base at 3700510 on chromosome 27, C base at 9898674, A base at 9921138 on chromosome 27, T base at 16395889 on chromosome 27, G base at 16811788 on chromosome 27, G base at 2167347 on chromosome 28, A base at 3077457 on chromosome 28, G base at 8395635 on chromosome 30, C base at 1667143 on chromosome 31, G base at 9460737 on chromosome 31, C base at 4518546 on chromosome 32, T base at 8517446 on chromosome 32, T base at 4376601 on chromosome 33,The G base at position 6946030 on chromosome 33, the A base at position 6948563 on chromosome 33, the C base at position 6956676 on chromosome 33, the C base at position 6064675 on chromosome 34, and the G base at position 735599 on chromosome 40.
[0016] In certain embodiments, the concentration of each primer is 0.2 μM.
[0017] According to a fifth aspect of the present invention, the application of the above method in Shiqi pigeon breed identification is provided. Through this application, Shiqi pigeon breeds can be identified efficiently, accurately, and objectively with a high identification rate, which can be promoted for use.
[0018] According to a fifth aspect of the present invention, a primer for Shiqi pigeon breed identification is provided, wherein the primer is a mixed primer having a sequence as shown in SEQ ID No: 1-100. Thus, the mixed primer can efficiently, accurately, and objectively identify Shiqi pigeon breeds, with a high identification rate, and can be promoted for use.
[0019] Beneficial effects of the present invention:
[0020] The present invention discloses a molecular marker for identifying Shiqi pigeon varieties. The molecular marker includes 50 SNP sites. These sites are detected, and then the detection results are compared to see whether the bases of the corresponding sites are Shiqi pigeon variety-specific bases. Finally, the number of SNP sites with different bases is counted. When the number of SNP sites with differences from the Shiqi pigeon variety-specific bases is less than 3, it can be determined to be a Shiqi pigeon variety; when the number of SNP sites with differences is between 3 and 5, it is uncertain whether it is a Shiqi pigeon variety; when the number of SNP sites with differences is greater than 5, the variety is not a Shiqi pigeon variety. In this way, whether the pigeon can be identified as a Shiqi pigeon variety can be identified. The method is accurate and efficient, with a high identification rate, and can efficiently identify Shiqi pigeon varieties, so as to effectively protect the integrity of Shiqi pigeon genetic resources and support the breeding and application of fine varieties. DETAILED DESCRIPTION
[0021] The analysis was based on the "ASM2865442v1" data from the GenBank pigeon reference genome "GCA_028654425.1." SNPs with a maf < 0.05 and a missingness > 0.1 were filtered. SNPs with a LD > 0.2 were filtered using a 100-bp window and a sliding distance of 5 SNPs. After initial screening using GWAS and LD analysis, 628,689 SNPs were retained. Due to the limitations of the Python random forest package, all SNPs were split into three RF models. The SNPs with the highest importance in these three models were selected as high-quality SNPs. Random forests were used to extract high-eigenvalue SNPs. The MeanDecreaGini eigenvalue of each SNP was scored using the RF model algorithm to extract the top 1,000 and top 2,000 Guangdong Shiqi pigeon breed-specific sequences. The top 2000 most important SNPs were used to calculate the minimum allele frequency of the purebred Shiqi pigeon population. The variant sites with a frequency less than 0.016 were selected and compared with the number of variant sites in other pigeon breeds. Finally, 50 specific molecular markers for identifying Shiqi pigeons were selected. These molecular markers include the following 50 SNP sites:
[0022] The sq_tag1 site is a G / A mutation located at position 34348083 of chromosome 1 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag1 site are:
[0023] sq_P1f(SEQ ID No:1):ACTGCTCAACTTCAACAGGGAGATG,
[0024] sq_P1r(SEQ ID No:2):TCCTTGCAGCTGGTCATGGGGA;
[0025] The sq_tag2 site is an A / T mutation located at position 43792470 of chromosome 1 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag2 site are:
[0026] sq_P2f(SEQ ID No:3):AATAATGCCCACGGCGTGCT,
[0027] sq_P2r(SEQ ID No:4):TTCTGAAAAGTCCTTGATGTTGCAC;
[0028] The sq_tag3 site is a G / A mutation located at position 4662968 of chromosome 2 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag3 site are:
[0029] sq_P3f(SEQ ID No:5):ACCTGCCTGTTTCTCTCCGTTT,
[0030] sq_P3r(SEQ ID No:6):TGGCATTTTGGTGCATTCTGTG;
[0031] The sq_tag4 site is a T / C mutation located at position 4664079 of chromosome 2 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag4 site are:
[0032] sq_P4f(SEQ ID No:7):CCCATACCAGCAACCACGGG,
[0033] sq_P4r(SEQ ID No:8):GGTGTTAACTTTGCTTTCCTGGTTT;
[0034] The sq_tag5 site is a T / C mutation located at position 4825319 of chromosome 2 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag5 site are:
[0035] sq_P5f(SEQ ID No:9):TGTCCCACCTCCTCATGGGCCAG,
[0036] sq_P5r(SEQ ID No:10):ATGTGGCTGGTCAGAGCTGCCTT;
[0037] The sq_tag6 site is a C / T mutation located at position 18182842 of chromosome 2 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. The base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag6 site are:
[0038] sq_P6f (SEQ ID No: 11): TGCTAATGCTGAGCCGCCCC,
[0039] sq_P6r (SEQ ID No: 12): TGCACCTTGGGGAGCAGGACAA;
[0040] The sq_tag7 site is a T / C mutation located at position 20543785 of chromosome 2 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag7 site are:
[0041] sq_P7f(SEQ ID No:13):TGCTGGTTTGCAAGCACCCCG,
[0042] sq_P7r(SEQ ID No:14):GCAACTGCCCTCGCTGACCC;
[0043] The sq_tag8 site is an A / G mutation located at position 21683679 of chromosome 2 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag8 site are:
[0044] sq_P8f(SEQ ID No:15):AGCCCGCTTTATGGCATAGTGTTT,
[0045] sq_P8r(SEQ ID No:16):GCGCTGGCATCATACCAACCTTGA;
[0046] The sq_tag9 site is a T / C mutation located at position 51365077 of chromosome 2 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag9 site are:
[0047] sq_P9f(SEQ ID No:17):GCATGCTGGCAGAAAGTCTGGT,
[0048] sq_P9r (SEQ ID No: 18): TGCTCAGTGGCTCTGCTTGGC;
[0049] The sq_tag10 site is a G / A mutation located at position 51664520 of chromosome 2 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag10 site are:
[0050] sq_P10f(SEQ ID No:19):ACCTTCTGCTGACCCGGAGGA,
[0051] sq_P10r(SEQ ID No:20):CCCTTCCCAAGCTCTAGATGTGGT;
[0052] The sq_tag11 site is a G / A mutation located at position 2274426 of chromosome 4 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag11 site are:
[0053] sq_P11f (SEQ ID No: 21): GTCTTCATGAGCTGTCAGTGTTGT,
[0054] sq_P11r (SEQ ID No: 22): GCAGCCTGCACTTGAGCACAT;
[0055] The sq_tag12 site is a T / C mutation located at position 2335380 of chromosome 4 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag12 site are:
[0056] sq_P12f(SEQ ID No:23):AGCTCGCTGCTCCACGTTGC,
[0057] sq_P12r(SEQ ID No:24):TTGTGCACTGAGGTGAAGGGC;
[0058] The sq_tag13 site is a C / T mutation located at position 30404232 of chromosome 4 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. This base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag13 site are:
[0059] sq_P13f (SEQ ID No: 25): AGGAGGACCTAGATCAGCCCTGGAA, sq_P13r (SEQ ID No: 26): CTCCACCCTTCTGGCGGGCTT;
[0060] The sq_tag14 site is an A / C mutation located at position 5410553 of chromosome 5 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag14 site are:
[0061] sq_P14f (SEQ ID No: 27): TGTTCCCCCAACACTTCCCCCT,
[0062] sq_P14r(SEQ ID No:28):CTTTCACAAGCTGGGGATGAAGAGA;
[0063] The sq_tag15 site is an A / G mutation located at position 21857219 of chromosome 5 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag15 site are:
[0064] sq_P15f (SEQ ID No: 29): TGCTCAGCTCCCTCCAACCTCT,
[0065] sq_P15r(SEQ ID No:30):GGGCAGTGCATGTTCCCACCTC;
[0066] The sq_tag16 site is a G / C mutation located at position 44048740 of chromosome 5 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. This base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag16 site are:
[0067] sq_P16f(SEQ ID No:31):CAGCTCTGCTACGGCTGCAACT,
[0068] sq_P16r(SEQ ID No:32):TTCTGCAGTAATGGTGGTATTGCCT;
[0069] The sq_tag17 site is an A / C mutation located at position 46273012 of chromosome 6 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag17 site are:
[0070] sq_P17f(SEQ ID No:33):ACAGCAATGTGCAGGAGCTGGAA,
[0071] sq_P17r(SEQ ID No:34):TCTCAGAGCTGGGCAAGCATGGAT;
[0072] The sq_tag18 site is an A / G mutation located at position 42249848 of chromosome 7 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag18 site are:
[0073] sq_P18f(SEQ ID No:35):GCCACCTGACCAGGAAGGCTGAG,
[0074] sq_P18r(SEQ ID No:36):CCCCATGAGCGCCTCGTTGCT;
[0075] The sq_tag19 site is a T / C mutation located at position 46224259 of chromosome 7 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag19 site are:
[0076] sq_P19f(SEQ ID No:37):AACTGACCAGTCTGTCGTGCT,
[0077] sq_P19r(SEQ ID No:38):CACTGGCTTTGCAGAACCGAGAC;
[0078] The sq_tag20 site is a T / G mutation located at position 31125758 of chromosome 8 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag20 site are:
[0079] sq_P20f (SEQ ID No: 39): TTTGGGCTCCTGTAAATGTGACT,
[0080] sq_P20r (SEQ ID No: 40): AGCACAGGTAATGCAGAAGGGT;
[0081] The sq_tag21 site is a C / A mutation located at position 35833970 of chromosome 8 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. The base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag21 site are:
[0082] sq_P21f (SEQ ID No: 41): TGCACCATGCCCGTTCTCTGGG,
[0083] sq_P21r (SEQ ID No: 42): ACACAGACGAATGCAGGAGCCA;
[0084] The sq_tag22 site is an A / G mutation located at position 415891 of chromosome 9 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag22 site are:
[0085] sq_P22f (SEQ ID No: 43): TGTCTGGCACAGCCACAGCCTT,
[0086] sq_P22r(SEQ ID No:44):GGGCTGTTCCCCTTGTGTGCG;
[0087] The sq_tag23 site is a T / C mutation located at position 5995369 of chromosome 9 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag23 site are:
[0088] sq_P23f(SEQ ID No:45):GGAGTGTATGCCCCTGGTTCCTCC,
[0089] sq_P23r(SEQ ID No:46):TTGGCAGTGGGGCTGATACCT;
[0090] The sq_tag24 site is a C / A mutation located at position 687812 of chromosome 11 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. The base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag24 site are:
[0091] sq_P24f(SEQ ID No:47):GCATGGATCTGTTTCCAGTGCAGC,
[0092] sq_P24r(SEQ ID No:48):TCCTCCCTCAGAGTCCTTTGCT;
[0093] The sq_tag25 site is a G / A mutation located at position 31080652 of chromosome 11 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag25 site are:
[0094] sq_P25f (SEQ ID No: 49): TGGCTGAATACCTGGAAGCTGGGG,
[0095] sq_P25r(SEQ ID No:50):ACGCATGCAAGGGCAAAGTGCT;
[0096] The sq_tag26 site is a T / C mutation located at position 15095086 of chromosome 16 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag26 site are:
[0097] sq_P26f(SEQ ID No:51):GGCAGCTCGTGAGAGCAGGCA,
[0098] sq_P26r(SEQ ID No:52):AGTGCTCAACCACAGGTTCCCCT;
[0099] The sq_tag27 site is a G / A mutation located at position 12075890 of chromosome 22 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag27 site are:
[0100] sq_P27f(SEQ ID No:53):TCAGCAAGCCTGGCAAGAGGAGAA,
[0101] sq_P27r(SEQ ID No:54):ACACAGCAGGACTGTGGGGCA;
[0102] The sq_tag28 site is a C / T mutation located at position 5161735 of chromosome 23 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. This base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag28 site are:
[0103] sq_P28f(SEQ ID No:55):ACTTTTCTCACTTCAGCTCCCCTGT,
[0104] sq_P28r(SEQ ID No:56):ACCTGAGCGTTTCCTTTTAGGCTGT;
[0105] The sq_tag29 site is a T / C mutation located at position 5119132 of chromosome 25 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag29 site are:
[0106] sq_P29f (SEQ ID No: 57): TCCCTTGGGTCTGGCTTGCAG,
[0107] sq_P29r (SEQ ID No: 58): AGCTCCATCACTGAACAGCTTCACA;
[0108] The sq_tag30 site is a T / A mutation located at position 7447512 of chromosome 25 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag30 site are:
[0109] sq_P30f(SEQ ID No:59):GGGTGGGTGGGCAGTTAAGGGG,
[0110] sq_P30r(SEQ ID No:60):TGTCCCACTCCAGGTCCAGCAGA;
[0111] The sq_tag31 site is an A / C mutation located at position 15848385 of chromosome 25 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag31 site are:
[0112] sq_P31f(SEQ ID No:61):ACTGGGCAGGACAAGCCTGAAC,
[0113] sq_P31r(SEQ ID No:62):CCTGCAACGCAAAGGAAGGAAGCA;
[0114] The sq_tag32 site is a T / C mutation located at position 2599218 of chromosome 26 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag32 site are:
[0115] sq_P32f (SEQ ID No: 63): AATTTGGCTGCTCTGCAGTTTGGC,
[0116] sq_P32r (SEQ ID No: 64): ACCTGGCGAGATTTGGCTTTCCGT;
[0117] The sq_tag33 site is a G / A mutation located at position 3700510 of chromosome 27 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag33 site are:
[0118] sq_P33f (SEQ ID No: 65): ACACGGCCACACAACAGTATCCC,
[0119] sq_P33r (SEQ ID No: 66): GCCAGGGCGGCCATCTTTGT;
[0120] The sq_tag34 site is a C / G mutation located at position 9898674 of chromosome 27 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. This base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag34 site are:
[0121] sq_P34f (SEQ ID No: 67): ACTGGAGCAGCATGCAACAAACCCA, sq_P34r (SEQ ID No: 68): GGATGCAGCGTCTTCCTCCAAGGG;
[0122] The sq_tag35 site is an A / G mutation located at position 9921138 of chromosome 27 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag35 site are:
[0123] sq_P35f(SEQ ID No:69):CCACAAGCCTGCCCAAGCCCA,
[0124] sq_P35r (SEQ ID No:70): AGTGTATCTCCAACAACGTGGTGCC;
[0125] The sq_tag36 site is a T / C mutation located at position 16395889 of chromosome 27 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag36 site are:
[0126] sq_P36f(SEQ ID No:71):GTCCCTCCGGCTCCGGTCCCCT,
[0127] sq_P36r(SEQ ID No:72):AGCCCGCACTGCCACAGCTCCA;
[0128] The sq_tag37 site is a G / A mutation located at position 16811788 of chromosome 27 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag37 site are:
[0129] sq_P37f (SEQ ID No:73): CGGGACGGGTCACCTCGGGAA,
[0130] sq_P37r(SEQ ID No:74):CACGCAGCTTTCTACATCACCGCAA;
[0131] The sq_tag38 site is a G / A mutation located at position 2167347 of chromosome 28 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag38 site are:
[0132] sq_P38f(SEQ ID No:75): CCGCCAGTACTTGCAGCCGGGA,
[0133] sq_P38r(SEQ ID No:76):CAGGCCACTGACGGGCGGGA;
[0134] The sq_tag39 site is an A / G mutation located at position 3077457 of chromosome 28 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag39 site are:
[0135] sq_P39f (SEQ ID No:77): GCCTTGAGGTCTGCCAGCTCCCCCC,
[0136] sq_P39r(SEQ ID No:78):TGCCAGAGCCCAACAGAAACACCCT;
[0137] The sq_tag40 site is a G / A mutation located at position 8395635 of chromosome 30 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag40 site are:
[0138] sq_P40f (SEQ ID No: 79): ACACTGAAACACTTGTCGGGGTGA, sq_P40r (SEQ ID No: 80): CCCGCTCGTTGTGTCTGGGACTCCA;
[0139] The sq_tag41 site is a C / T mutation located at position 1667143 of chromosome 31 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. This base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag41 site are:
[0140] sq_P41f(SEQ ID No:81):CCCAGGTCCCAAGAGGAGGTGTAG,
[0141] sq_P41r(SEQ ID No:82):AGCTCTGGCAGGGGCACTTCA;
[0142] The sq_tag42 site is a G / C mutation located at position 9460737 of chromosome 31 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. This base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag42 site are:
[0143] sq_P42f(SEQ ID No:83):GCTGGGAAACCTCCAGTGTGCTGCC,
[0144] sq_P42r (SEQ ID No:84):TGGCTGCAGCTCCATTCAGGCAA;
[0145] The sq_tag43 site is a C / G mutation located at position 4518546 of chromosome 32 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. This base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag43 site are:
[0146] sq_P43f(SEQ ID No:85):ACTGTGCCCCCAGCCGTGCCAG,
[0147] sq_P43r(SEQ ID No:86):GGATGCAGCCCTCAGCACCCCT;
[0148] The sq_tag44 site is a T / C mutation located at position 8517446 of chromosome 32 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag44 site are:
[0149] sq_P44f(SEQ ID No:87):GACTCCGGCCATCCACCCGCA,
[0150] sq_P44r (SEQ ID No:88): TCCGTGGCTGGTGTTACCTGTGTCC;
[0151] The sq_tag45 site is a T / G mutation located at position 4376601 of chromosome 33 in the pigeon genome GCA_028654425.1. When the base at this site is T, it can be determined to be a Shiqi pigeon breed. The base T is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag45 site are:
[0152] sq_P45f (SEQ ID No:89): TTGGCCAGCACCCGGGACAGCC,
[0153] sq_P45r (SEQ ID No:90): AGCCCAGCGGCACCTCCACTCC;
[0154] The sq_tag46 site is a G / C mutation located at position 6946030 of chromosome 33 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. This base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag46 site are:
[0155] sq_P46f (SEQ ID No:91): CCTGCGGGCGCCAGAGGAGAACG,
[0156] sq_P46r(SEQ ID No:92):CAGCCTCGGAGCCCTTGGCCGT;
[0157] The sq_tag47 site is an A / C mutation located at position 6948563 of chromosome 33 in the pigeon genome GCA_028654425.1. When the base at this site is A, it can be determined to be a Shiqi pigeon breed. The base A is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag47 site are:
[0158] sq_P47f(SEQ ID No:93):ACCTGCCCTCGGGCGCCTTCT,
[0159] sq_P47r (SEQ ID No:94):GAGCGAGCGTCCCGTTGCCTCCC;
[0160] The sq_tag48 site is a C / A mutation located at position 6956676 of chromosome 33 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. The base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag48 site are:
[0161] sq_P48f(SEQ ID No:95):GCCATCAGCAAGGCTGGCTACTCCT,
[0162] sq_P48r(SEQ ID No:96):TGCTGCAGCCACGTACTACCCACC;
[0163] The sq_tag49 site is a C / G mutation located at position 6064675 of chromosome 34 in the pigeon genome GCA_028654425.1. When the base at this site is C, it can be determined to be a Shiqi pigeon breed. This base C is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag49 site are:
[0164] sq_P49f(SEQ ID No:97): CCGCCGCACCTGCATGGCTTT,
[0165] sq_P49r (SEQ ID No:98): TTCTGGCAGACTCCTGGCGTGTGT;
[0166] The sq_tag50 site is a G / A mutation located at position 735599 of chromosome 40 in the pigeon genome GCA_028654425.1. When the base at this site is G, it can be determined to be a Shiqi pigeon breed. The base G is a Shiqi pigeon breed-specific base. The primers used to detect the sq_tag50 site are:
[0167] sq_P50f(SEQ ID No:99):ATGCCCTCGGGCGCTGGTGCTG,
[0168] sq_P50r(SEQ ID No:100):GGAGCAGGAGGGGGTCGGAGGT.
[0169] To verify the effectiveness of the 50 SNPs in identifying Shiqi pigeon breeds, we selected different breeds of pigeons for testing, including the European meat pigeon Mimas, the white Canu pigeon, the Shiqi pigeon (white feather line), the Shiqi pigeon (gray feather line), the Silver King pigeon, and the White King pigeon. The experimental process is as follows:
[0170] 1. DNA Extraction: DNA was extracted from pigeon blood samples using the DC112 Blood Genomic DNA Extraction Kit (Nanjing Novozymes Biotechnology Co., Ltd.) according to the manufacturer's instructions. DNA integrity was verified by agarose gel electrophoresis, and DNA concentration and OD values were determined using a Qubit 4.0. DNA extracts that passed the concentration and OD tests were immediately stored at -20°C until further use.
[0171] 2. Standard Multiplex PCR: PCR reaction system: 8.5 μl of DNA sample, 10 μl of Multiplex PCR primer mix (primer powder diluted with water, mixed at a concentration of 0.2 μM each), 31.5 μl of 2X Multiplex Mix. Reaction conditions: 98°C for 2 min; 98°C for 15 sec, 65°C for 4 min, 20 cycles (decreasing 0.5°C each cycle, ultimately from 65°C to 55°C); 98°C for 15 sec, 55°C for 4 min, 7 cycles; 72°C for 5 min; 4°C. Multiplex PCR primers are mixed primers for detecting sq_tag1-50 sites. Specific sequences are shown in SEQ ID Nos: 1-100.
[0172] 3. Compare the detected SNPs results with the above 50 SNP sites, and record the number of SNP sites where the bases at the sites are different from the Shiqi pigeon breed-specific bases.
[0173] 4. Experimental results: The results and statistical data of the detection of the above 50 SNP sites in six pigeon breeds, namely, European meat pigeon Mimas, White Canu pigeon, Shiqi pigeon (white feather line), Shiqi pigeon (gray feather line), Silver King pigeon, and White King pigeon, are shown in Tables 1-3.
[0174] In order to analyze different pigeon breeds, the above 50 SNP sites were detected and the number of SNP sites with differences in Shiqi pigeon breed-specific bases was counted. The results are shown in Table 1:
[0175]
[0176]
[0177] The results in Table 1 show that among non-Shiqi pigeon breeds (European meat pigeons Mimas, White Canoes, Silver Kings, and White Kings), the minimum number of SNPs with differences is 3 and the maximum is 22. In contrast, among Shiqi pigeon breeds (including white and gray lines), the minimum number of SNPs with differences is 0 and the maximum is 3. This suggests that 3 SNPs with differences may be a critical value.
[0178] To further determine the criteria for Shiqi pigeon breeds, statistics were conducted on the number of SNP sites with differences of 0, 1, 2, and ≥3 among six pigeon breeds: European meat pigeon Mimas, White Canu pigeon, Shiqi pigeon (white feather line), Shiqi pigeon (gray feather line), Silver King pigeon, and White King pigeon. The results are shown in Table 2:
[0179]
[0180] It can be seen from Table 2 that: in non-Shiqi pigeon breeds (European meat pigeon Mimas, white Canu pigeon, silver king pigeon, white feather king pigeon), the number of pigeons with the number of SNP loci with differences <3 (0, 1, 2) is 0, and all are ≥3; in Shiqi pigeons (white feather system), the number of pigeons with the number of SNP loci with differences of 0 is 18, the number of pigeons with the number of SNP loci with differences of 1 is 22, the number of pigeons with the number of SNP loci with differences of 2 is 8, and the number of pigeons with the number of SNP loci with differences of ≥3 is 0; in Shiqi pigeons (gray feather system), the number of pigeons with the number of SNP loci with differences of 0 is 27, the number of pigeons with the number of SNP loci with differences of 1 is 11, the number of pigeons with the number of SNP loci with differences of 2 is 16, and the number of pigeons with the number of SNP loci with differences of ≥3 is 2. Therefore, it can be concluded that the above 50 molecular markers (sq_tag1-50) are tested, and the number of SNP sites whose bases at the test sites are different from the Shiqi pigeon breed-specific bases is recorded: when the number of SNP sites that are different from the Shiqi pigeon breed-specific bases is less than 3, it can be determined to be the Shiqi pigeon breed; when the number of SNP sites with differences is between 3-5, it is uncertain whether it is the Shiqi pigeon breed; when the number of SNP sites with differences is greater than 5, the breed is not the Shiqi pigeon breed.
[0181] From this, we can get the method of identifying Shiqi pigeon varieties:
[0182] S1: Sampling the pigeons to be identified and extracting DNA;
[0183] S2: performing multiplex PCR on the DNA extracted in step S1, wherein the multiplex PCR primers are mixed primers with sequences as shown in SEQ ID No: 1-100;
[0184] S3: Sequencing the multiplex PCR test results to determine the bases at the sites of the 50 molecular markers (sq_tag1-50 SNP sites);
[0185] S4: Record the number of SNP sites where the bases at the site are different from the Shiqi pigeon breed-specific bases: When the number of SNP sites that are different from the Shiqi pigeon breed-specific bases is less than 3, it can be determined to be the Shiqi pigeon breed; when the number of SNP sites with differences is between 3-5, it is uncertain whether it is the Shiqi pigeon breed; when the number of SNP sites with differences is greater than 5, the breed is not the Shiqi pigeon breed.
[0186] Using this method for identifying Shiqi pigeon varieties, the detection data in Table 2 were further analyzed to determine the detection rate of Shiqi pigeon varieties. The results are shown in Table 3:
[0187]
[0188] As shown in Table 3, using this method for Shiqi pigeon breed identification, the detection rate for Shiqi pigeons (white-feathered strain) was 100%, the detection rate for Shiqi pigeons (gray-feathered strain) was 95.65%, and the total detection rate for Shiqi pigeons (white-feathered + gray-feathered strains) was 97.87%. The detection rates for non-Shiqi pigeon breeds (European meat pigeon Mimas, White Cano, Silver King, and White King) were all 0. This demonstrates that this Shiqi pigeon breed identification method is efficient and accurate and can be widely used for Shiqi pigeon breed identification.
[0189] In summary, the sq_tag1-50 SNP site can be used for the identification of Shiqi pigeon varieties, with a detection rate of up to 97.87%. This avoids the existing problem of judging pigeon varieties by appearance characteristics, making it difficult to distinguish between hybrid offspring or phenotypically similar impersonating varieties, and is highly subjective and relies on empirical judgment. The molecular markers disclosed in the present invention can be effectively used for the screening of specific genetic sites for the identification of Shiqi pigeon varieties, and have a good identification rate for Shiqi pigeons. Therefore, each site and combination can be effectively used for the identification of Shiqi pigeon varieties. The molecular marker containing 50 sites forms a molecular identity card for the identification of Shiqi pigeon varieties, with a high detection rate and more scientific and effective, which is convenient for large-scale promotion and use.
Claims
1. A molecular marker for identifying Shiqi pigeon varieties, wherein: The molecular markers include a G / A mutation at position 34348083 of chromosome 1 in pigeon genome GCA_028654425.1, an A / T mutation at position 43792470 of chromosome 1, a G / A mutation at position 4662968 of chromosome 2, a T / C mutation at position 4664079 of chromosome 2, a T / C mutation at position 4825319 of chromosome 2, a C / T mutation at position 18182842 of chromosome 2, a T / C mutation at position 20543785 of chromosome 2, an A / G mutation at position 21683679 of chromosome 2, a T / C mutation at position 51365077 of chromosome 2, and a T / C mutation at position 5166452 of chromosome 2. 0, G / A mutation at chromosome 4, 2274426, G / A mutation at chromosome 4, 2335380, T / C mutation at chromosome 4, 30404232, A / C mutation at chromosome 5, 5410553, A / G mutation at chromosome 5, 44048740, G / C mutation at chromosome 5, 46273012, A / G mutation at chromosome 7, 42249848, T / C mutation at chromosome 7, 31125758, T / G mutation at chromosome 8, 35833 The C / A mutation at 970, the A / G mutation at 415891 on chromosome 9, the T / C mutation at 5995369 on chromosome 9, the C / A mutation at 687812 on chromosome 11, the G / A mutation at 31080652 on chromosome 11, the T / C mutation at 15095086 on chromosome 16, the G / A mutation at 12075890 on chromosome 22, the C / T mutation at 5161735 on chromosome 23, the T / C mutation at 5119132 on chromosome 25, the T / A mutation at 7447512 on chromosome 25, the A / C mutation at 15848385 on chromosome 26 T / C mutation at No. 2599218, G / A mutation at No. 3700510 on chromosome 27, C / G mutation at No. 9898674 on chromosome 27, A / G mutation at No. 9921138 on chromosome 27, T / C mutation at No. 16395889 on chromosome 27, G / A mutation at No. 16811788 on chromosome 27, G / A mutation at No. 2167347 on chromosome 28, A / G mutation at No. 3077457 on chromosome 28, G / A mutation at No. 8395635 on chromosome 30, C / T mutation at No. 1667143 on chromosome 31, G / C mutation at No. 9460737 on chromosome 31,T / G mutation at chromosome 32, 4518546; T / C mutation at chromosome 32, 8517446; T / G mutation at chromosome 33, 4376601; G / C mutation at chromosome 33, 6946030; A / C mutation at chromosome 33, 6948563; C / A mutation at chromosome 33, 6956676; C / G mutation at chromosome 34, 6064675; G / A mutation at chromosome 40, 735599.
2. Application of the molecular marker described in claim 1 in identifying Shiqi pigeon varieties.
3. Use of the product for detecting the molecular markers described in claim 1 in identifying Shiqi pigeon varieties.
4. The use according to claim 3, wherein The product comprises a probe, primer or kit capable of detecting the molecular marker described in claim 1.
5. The use according to claim 4, wherein The primers are mixed primers whose sequences are shown as SEQ ID No: 1-100.
6. A method for identifying Shiqi pigeon varieties, wherein: The method comprises the following steps: S1: Sampling the pigeons to be identified and extracting DNA; S2: performing multiplex PCR on the DNA extracted in step S1, wherein the multiplex PCR primers are mixed primers with sequences as shown in SEQ ID No: 1-100; S3: Sequencing the multiplex PCR test results to determine the bases at the sites where the molecular markers described in claim 1 are located; S4: Record the number of SNP sites where the bases at the site are different from the Shiqi pigeon breed-specific bases: When the number of SNP sites that are different from the Shiqi pigeon breed-specific bases is less than 3, it can be determined to be the Shiqi pigeon breed; when the number of SNP sites with differences is between 3-5, it is uncertain whether it is the Shiqi pigeon breed; when the number of SNP sites with differences is greater than 5, the breed is not the Shiqi pigeon breed.
7. The method according to claim 6, wherein: The Shiqi pigeon breed-specific bases include the G base at 34348083 of chromosome 1 in the pigeon genome GCA_028654425.1, the A base at 43792470 of chromosome 1, the G base at 4662968 of chromosome 2, the T base at 4664079 of chromosome 2, the T base at 4825319 of chromosome 2, the C base at 18182842 of chromosome 2, the T base at 20543785 of chromosome 2, the A base at 21683679 of chromosome 2, the T base at 51365077 of chromosome 2, the G base at 51664520 of chromosome 2, the G base at 274426, T base at 2335380 on chromosome 4, C base at 30404232 on chromosome 4, A base at 5410553 on chromosome 5, A base at 21857219 on chromosome 5, G base at 44048740 on chromosome 5, A base at 46273012 on chromosome 6, A base at 42249848 on chromosome 7, T base at 46224259 on chromosome 7, T base at 31125758 on chromosome 8, C base at 35833970 on chromosome 8, A base at 415891 on chromosome 9, 599 on chromosome 9 The T base at 5369 on chromosome 11, the C base at 687812 on chromosome 11, the G base at 31080652 on chromosome 11, the T base at 15095086 on chromosome 16, the G base at 12075890 on chromosome 22, the C base at 5161735 on chromosome 23, the T base at 5119132 on chromosome 25, the T base at 7447512 on chromosome 25, the A base at 15848385 on chromosome 25, the T base at 2599218 on chromosome 26, the G base at 3700510 on chromosome 27, the C base at 9898674 on chromosome 27, A base at chromosome 9921138, T base at chromosome 27, G base at chromosome 16811788, G base at chromosome 28, A base at chromosome 28, G base at chromosome 30, C base at chromosome 31, G base at chromosome 9460737, C base at chromosome 32, T base at chromosome 32, T base at chromosome 33, G base at chromosome 6946030,The A base at position 6948563 on chromosome 33, the C base at position 6956676 on chromosome 33, the C base at position 6064675 on chromosome 34, and the G base at position 735599 on chromosome 40.
8. The method according to claim 6, wherein: The concentration of each primer was 0.2 μM.
9. Application of the method described in any one of claims 6 to 8 in Shiqi pigeon variety identification.
10. A primer for Shiqi pigeon variety identification, wherein: The primers are mixed primers whose sequences are shown as SEQ ID No: 1-100.
Citation Information
Patent Citations
Application and method of reagent for detecting SNP (Single Nucleotide Polymorphism) molecular marker related to pigeon breast muscle weight
CN117363746A
STR (short tandem repeat) fluorescent multiplex amplification kit for pigeon individual recognition
CN120026117A
Pigeon whole genome 5K liquid chip as well as preparation method and application thereof
CN120193088A
SNP markers for meat quality trait evaluation or breeding of meat pigeons and their applications
LU508954B1