Guiding RNA targeting TRAC gene and methods of use

Abstract

The present invention provides compositions and methods for binding a target sequence in the T cell receptor alpha chain constant (TRAC) gene. Compositions comprise CRISPR RNA, guide RNA, and nucleic acid molecules encoding them. Also provided are vectors and host cells comprising the nucleic acid molecules. Further provided is an RNA-guided nuclease (RGN) system for binding to a target sequence in a TRAC gene, wherein the RGN system comprises an RNA-guided nuclease polypeptide and one or more guide RNAs. The compositions can be used to cleave or modify a target sequence of the TRAC gene, and / or to modify expression of the TRAC gene.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 63 / 387,889, filed on December 16, 2022, which is incorporated herein by reference in its entirety.

[0003] Reference to a sequence listing submitted electronically as an XML file

[0004] This application contains a sequence listing, which has been submitted by the USPTO Patent Center in xml format and is incorporated herein by reference in its entirety. The xml copy created on December 7, 2023 is named L103438_1360PCT_0253_3_SL and is 1.15MB in size. Technical Field

[0005] The present invention relates to the fields of molecular biology and gene editing. Background Art

[0006] T cells are white blood cells that work in the adaptive immune system to attack and destroy foreign molecules, pathogens and / or tumors. This function of T cells is partly helped by the presence of T cell receptor (TCR) molecules on its surface. TCR can be combined with a fragment of foreign peptides presented by cells encountering foreign entities (such as viruses), and this interaction allows T cells to detect and resist foreign molecules. The most common TCR type is composed of α chain and β chain. Each of α and β chains contains variable region and constant region, and variable region works in binding antigen. There is a single gene encoding T cell receptor α chain constant (TRAC) region.

[0007] However, the presence of endogenous TCRs can pose a challenge to developing donor-derived T cells that are needed to target pathogens or tumors in the recipient. TCRs can cause attacks on non-targeted recipient tissues, a condition known as graft-versus-host disease (GvHD). Among other advantages, the ability to reduce or knock out TCR components such as TRACs would be invaluable in preventing or reducing GvHD.

[0008] Targeted genome editing or modification is rapidly becoming an important tool for basic and applied research because it allows the genome to be modified, such as cutting nucleic acids, deleting nucleic acids, inserting nucleic acids, replacing nucleotides in nucleic acids and regulating gene expression at a specific position in the genome, as well as many other possible modifications. The initial efforts of genome editing involved designing nucleases, i.e., proteins capable of editing nucleic acids, to recognize and specifically bind to target nucleic acid sequences to be edited. However, engineering nucleases requires considerable time and experiments to obtain nucleases that are effective for editing specific sequences. Genome editing systems using RNA-guided nucleases, such as clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) proteins of the CRISPR-Cas bacterial system, work by combining nucleases with guide RNAs. Hybridization of guide RNAs with specific target sequences allows editing at a specific position in the genome. Therefore, genome editing systems using RNA-guided nucleases can be lower cost and more effective for editing genomic sequences because nucleic acids can generally be more easily designed and redesigned than nucleases.

[0009] Therefore, regulation of TRAC expression would benefit from the development of RNA-guided nuclease systems that can target specific regions of the TRAC gene for binding, cleavage, and / or modification. Summary of the Invention

[0010] The present invention provides compositions and methods for binding to target sequences in T cell receptor alpha chain constant (TRAC) genes. The composition can be used to modify TRAC genes at specific regions. Compositions include CRISPR RNA (crRNA), transactivated CRISPR RNA (tracrRNA), single guide RNA (sgRNA), dual guide RNA (dgRNA), RNA-guided nuclease (RGN) polypeptides, nucleic acid molecules encoding them, compositions comprising them, and vectors and host cells comprising nucleic acid molecules. The present invention also provides RGN systems and ribonucleoprotein complexes for binding to target sequences in TRAC genes, wherein the RGN systems and ribonucleoprotein complexes include RGN polypeptides and one or more guide RNAs. Therefore, methods disclosed herein relate to binding to target sequences in TRAC genes, and in some embodiments, cutting or modifying target sequences in TRAC genes. TRAC genes can be modified, for example, as a result of non-homologous end connection after target sequence cutting and knocked out. In some embodiments, the target sequence in TRAC genes is cut, and donor polynucleotides are inserted at the cutting site.

[0011] In one aspect, the present disclosure provides a guide RNA (gRNA) comprising a CRISPR RNA (crRNA) and a transactivating CRISPR RNA (tracrRNA), wherein the crRNA comprises (i) a crRNA repeat sequence; and (ii) a spacer, wherein the tracrRNA comprises: (iii) an anti-repeat sequence; and (iv) a tail, wherein the gRNA comprises a first stem-loop formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, wherein the spacer is capable of hybridizing to a target sequence in a T cell receptor alpha chain constant (TRAC) gene, wherein the target sequence has the sequence of SEQ ID NO: , 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104. In some aspects, the target sequence that hybridizes to the spacer in the TRAC gene comprises the target strand and the non-target strand.

[0012] In some embodiments of the above aspects, the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 1 to 5 nucleotides. In some embodiments of the above aspects, the spacer region has a nucleotide sequence as set forth in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0013] In some embodiments of the above aspects, the gRNA is a single guide RNA (sgRNA) comprising a crRNA and a tracrRNA connected by a linker, wherein the sgRNA comprises a backbone and a spacer, and wherein the backbone of the sgRNA comprises a crRNA repeat sequence, a linker, and a tracrRNA. In some embodiments, the linker has a nucleotide sequence as shown in AAAG, GAAA, ACUU, or CAAAGG. In some embodiments, the linker has a nucleotide sequence as shown in AAAG. In some embodiments of the above aspects, the backbone of the sgRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides. In some embodiments of the above aspects, the backbone of the sgRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides. In some embodiments of the above aspects, the backbone of the sgRNA comprises a total length of 86 to 98 nucleotides. In some embodiments of the above aspects, the backbone of the sgRNA comprises a total length of 94 nucleotides. In some embodiments of the above aspects, the backbone of the sgRNA has a nucleotide sequence having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to any one of SEQ ID NOs: 124 to 134.

[0014] In some embodiments of the above aspects, the first stem-loop comprises a first stem and a second stem, and wherein the first stem of the first stem-loop comprises a total length of at least 3, 4, 5, 6, 7, 8, 9, 10, or 11 base pairs (bp). In some embodiments of the above aspects, the first stem of the first stem-loop comprises a total length of at most 3, 4, 5, 6, 7, 8, 9, 10, or 11 bp. In some embodiments, the first stem of the first stem-loop comprises a total length of 6 bp. In some embodiments, the first stem of the first stem-loop comprises a total length of 3 bp.

[0015] In some embodiments of the above aspects, the tail of the tracrRNA comprises a total length of at least 1, 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments of the above aspects, the tail of the tracrRNA comprises a total length of at most 1, 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments, the tail of the tracrRNA comprises a total length of 3 nucleotides. In some embodiments, the tail of the tracrRNA comprises a total length of 1 nucleotide.

[0016] In some embodiments of the above aspects, the gRNA further comprises a second stem loop proximal to the tail, wherein the second stem loop comprises a first stem and a second stem. In some embodiments of the above aspects, the first stem of the second stem loop comprises a total length of at least 1, 2, 3, 4, 5, or 6 bp. In some embodiments of the above aspects, the first stem of the second stem loop comprises a total length of at most 1, 2, 3, 4, 5, or 6 bp. In some embodiments, the first stem of the second stem loop comprises a total length of 5 bp.

[0017] In some embodiments of the above aspects, the first stem of the first stem-loop comprises a total length of 6 bp, the tail of the tracrRNA comprises a total length of 3 nucleotides, and the first stem of the second stem-loop comprises a total length of 5 bp.

[0018] In some embodiments of the above aspects, the gRNA is a dual guide RNA (dgRNA). In some embodiments of the above aspects, the crRNA repeat sequence of the dgRNA includes a total length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides. In some embodiments of the above aspects, the crRNA repeat sequence of the dgRNA includes a total length of at most 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides. In some embodiments, the crRNA repeat sequence of the dgRNA includes a total length of 13 nucleotides. In some embodiments, the crRNA repeat sequence of the dgRNA includes a total length of 16 nucleotides. In some embodiments, the crRNA repeat sequence of the dgRNA includes a total length of 21 nucleotides. In some embodiments of the above aspects, the tracrRNA of the dgRNA includes a total length of at least 65, 70, 75, 80, or 85 nucleotides. In some embodiments of the above aspects, the tracrRNA of the dgRNA comprises a total length of at most 65, 70, 75, 80, or 85 nucleotides. In some embodiments, the tracrRNA of the dgRNA comprises a total length of 74 nucleotides. In some embodiments, the tracrRNA of the dgRNA comprises a total length of 77 nucleotides.

[0019] In some embodiments of the above aspects, the gRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides. In some embodiments of the above aspects, the gRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides. In some embodiments of the above aspects, the gRNA comprises a total length of 106 to 135 nucleotides. In some embodiments of the above aspects, the gRNA comprises a total length of 117 to 119 nucleotides.

[0020] In some embodiments of the above aspects, the gRNA is capable of targeting the bound RNA-guided nuclease (RGN) polypeptide to a target sequence in the TRAC gene. In some embodiments of the above aspects, the RGN polypeptide is capable of recognizing a common protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC. In some embodiments of the above aspects, the RGN polypeptide is capable of recognizing a common protospacer adjacent motif (PAM) having a nucleotide sequence as shown in AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GGGCCCAG, T The entire protospacer-adjacent motif (PAM) of the nucleotide sequence set forth in any one of GTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG.

[0021] In some embodiments of the above aspects, the RGN polypeptide has an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 105; and wherein the target sequence and the spacer are selected from the group consisting of: a) a target sequence having the nucleotide sequence as set forth in SEQ ID NO: 8 and a spacer having the nucleotide sequence as set forth in SEQ ID NO: 7, or a nucleotide sequence that differs from SEQ ID NO: 7 in length and / or sequence by 1 to 5 nucleotides; and b) a target sequence having the nucleotide sequence as set forth in SEQ ID NO: 10 and a spacer having the nucleotide sequence as set forth in SEQ ID NO: 9, or a nucleotide sequence that differs from SEQ ID NO: 9 in length and / or sequence by 1 to 5 nucleotides.

[0022] In some embodiments of the above aspects, the spacer region has a nucleotide sequence as shown in SEQ ID NO: 7 or 9.

[0023] In some embodiments of the above aspects, the RGN polypeptide has an amino acid sequence as set forth in SEQ ID NO: 105. In some embodiments of the above aspects, the crRNA repeat sequence has a nucleotide sequence as set forth in SEQ ID NO: 106, or a nucleotide sequence that differs from SEQ ID NO: 106 in length and / or sequence by 1 to 8 nucleotides. In some embodiments of the above aspects, the crRNA repeat sequence has a nucleotide sequence as set forth in any one of SEQ ID NOs: 106, 109 to 112, 328, 331, and 334. In some embodiments of the above aspects, the crRNA has a nucleotide sequence as set forth in any one of SEQ ID NOs: 136 to 197. In some embodiments of the above aspects, the tracrRNA has a nucleotide sequence that has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity with SEQ ID NO: 107. In some embodiments, the tracrRNA has a nucleotide sequence as set forth in SEQ ID NO: 107. In some embodiments of the above aspects, the tracrRNA has a nucleotide sequence that differs from SEQ ID NO: 107 in length by 1 to 16 nucleotides. In some embodiments, the tracrRNA has a nucleotide sequence that is 8 nucleotides shorter than SEQ ID NO: 107. In some embodiments, the tracrRNA has a nucleotide sequence that is 11 nucleotides shorter than SEQ ID NO: 107. In some embodiments of the above aspects, the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335.

[0024] In some embodiments of the above aspects, the RGN polypeptide has an amino acid sequence that has at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to SEQ ID NO: 327 or 330. In some embodiments, the RGN polypeptide has an amino acid sequence as set forth in SEQ ID NO: 327 or 330. In some embodiments of the above aspects, the RGN polypeptide has an amino acid sequence that has at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to SEQ ID NO: 333. In some embodiments, the RGN polypeptide has an amino acid sequence as set forth in SEQ ID NO: 333. In some embodiments of the above aspects, the gRNA has a nucleotide sequence as set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259. In some embodiments, the gRNA has a nucleotide sequence as set forth in SEQ ID NO: 204 or 205.

[0025] In some embodiments of the above aspects, the gRNA comprises at least one chemical modification. In some embodiments, the at least one chemical modification comprises a bridged nucleic acid (BNA) modification; a 2'-O-methyl (2'-O-Me) modification; a 2'-O-methoxy-ethyl (2'MOE) modification; a 2'-fluoro (2'-F) modification; a 2'F-4'Cα-OMe modification; a 2',4'-di-Cα-OMe modification; a 2'-O-methyl 3' phosphorothioate (MS) modification; a 2'-O-methyl 3' phosphonothioate (MSP) modification; a 2'-O-methyl 3' phosphonoacetate (MP) modification; a phosphorothioate (PS) modification; or a combination thereof. In some embodiments, the BNA comprises a 2',4' BNA modification. In some embodiments, the 2',4'BNA modification is selected from the group consisting of locked nucleic acid (LNA) modification, BNANC[N-Me] modification, 2'-O,4'-C-ethylene bridged nucleic acid (2',4'-ENA) modification, and S-constrained ethyl (cEt) modification. In some embodiments, the 2',4'BNA is LNA modified. In some embodiments, the 2',4'BNA is cEt modified. In some embodiments, at least one chemical modification comprises BNA modification, 2'-O-Me modification, PS modification, or a combination thereof.

[0026] In some embodiments, at least one chemical modification comprises a 2'-O-methyl 3' phosphorothioate (MS) modification at the three terminal nucleotides of the 5' region and the three terminal nucleotides of the 3' region of the gRNA. In some embodiments of the above aspects, the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 430, 432 to 435, 583, 585, and 587. In some embodiments of the above aspects, the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 459 to 520. In some embodiments of the above aspects, the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 431, 437 to 446, 584, 586, and 588. In some embodiments of the above aspects, the gRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582.

[0027] In some embodiments of the above aspects, the gRNA further comprises an extension region comprising an editing template for reverse transcriptase (RT) editing.

[0028] In another aspect, the present disclosure provides a guide RNA (gRNA) comprising a CRISPR RNA (crRNA) and a transactivating CRISPR RNA (tracrRNA), wherein the crRNA comprises: (i) a crRNA repeat sequence; and (ii) a spacer, wherein the tracrRNA comprises: (iii) an anti-repeat sequence; and (iv) a tail, wherein the spacer has a sequence as shown in SEQ ID 99, 101, and 103, or a nucleotide sequence having the same length and / or sequence as SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103. 99, 101, and 103.

[0029] In some embodiments of the above gRNA aspects, the spacer region has a nucleotide sequence as shown in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 and 103. In some embodiments of the above gRNA aspects, the spacer is capable of hybridizing to a target sequence as set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

[0030] In another aspect, the present disclosure provides a nucleic acid molecule comprising a CRISPR RNA (crRNA) or encoding a crRNA, wherein the crRNA comprises a spacer and a crRNA repeat sequence, wherein the spacer is capable of hybridizing to a target sequence in a T cell receptor alpha chain constant (TRAC) gene, and wherein the target sequence has a nucleotide sequence as shown in any one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

[0031] In some embodiments of the nucleic acid molecule, the spacer region has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 1 to 5 nucleotides. In some embodiments, the spacer has a nucleotide sequence as set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0032] In some embodiments of nucleic acid molecules, crRNA is capable of binding to trans-activated CRISPR RNA (tracrRNA) to form a guide RNA (gRNA), wherein tracrRNA includes an anti-repeat sequence and a tail. In some embodiments of nucleic acid molecules, gRNA is a single guide RNA (sgRNA) comprising crRNA and tracrRNA connected by a joint, wherein sgRNA includes a backbone and a spacer, and wherein the backbone of sgRNA includes crRNA repeats, a joint and tracrRNA. In some embodiments, the backbone of sgRNA includes a total length of 86 to 98 nucleotides. In some embodiments, the backbone of sgRNA includes a total length of 94 nucleotides. In some embodiments of nucleic acid molecules, the backbone of sgRNA has a nucleotide sequence with SEQ ID NO: 124 to 134 having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity or 100% sequence identity.

[0033] In some embodiments of nucleic acid molecules, the gRNA comprises a first stem loop comprising a first stem and a second stem formed by hybridization of crRNA repeats and anti-repeat sequences, wherein the first stem of the first stem loop comprises a total length of at least 3, 4, 5, 6, 7, 8, 9, 10, or 11 bp. In some embodiments of nucleic acid molecules, the gRNA comprises a first stem loop comprising a first stem and a second stem formed by hybridization of crRNA repeats and anti-repeat sequences, wherein the first stem of the first stem loop comprises a total length of at most 3, 4, 5, 6, 7, 8, 9, 10, or 11 bp. In some embodiments, the first stem of the first stem loop comprises a total length of 6 bp. In some embodiments, the first stem of the first stem loop comprises a total length of 3 bp.

[0034] In some embodiments of the nucleic acid molecule, the tail of the tracrRNA comprises a total length of at least 1, 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments of the nucleic acid molecule, the tail of the tracrRNA comprises a total length of at most 1, 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments, the tail of the tracrRNA comprises a total length of 3 nucleotides. In some embodiments, the tail of the tracrRNA comprises a total length of 1 nucleotide.

[0035] In some embodiments of the nucleic acid molecule, the gRNA further comprises a second stem loop proximal to the tail, wherein the second stem loop comprises a first stem and a second stem. In some embodiments of the nucleic acid molecule, the first stem of the second stem loop comprises a total length of at least 1, 2, 3, 4, 5, or 6 bp. In some embodiments of the nucleic acid molecule, the first stem of the second stem loop comprises a total length of at most 1, 2, 3, 4, 5, or 6 bp. In some embodiments, the first stem of the second stem loop comprises a total length of 5 bp.

[0036] In some embodiments of the nucleic acid molecule aspect, the first stem of the first stem-loop comprises a total length of 6 bp, the tail of the tracrRNA comprises a total length of 3 nucleotides, and the first stem of the second stem-loop comprises a total length of 5 bp.

[0037] In some embodiments of the nucleic acid molecule, the gRNA is a dual guide RNA (dgRNA). In some embodiments of the above aspects, the crRNA repeat sequence comprises a total length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides. In some embodiments of the nucleic acid molecule, the crRNA repeat sequence comprises a total length of at most 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides. In some embodiments, the crRNA repeat sequence comprises a total length of 13 nucleotides. In some embodiments, the crRNA repeat sequence comprises a total length of 16 nucleotides. In some embodiments, the crRNA repeat sequence comprises a total length of 21 nucleotides. In some embodiments of the nucleic acid molecule, the tracrRNA comprises a total length of at least 65, 70, 75, 80, or 85 nucleotides. In some embodiments of the nucleic acid molecule, the tracrRNA comprises a total length of at most 65, 70, 75, 80, or 85 nucleotides. In some embodiments, the tracrRNA comprises a total length of 74 nucleotides. In some embodiments, the tracrRNA comprises a total length of 77 nucleotides.

[0038] In some embodiments of the nucleic acid molecule aspect, the gRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides. In some embodiments of the nucleic acid molecule aspect, the gRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides. In some embodiments, the gRNA comprises a total length of 106 to 135 nucleotides. In some embodiments, the gRNA comprises a total length of 117 to 119 nucleotides. In some embodiments, the gRNA is capable of targeting a bound RNA-guided nuclease (RGN) polypeptide to a target sequence.

[0039] In some embodiments of the nucleic acid molecule, the gRNA is capable of binding to an RGN polypeptide that is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC. In some embodiments of the nucleic acid molecule, the gRNA is capable of binding to an RGN polypeptide that is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC. In some embodiments of the nucleic acid molecule, the gRNA is capable of binding to an RGN polypeptide that is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, G The entire protospacer-adjacent motif (PAM) of the nucleotide sequence set forth in any one of GGCCCAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG.

[0040] In some embodiments of the nucleic acid molecule aspect, the RGN polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 105; and wherein the target sequence and the spacer are selected from the group consisting of: a) a target sequence having the nucleotide sequence set forth in SEQ ID NO: 8 and a spacer having the nucleotide sequence set forth in SEQ ID NO: 7, or a nucleotide sequence that differs from SEQ ID NO: 7 in length and / or sequence by 1 to 5 nucleotides; and b) a target sequence having the nucleotide sequence set forth in SEQ ID NO: 10 and a spacer having the nucleotide sequence set forth in SEQ ID NO: 9, or a nucleotide sequence that differs from SEQ ID NO: 9 in length and / or sequence by 1 to 5 nucleotides. In some embodiments, the spacer has the nucleotide sequence set forth in SEQ ID NO: 7 or 9.

[0041] In some embodiments of the nucleic acid molecule, the RGN polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 105. In some embodiments of the nucleic acid molecule, the crRNA repeat sequence has the nucleotide sequence set forth in SEQ ID NO: 106, or a nucleotide sequence that differs from SEQ ID NO: 106 in length and / or sequence by 1 to 8 nucleotides. In some embodiments of the nucleic acid molecule, the crRNA repeat sequence has the nucleotide sequence set forth in any one of SEQ ID NOs: 106, 109 to 112, 328, 331, and 334. In some embodiments of the nucleic acid molecule, the crRNA has the nucleotide sequence set forth in any one of SEQ ID NOs: 136 to 197. In some embodiments of the nucleic acid molecule, the tracrRNA has a nucleotide sequence that has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO: 107. In some embodiments, the tracrRNA has the nucleotide sequence set forth in SEQ ID NO: 107. In some embodiments of the nucleic acid molecule aspects, the tracrRNA has a nucleotide sequence that differs in length from SEQ ID NO: 107 by 1 to 16 nucleotides. In some embodiments, the tracrRNA has a nucleotide sequence that is 8 nucleotides shorter than SEQ ID NO: 107. In some embodiments, the tracrRNA has a nucleotide sequence that is 11 nucleotides shorter than SEQ ID NO: 107. In some embodiments of the nucleic acid molecule aspects, the tracrRNA has a nucleotide sequence as set forth in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335.

[0042] In some embodiments of the nucleic acid molecule aspects, the RGN polypeptide has an amino acid sequence that has at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to SEQ ID NO: 327 or 330. In some embodiments, the RGN polypeptide has an amino acid sequence as set forth in SEQ ID NO: 327 or 330. In some embodiments of the nucleic acid molecule aspects, the RGN polypeptide has an amino acid sequence that has at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to SEQ ID NO: 333. In some embodiments, the RGN polypeptide has an amino acid sequence as set forth in SEQ ID NO: 333. In some embodiments of the nucleic acid molecule aspects, the gRNA has a nucleotide sequence as set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259. In some embodiments, the gRNA has a nucleotide sequence as set forth in SEQ ID NO: 204 or 205.

[0043] In some embodiments of nucleic acid molecules, the gRNA comprises at least one chemical modification. In some embodiments, the at least one chemical modification comprises a bridged nucleic acid (BNA) modification; a 2'-O-methyl (2'-O-Me) modification; a 2'-O-methoxy-ethyl (2'MOE) modification; a 2'-fluoro (2'-F) modification; a 2'F-4'Cα-OMe modification; a 2',4'-di-Cα-OMe modification; a 2'-O-methyl 3'phosphorothioate (MS) modification; a 2'-O-methyl 3'phosphonothioate (MSP) modification; a 2'-O-methyl 3'phosphonoacetate (MP) modification; a phosphorothioate (PS) modification; or a combination thereof. In some embodiments, the BNA comprises a 2',4'BNA modification. In some embodiments, the 2',4'BNA modification is selected from the group consisting of locked nucleic acid (LNA) modification, BNANC[N-Me] modification, 2'-O,4'-C-ethylene bridged nucleic acid (2',4'-ENA) modification, and S-constrained ethyl (cEt) modification. In some embodiments, the 2',4'BNA is LNA modified. In some embodiments, the 2',4'BNA is cEt modified. In some embodiments, at least one chemical modification comprises BNA modification, 2'-O-Me modification, PS modification, or a combination thereof.

[0044] In some embodiments, at least one chemical modification comprises a 2'-O-methyl 3' phosphorothioate (MS) modification at the three terminal nucleotides of the 5' region and the three terminal nucleotides of the 3' region of the gRNA. In some embodiments of the nucleic acid molecule, the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 430, 432 to 435, 583, 585, and 587. In some embodiments of the nucleic acid molecule, the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 459 to 520. In some embodiments of the nucleic acid molecule, the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 431, 437 to 446, 584, 586, and 588. In some embodiments of the nucleic acid molecule, the gRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582.

[0045] In some embodiments of the nucleic acid molecule aspect, the gRNA further comprises an extension region comprising an editing template for reverse transcriptase (RT) editing.

[0046] In another aspect, the present disclosure provides a nucleic acid molecule comprising a CRISPR RNA (crRNA) or encoding a crRNA, wherein the crRNA comprises a spacer and a crRNA repeat sequence, wherein the spacer has a nucleotide sequence as shown in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103, or has a length and / or sequence similar to that of SEQ ID NO: 1. 99, 101, and 103.

[0047] In some embodiments of the aforementioned nucleic acid molecules, the spacer region has a nucleotide sequence as set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0048] In some embodiments of the aforementioned nucleic acid molecules, the spacer is capable of hybridizing to a target sequence, and wherein the target sequence has a nucleotide sequence as set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

[0049] In another aspect, the present disclosure provides a vector comprising a nucleic acid molecule as described above, wherein the nucleic acid molecule comprises a polynucleotide encoding crRNA. In some embodiments of the vector, the nucleic acid molecule further comprises a heterologous promoter operably linked to the polynucleotide encoding crRNA. In some embodiments, the heterologous promoter is an RNA polymerase III (pol III) promoter. In some embodiments of the vector, the vector further comprises a nucleic acid molecule encoding an RGN polypeptide, wherein the crRNA can bind to tracrRNA to form a guide RNA, wherein the guide RNA can bind to the RGN polypeptide. In some embodiments of the vector, the vector further comprises a promoter operably linked to the nucleic acid molecule encoding the RGN polypeptide.

[0050] In another aspect, the present disclosure provides a vector comprising a nucleic acid molecule as described above, wherein the nucleic acid molecule comprises a polynucleotide encoding crRNA, and wherein the vector further comprises a polynucleotide encoding tracrRNA. In some embodiments of the vector, the polynucleotide encoding crRNA and the polynucleotide encoding tracrRNA are operably linked to the same promoter and are encoded as sgRNA. In some embodiments of the vector, the polynucleotide encoding crRNA and the polynucleotide encoding tracrRNA are operably linked to separate promoters. In some embodiments of the vector, the vector further comprises a nucleic acid molecule encoding an RGN polypeptide, wherein crRNA can bind to tracrRNA to form a guide RNA, wherein the guide RNA can bind to an RGN polypeptide. In some embodiments of the vector, the vector further comprises a promoter operably linked to a nucleic acid molecule encoding an RGN polypeptide.

[0051] In another aspect, the present disclosure provides a cell comprising the gRNA, nucleic acid molecule or vector as described above.

[0052] In another aspect, the present disclosure provides an RNA-guided nuclease (RGN) system for binding to a target sequence within a T cell receptor alpha chain constant (TRAC) gene, wherein the RGN system comprises: a) one or more gRNAs as described above, or one or more polynucleotides comprising one or more nucleotide sequences encoding one or more gRNAs as described above; and b) an RGN polypeptide, or a polynucleotide comprising a nucleotide sequence encoding an RGN polypeptide; wherein the one or more guide RNAs are capable of forming a complex with the RGN polypeptide to guide the RGN polypeptide to bind to the target sequence.

[0053] In some embodiments of the RGN system aspect, the RGN polypeptide is capable of recognizing a consensus protospacer-adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC. In some embodiments of the RGN system, the RGN polypeptide is capable of recognizing an entire PAM having a nucleotide sequence as set forth in any one of AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GGGCCCAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG. In some embodiments of the RGN system, the RGN polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 105. In some embodiments of the RGN system, the RGN polypeptide has the amino acid sequence set forth in SEQ ID NO: 327. In some embodiments of the RGN system, the RGN polypeptide has the amino acid sequence set forth in SEQ ID NO: 330. In some embodiments of the RGN system, the RGN polypeptide has the amino acid sequence set forth in SEQ ID NO: 333.

[0054] In some embodiments of the RGN system, the polynucleotide comprising a nucleotide sequence encoding an RGN polypeptide comprises an mRNA. In some embodiments of the RGN system, the polynucleotide comprising a nucleotide sequence encoding an RGN polypeptide is codon-optimized for expression in mammalian cells. In some embodiments of the RGN system, at least one of the one or more nucleotide sequences encoding one or more gRNAs and the nucleotide sequence encoding the RGN polypeptide is operably linked to a promoter heterologous to the nucleotide sequence. In some embodiments of the RGN system, the one or more nucleotide sequences encoding one or more gRNAs and the nucleotide sequence encoding the RGN polypeptide are located on a single vector. In some embodiments of the RGN system, the RGN polypeptide is nuclease-inactive or a nickase. In some embodiments of the RGN system, the RGN polypeptide is fused to a base editing polypeptide. In some embodiments, the base editing polypeptide comprises a deaminase. In some embodiments of the RGN system, the RGN polypeptide is fused to a RT editing polypeptide. In some embodiments, the RT editing polypeptide comprises a DNA polymerase. In some embodiments, the DNA polymerase comprises a reverse transcriptase. In some embodiments of the RGN system, the gRNA further comprises an extension region comprising an editing template for RT editing. In some embodiments of the RGN system aspects, the RGN polypeptide comprises one or more nuclear localization signals.

[0055] In yet another aspect, the present disclosure provides a ribonucleoprotein (RNP) complex comprising one or more gRNAs and an RGN polypeptide of the RGN system as described above.

[0056] In yet another aspect, the present disclosure provides a cell comprising an RGN system or RNP complex as described above. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the mammalian cell or human cell is a T cell or an induced pluripotent stem cell.

[0057] In another aspect, the present disclosure provides a method for binding to a target sequence within a TRAC gene, the method comprising delivering an RGN system or RNP complex as described above to the target sequence or a cell comprising the target sequence. In some embodiments of the method aspects for binding to a target sequence within a TRAC gene, cleavage or modification of the target sequence occurs.

[0058] In another aspect, the present disclosure provides a method for assembling an RNA-guided nuclease (RGN) ribonucleoprotein complex, the method comprising combining the following under conditions suitable for forming the complex: a) a guide RNA as described above; and b) an RGN polypeptide that binds to the guide RNA. In some embodiments of the method for assembling, the RGN polypeptide is capable of recognizing a common protospacer adjacent motif (PAM) having a nucleotide sequence such as NNNNCC or NNRNCC. In some embodiments of the method for assembling, the complex guides cleavage of the target sequence. In some embodiments, the cleavage produces a double-strand break. In some embodiments, the cleavage produces a single-strand break.

[0059] In another aspect, the present disclosure provides a method for binding to a target sequence within a TRAC gene, the method comprising: a) combining the following under conditions suitable for forming a ribonucleoprotein (RNP) complex: i) a guide RNA as described above; and ii) an RGN polypeptide that binds to the guide RNA; thereby assembling the RNP complex; and b) contacting the target sequence or a cell comprising the target sequence with the assembled RNP complex; wherein the guide RNA hybridizes to the target sequence, thereby directing the binding of the RNP complex to the target sequence. In some embodiments of the method for binding to a target sequence within a TRAC gene, the RGN polypeptide is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence such as NNNNCC or NNRNCC. In some embodiments of the method aspects for binding to a target sequence within a TRAC gene, the RGN polypeptide is capable of recognizing a target sequence having a sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GG In some embodiments of the method aspects for binding to a target sequence within a TRAC gene, the RGN polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 105. In some embodiments of the method aspects for binding to a target sequence within a TRAC gene, the RGN polypeptide has the amino acid sequence set forth in SEQ ID NO: 327. In some embodiments of the method aspects for binding to a target sequence within a TRAC gene, the RGN polypeptide has the amino acid sequence set forth in SEQ ID NO: 330. In some embodiments of the method aspects for binding a target sequence within a TRAC gene, the RGN polypeptide has the amino acid sequence set forth in SEQ ID NO:333.

[0060] In some embodiments of the method aspects for binding to a target sequence within a TRAC gene, the method is performed in vitro or ex vivo. In some embodiments of the method aspects for binding to a target sequence within a TRAC gene, the RGN polypeptide is capable of cleaving the target sequence, thereby allowing cleavage and / or modification of the target sequence. In some embodiments, cleavage produces double-strand breaks. In some embodiments, cleavage produces single-strand breaks. In some embodiments, cleavage results in insertion of a heterologous sequence into the target sequence.

[0061] In some embodiments of the method for binding to a target sequence within a TRAC gene, the RGN polypeptide is nuclease-inactive or is a nicking enzyme. In some embodiments of the method for binding to a target sequence within a TRAC gene, the RGN polypeptide is fused to a base editing polypeptide. In some embodiments, the base editing polypeptide comprises a deaminase. In some embodiments of the method for binding to a target sequence within a TRAC gene, the RGN polypeptide is fused to a RT editing polypeptide. In some embodiments, the RT editing polypeptide comprises a DNA polymerase. In some embodiments, the DNA polymerase comprises a reverse transcriptase. In some embodiments of the method for binding to a target sequence within a TRAC gene, the gRNA further comprises an extension region comprising an editing template for RT editing.

[0062] In a further aspect, the present disclosure provides a method for regulating the expression of a T cell receptor alpha chain (TRAC) gene in a cell population, the method comprising delivering the RGN system described above or the RNP complex described above to the cell population, wherein the cell population comprises a target sequence and wherein TRAC gene expression is regulated compared to TRAC gene expression in a control cell population.

[0063] In some embodiments of the method aspects for regulating the expression of a TRAC gene, cleavage or modification of the target sequence occurs. In some embodiments, cleavage or modification of the target sequence is detected by sequencing. In some embodiments, TRAC gene expression is measured by quantitative PCR, microarray, RNA-seq, flow cytometry, immunoblotting, enzyme-linked immunosorbent assay (ELISA), protein immunoprecipitation, immunostaining, high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC / MS), mass spectrometry, or a combination thereof.

[0064] In some embodiments of the method aspects for regulating the expression of a TRAC gene, TRAC gene expression is reduced. In some embodiments, the reduction in TRAC gene expression includes a reduction in TRAC mRNA and / or TRAC protein levels. In some embodiments, the reduction in TRAC protein levels is measured by flow cytometry for detecting CD3+ cells. In some embodiments, a reduction in CD3+ cells compared to the level of CD3+ cells in a control cell population indicates a reduction in TRAC protein levels. In some embodiments, the reduction in CD3+ cells is 30% to 100%. In some embodiments, the reduction in CD3+ cells is 50% to 100%.

[0065] In some embodiments of the method aspects for modulating expression of a TRAC gene, cleavage or modification of the target sequence occurs at a rate of 40% to 100%. In some embodiments, cleavage or modification of the target sequence occurs at a rate of 80% to 100%.

[0066] In some embodiments of the method aspects for modulating expression of a TRAC gene, the control cell population has not been subjected to delivery.

[0067] In some embodiments of the method aspects for modulating expression of a TRAC gene, the cell population comprises T cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 Consistent editing with TRAC guide RNA is shown at higher doses of guide RNA (gRNA) and ribonucleoprotein (RNP) complexes of APG07433.1 RGN. The pmol represents the amount of RNA-guided nuclease (RGN), and the ratio is RGN:guide RNA. For the guides used, the doses of the RNP complex and the RGN protein:guide RNA ratios are, from left to right: 90 pmol 1:2, 90 pmol 1:3, 120 pmol 1:2, and 120 pmol 1:3.

[0069] Figure 2 Figure 2 shows TRAC guide RNA with >70% editing at TRAC in cells from different donors using APG07433.1 RGN. 60 pmol of RGN was used. The donor and RGN protein:guide RNA ratios for the guides used are, from left to right: Donor 1 (F) 1:2, Donor 1 (F) 1:3, Donor 2 (M) 1:2, Donor 2 (M) 1:3, Donor 3 (F) 1:2, and Donor 3 (F) 1:3.

[0070] Figure 3Consistently high TRAC editing using APG07433.1 RGN is shown, as measured by knockdown of the CD3 surface marker in cells from different donors. CD3+ cell % was measured using flow cytometry. For each graph and each of the control or RNP complex doses, the donors from left to right are: Donor 1, Donor 2, and Donor 3.

[0071] Figure 4 Two TRAC guide RNAs with robust editing at TRAC in cells from different donors and across a range of RNP complex dosages are shown. For each guide used, the dosage of RNP complex is from left to right: 20 pmol, 40 pmol, 60 pmol, and 80 pmol.

[0072] Figure 5 The performance of guide RNAs with two different spacers (1880 and 1881) in TRAC editing is shown, with the indicated backbone variants and spacer lengths compared to guide RNAs with a natural backbone and a 25nt spacer ('full length'). APG07433.1 RGN was used. TRAC editing was measured by knocking down CD3 surface markers in cells. Compared to the natural APG07433.1 backbone, the M backbone has: a 10nt deletion in the first stem of the stem loop 1 formed by hybridization of crRNA repeats and anti-repeat sequences; a 2nt deletion in the stem loop 3 closest to the tail of the guide RNA; and a 4nt deletion from the tail of the guide RNA. Compared to the natural APG07433.1 backbone, 94bb has a 16nt deletion in the first stem of the stem loop 1. '25', '24', and '23' represent the spacer lengths in nucleotides. The control represents a condition without RGN and gRNA, in which the cells are mixed with the nuclear transfection solution but do not undergo the nuclear transfection process. The highest editing was observed for the 1880TRAC guide RNA with a 24nt spacer and a 94nt backbone (total guide length of 118nt), and the highest editing was observed for the 1881TRAC guide RNA with a 23nt spacer and an M backbone (total guide length of 117nt). For each backbone variant, the % CD3+ cells with an 1880 spacer are on the left, and the % CD3+ cells with an 1881 spacer are on the right.

[0073] Figure 6It was shown that two truncated guide RNAs (shortened in the spacer and backbone) were effective in editing two TRAC target sites across a range of doses of the guide RNA and RNP complex of APG07433.1 RGN and in multiple donors, where TRAC editing was measured by knockdown of the CD3 surface marker in cells. All three donors showed an average of over 95% knockdown for both guides at the highest dose. The knockdown was dose-dependent. SGN3156 is a TRAC guide RNA with a 24nt spacer of 754 and a 94nt backbone. SGN6286 is a TRAC guide RNA with a 23nt spacer of 755 and an M backbone. Note that '754' and '1880' refer to the same 24nt TRAC spacer sequence in this article. Similarly, '755' and '1881' refer to the same 23nt TRAC spacer sequence in this article. For each guide used, the dose of RNP complex is from left to right: control, 20 pmol, 40 pmol, 60 pmol and 80 pmol. The control represents the condition without RGN and gRNA, in which cells were mixed with nucleofection solution but did not undergo the nucleofection process.

[0074] Figure 7 The efficacy of the SGN3156 and SGN6286 truncated TRAC guide RNAs across a range of guide RNA and RNP complexes of the APG07433.1 RGN and across multiple donors is shown as percent editing. For each guide used, the dose of the RNP complex is from left to right: 20 pmol, 40 pmol, 60 pmol, and 80 pmol.

[0075] Figure 8 Truncated TRAC guide RNAs SGN3156 and SGN6286 are shown, showing equivalent or slightly improved editing compared to the original guide RNA with a native backbone and a 25nt spacer. For each guide used, the dose of the RNP complex is from left to right: 20 pmol, 40 pmol, 60 pmol, and 80 pmol.

[0076] Figure 9 Shown are cell viability at or above 80% for most samples across multiple donors and across a range of doses of RNP complexes of truncated TRAC guide RNA and APG07433.1 RGN. For each guide used, the doses of RNP complexes are, from left to right: 20 pmol, 40 pmol, 60 pmol, and 80 pmol.

[0077] Figure 10Two major TRAC guide RNAs, SGN3156 and SGN6286, are shown to have no significant off-target modifications. For each on-target or in silico predicted off-target site, the percent edited insertion / deletion (indel) is on the left, and the percent indel for the control is on the right. The control represents a condition without RGNs and gRNAs, in which cells were mixed with the nucleofection solution but did not undergo the nucleofection process. DETAILED DESCRIPTION

[0078] Many modifications and other embodiments of the invention set forth herein will occur to those skilled in the art having the benefit of the teachings presented in the foregoing description and the associated drawings. Therefore, it should be understood that the invention is not limited to the specific embodiments disclosed, and modifications and other embodiments are intended to be included within the scope of the appended embodiments. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

[0079] I. Overview

[0080] RNA-guided nuclease (RGN) systems allow for targeted manipulation of specific sites within the genome and are useful in the context of gene targeting for therapeutic and research applications. In a variety of organisms, including mammals, RGN systems have been used for genome engineering by, for example, stimulating nonhomologous end joining and homologous recombination. The compositions and methods described herein can be used to modify the T cell receptor alpha chain constant (TRAC) gene.

[0081] The RGN system disclosed herein can bind, cleave, and / or modify a target sequence in a TRAC gene. Modification of the TRAC gene can include reducing or eliminating TRAC expression. The guide RNA of the disclosed RGN system can be engineered to be shorter than its native length and still maintain >60% editing efficiency.

[0082] The ability to reduce or knock out TCR components such as TRACs is valuable in situations where elimination of endogenous TCRs is desired, such as preventing or reducing the reactivity of donor T cells to recipient tissues in adoptive T cell transfer and / or engineering T cells with heterologous TCRs or chimeric antigen receptors.

[0083] II. Guide RNA

[0084] The present disclosure provides guide RNA, its components and the polynucleotides encoding them, which target the relevant RNA-guided nuclease (RGN) to the target nucleotide sequence in the TRAC gene. The term "guide RNA" is known in the art and generally refers to an RNA molecule (or generally a group of RNA molecules) that can bind to an RNA-guided nuclease (RGN) and help target the RGN to a specific position in a target polynucleotide (e.g., DNA or mRNA molecule). The guide RNA may include a nucleotide sequence (i.e., a spacer) with sufficient complementarity to the target nucleotide sequence to hybridize with the target sequence and instruct the sequence-specific binding of the RGN to the target nucleotide sequence. In some embodiments, when the target nucleotide sequence is double-stranded (such as in the case of DNA), the target nucleotide sequence includes a non-target chain (which includes a PAM sequence) and a target chain hybridized with the spacer of the guide RNA. In these embodiments, the target chain of the guide RNA and the double-stranded target sequence (e.g., the target DNA sequence of the TRAC gene) has sufficient complementarity so that the guide RNA hybridizes with the target chain and instructs the sequence-specific binding of the relevant RGN to the target sequence (e.g., the target DNA sequence of the TRAC gene). Thus, in some embodiments, the guide RNA includes a spacer region that is identical in sequence to the non-target strand, except that uracil (U) replaces thymidine (T) in the guide RNA.

[0085] The corresponding guide RNA of the RGN is one or more RNA molecules (usually one or two) that can bind to the RGN and guide the RGN to bind to a specific target sequence and, in those embodiments in which the RGN has nickase or nuclease activity, also cleave the target strand and / or the non-target strand. Typically, the guide RNA comprises CRISPR RNA (crRNA) and transactivating CRISPR RNA (tracrRNA).

[0086] The term "guide RNA" also generally encompasses a group of two or more RNA molecules, wherein crRNA and tracrRNA are located in separate RNA molecules. The natural guide RNA comprising both crRNA and tracrRNA generally comprises two separate RNA molecules that are hybridized to each other by the repetitive sequence of crRNA and the anti-repeating sequence of tracrRNA. In certain embodiments, crRNA and tracrRNA are linked together by a polynucleotide linker (e.g., a tetranucleotide linker) to form a single guide RNA molecule, wherein crRNA and tracrRNA are hybridized to each other by the repetitive sequence of crRNA and the anti-repeating sequence of tracrRNA. Therefore, guide RNA encompasses single guide RNA (sgRNA), wherein crRNA and tracrRNA are located in the same RNA molecule or chain. The total length of guide RNA refers to the length of the spacer and skeleton in sgRNA, or the length of crRNA and tracrRNA in dgRNA.

[0087] The guide RNA of the present disclosure may include at least one chemical modification. The at least one chemical modification includes: bridging nucleic acid (BNA) modification; 2'-O-methyl (2'-O-Me) modification; 2'-O-methoxy-ethyl (2'MOE) modification; 2'-fluoro (2'-F) modification; 2'F-4'Cα-OMe modification; 2',4'-di-Cα-OMe modification; 2'-O-methyl 3'phosphorothioate (MS) modification; 2'-O-methyl 3'phosphorothioate acetate (MSP) modification; 2'-O-methyl 3'phosphorothioate acetate (MP) modification; and phosphorothioate (PS) modification; or a combination thereof. In some embodiments, BNA includes 2',4'BNA modification. In some embodiments, 2',4'BNA modification is selected from the group consisting of locked nucleic acid (LNA) modification, BNA NC [N-Me] modification, 2'-O, 4'-C-ethylene bridged nucleic acid (2', 4'-ENA) modification and S-constrained ethyl (cEt) modification. In some embodiments, 2', 4'BNA is LNA modified. In some embodiments, 2', 4'BNA is cEt modified. In some embodiments, the at least one chemical modification includes BNA modification, 2'-O-Me modification or PS modification. The chemical modification of the spacer, crRNA repeats, crRNA, tracrRNA and guide RNA is described in International Application No. PCT / IB2023 / 058418, filed on August 25, 2023, which is incorporated herein by reference in its entirety. The at least one chemical modification may include 2'-O-methyl 3' phosphorothioate (MS) modification at the 3 terminal nucleotides of the 5' region and the 3 terminal nucleotides of the 3' region of the guide RNA. As used herein, the "5' region" of an RNA molecule disclosed herein includes the first nucleotide, the first two nucleotides, the first three nucleotides, the first four nucleotides, or the first five nucleotides at the 5' end of the RNA molecule. As used herein, the "3' region" of an RNA molecule disclosed herein includes the first nucleotide, the first two nucleotides, the first three nucleotides, the first four nucleotides, or the first five nucleotides at the 3' end of the RNA molecule. In some embodiments, in the case of a single guide RNA, the 3' region of the crRNA includes the first nucleotide, the first two nucleotides, the first three nucleotides, the first four nucleotides, or the first five nucleotides from the linker of the tracrRNA or the crRNA and tracrRNA connecting the single guide RNA.

[0088] As used herein, the term "crRNA" refers to an RNA molecule or portion thereof including a spacer (a nucleotide sequence hybridized to the target strand of a target sequence) and a CRISPR repeat sequence (i.e., a crRNA repeat sequence), wherein the CRISPR repeat sequence comprises a nucleotide sequence that forms a structure recognized by an RGN molecule alone or together with the hybridized tracrRNA. As used herein, the term "tracrRNA" or "trans-activated crRNA" refers to an RNA molecule comprising an anti-repeat sequence that has sufficient complementarity to hybridize with at least a portion of the CRISPR repeat sequence of crRNA to form a structure recognized by an RGN molecule. In some embodiments, additional secondary structures (e.g., stem-loops) within the tracrRNA molecule are required for binding to the RGN.

[0089] The present invention provides CRISPR RNA (crRNA) or the polynucleotide encoding CRISPR RNA, which targets the relevant RGN to the target sequence in the TRAC gene. CrRNA includes a spacer and a CRISPR repeat sequence." Spacer" has a nucleotide sequence that directly hybridizes with the non-target strand of the target sequence of interest (e.g., the target DNA sequence in the TRAC gene). The spacer is engineered to have complete or partial complementarity with the target strand of the target sequence of interest. In some embodiments, the spacer can include about 8 nucleotides to about 30 nucleotides or more. For example, the length of the spacer can be about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 or more nucleotides. In some embodiments, the length of the spacer is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. In some embodiments, the length of the spacer is about 10 to about 26 nucleotides, or about 12 to about 30 nucleotides in length. In some embodiments, the length of the spacer is about 30 nucleotides. In embodiments, the length of the spacer is 30 nucleotides. In some embodiments, the degree of complementarity between the spacer and the target strand of the target sequence (e.g., target DNA sequence) when optimally aligned using a suitable alignment algorithm is 50% to 99% or more, including but not limited to about or greater than about 50%, about 60%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more. In embodiments, the degree of complementarity between the spacer and the target strand of the target sequence (e.g., target DNA sequence) is 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more when optimally aligned using a suitable alignment algorithm. The spacer may be identical in sequence to the non-target strand of the target sequence. In some of those embodiments where the target sequence is a target DNA sequence, the spacer may be identical in sequence to the non-target strand of the target DNA sequence, except that thymidine (T) in the target strand is replaced by uracil (U) in the spacer.In some embodiments, the spacer contains no secondary structure, which can be predicted using any suitable polynucleotide folding algorithm known in the art, including but not limited to mFold (see, e.g., Zuker and Stiegler (1981) Nucleic Acids Res. 9: 133-148) and RNAfold (see, e.g., Gruber et al. (2008) Cell 106(1): 23-24). The spacer may comprise at least one chemical modification. In some embodiments, the spacer as part of the guide RNA comprises a 2'-O-methyl 3' phosphorothioate (MS) modification at the 3 terminal nucleotides of the 5' region of the spacer.

[0090] The crRNA disclosed herein comprises a spacer capable of targeting a bound RGN polypeptide to a target sequence in a T cell receptor alpha chain constant (TRAC) gene, wherein the target sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104. In some embodiments, the spacer region of the present disclosure has a nucleotide sequence as set forth in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103, or has a length and / or sequence similar to that of SEQ ID NO: 1. 99, 101, and 103.

[0091] In some embodiments, the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 5 nucleotides.

[0092] In some embodiments, the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 4 nucleotides.

[0093] In some embodiments, the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 3 nucleotides.

[0094] In some embodiments, the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 2 nucleotides.

[0095] In some embodiments, the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 1 nucleotide.

[0096] In some embodiments, the spacer of the present disclosure has a nucleotide sequence as shown below: GCCGUGUACCAGCUGAGAGACUCU (SEQ ID NO: 7), or a nucleotide sequence that differs from SEQ ID NO: 7 by 1 to 5 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 7 by 5 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 7 by 4 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 7 by 3 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 7 by 2 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 7 by 1 nucleotide in length and / or sequence.

[0097] In some embodiments, the spacer of the present disclosure has a nucleotide sequence as shown below: AUCCUCUUGUCCCACAGAUAUCC (SEQ ID NO: 9), or a nucleotide sequence that differs from SEQ ID NO: 9 by 1 to 5 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 9 by 5 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 9 by 4 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 9 by 3 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 9 by 2 nucleotides in length and / or sequence. In some embodiments, the spacer has a nucleotide sequence that differs from SEQ ID NO: 9 by 1 nucleotide in length and / or sequence.

[0098] In addition to the spacer, crRNA further comprises CRISPR RNA repeats. CRISPR RNA repeats comprise nucleotide sequences that form a structure recognized by RGN molecules alone or together with hybridized tracrRNA. In some embodiments, CRISPR RNA repeats may comprise about 8 nucleotides to about 30 nucleotides or more. For example, the length of the CRISPR repeats can be about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 or more nucleotides. In some embodiments, the CRISPR repeat sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides in length. In some embodiments, the degree of complementarity between a CRISPR repeat sequence and its corresponding tracrRNA anti-repeat sequence, when optimally aligned using a suitable alignment algorithm, is about or greater than about 50%, about 60%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more. In certain embodiments, the degree of complementarity between a CRISPR repeat sequence and its corresponding tracrRNA anti-repeat sequence, when optimally aligned using a suitable alignment algorithm, is 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.

[0099] The CRISPR repeat sequence can comprise the nucleotide sequence of any one of SEQ ID NOs: 106, 109 to 112, 328, 331 and 334, or an active variant or fragment thereof, which, when contained within a guide RNA, is capable of directing sequence-specific binding of a related RNA-guided nuclease provided herein to a target DNA sequence disclosed herein within a TRAC gene. In some embodiments, the active CRISPR repeat sequence variant comprises a nucleotide sequence having at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleotide sequence shown in any one of SEQ ID NOs: 106, 109 to 112, 328, 331 and 334. In some embodiments, an active CRISPR repeat comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides of a nucleotide sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, and 334. In some embodiments, the CRISPR repeat comprises a nucleotide sequence that differs from SEQ ID NO: 106 by 1 to 8 nucleotides in length and / or sequence. In some embodiments, the CRISPR repeat comprises a nucleotide sequence that differs from SEQ ID NO: 106 by 8 nucleotides in length and / or sequence. In some embodiments, the CRISPR repeat comprises a nucleotide sequence that differs from SEQ ID NO: 106 by 7 nucleotides in length and / or sequence. In some embodiments, the CRISPR repeat comprises a nucleotide sequence that differs from SEQ ID NO: 106 by 6 nucleotides in length and / or sequence. In some embodiments, the CRISPR repeat sequence comprises a nucleotide sequence that differs in length and / or sequence from SEQ ID NO: 106 by 5 nucleotides. In some embodiments, the CRISPR repeat sequence comprises a nucleotide sequence that differs in length and / or sequence from SEQ ID NO: 106 by 4 nucleotides. In some embodiments, the CRISPR repeat sequence comprises a nucleotide sequence that differs in length and / or sequence from SEQ ID NO: 106 by 3 nucleotides. In some embodiments, the CRISPR repeat sequence comprises a nucleotide sequence that differs in length and / or sequence from SEQ ID NO: 106 by 2 nucleotides. In some embodiments, the CRISPR repeat sequence comprises a nucleotide sequence that differs in length and / or sequence from SEQ ID NO: 106 by 1 nucleotide.In some embodiments, the CRISPR repeat sequence comprises a nucleotide sequence as follows: GUCAUAGUUCCAUUAAAGCCA (SEQ ID NO: 106). The CRISPR repeat sequence may include at least one chemical modification. In some embodiments, the CRISPR repeat sequence as part of the guide RNA comprises a 2'-O-methyl 3' phosphorothioate (MS) modification at the three terminal nucleotides of the 3' region of the CRISPR repeat sequence. The CRISPR repeat sequence comprising a 2'-O-methyl 3' phosphorothioate (MS) modification at the three terminal nucleotides of the 3' region of the CRISPR repeat sequence can have a nucleotide sequence as shown in any one of SEQ ID NOs: 430, 432 to 435, 583, 585, and 587.

[0100] The crRNA can be a non-naturally occurring engineered sequence. In some embodiments, a specific CRISPR repeat sequence is not linked to an engineered spacer in nature, and the CRISPR repeat sequence is considered heterologous to the spacer. In some embodiments, the spacer is a non-naturally occurring engineered sequence.

[0101] In some embodiments, the crRNA has a sequence as shown in any one of SEQ ID NOs: 136 to 197. The crRNA may include at least one chemical modification. In some embodiments, the crRNA of the present disclosure may include 2'-O-methyl 3' phosphorothioate (MS) modifications at the 3 terminal nucleotides of the 5' region and the 3 terminal nucleotides of the 3' region of the crRNA. The crRNA comprising 2'-O-methyl 3' phosphorothioate (MS) modifications at the 3 terminal nucleotides of the 5' region and the 3 terminal nucleotides of the 3' region of the crRNA may have a nucleotide sequence as shown in any one of SEQ ID NOs: 459 to 520.

[0102] Typically, the guide RNA disclosed in the present invention includes crRNA and trans-activated CRISPR RNA (tracrRNA), while some compositions and methods disclosed in the present invention utilize RGN polypeptides that do not require tracrRNA. The tracrRNA molecule includes a nucleotide sequence that includes a region with sufficient complementarity to hybridize with the crRNA repeat sequence (referred to herein as an anti-repeat sequence). In some embodiments, the tracrRNA molecule further includes a region with a secondary structure (e.g., stem-loop). In some embodiments, the secondary structure includes nucleotides in one of two states of pairing or unpairing, wherein nucleotides or base pairing are included in base-base hydrogen bond interactions (e.g., adenine (A) is paired with uracil (U), and cytosine (C) is paired with guanine (G)) between two complementary nucleic acid chains to form a spiral. In some embodiments, the combination of one or more spiral elements interspersed with unpaired single-stranded nucleotides constitutes an RNA structure.

[0103] As used herein, "stem-loop" refers to a secondary structure form including at least one "stem" and at least one "loop", "protrusion" or "bubble" found in a polynucleotide. Stem-loop can be intramolecular (within a molecule, for example, in tracrRNA or sgRNA) or intermolecular (between two different nucleic acids, for example, in dual-guide RNA, by the crRNA repeats of crRNA and the anti-repeat sequence of tracrRNA) formation. When there is at least some complementarity between two nucleic acid sequences to form a paired double helix, a stem-loop is produced. There is complete complementarity or sometimes includes a paired double helix region of G:U wobble base pairs (or I:U, I:A or I:C, wherein I refers to inosine) is referred to as a "stem". The term "loop", "protrusion" or "bubble" refers to a single-stranded region in a "stem-loop" structure, wherein there is no complementarity between nucleotides, excluding G:U wobble base pairs (or I:U, I:A or I:C, wherein I refers to inosine). Therefore, "loop", "protrusion" and "bubble" include unpaired nucleotides. In some embodiments, a "loop" is distinguished from a "bulge" or "bubble" by being located at one end of a "stem-loop" structure, while the "bulge" or "bubble" is located between the two "stems" in the "stem-loop" structure.

[0104] In certain embodiments, the stem-loop structure includes a stem and a loop at one end of the stem. In some embodiments, the stem-loop structure includes a first stem and a second stem, with a bubble between the stem. In some embodiments, the stem-loop structure includes a ring, a plurality of stems and a plurality of bubbles between the stem. In this case, the bubble according to the order close to the ring is referred to as "first bubble", "second bubble", "third bubble" etc., and the stem according to the order close to the ring is referred to as "first stem", "second stem", "third stem" etc. In the embodiment of dgRNA, the stem-loop formed by the crRNA repeat sequence of crRNA and the anti-repeat sequence of tracrRNA does not include a ring, and therefore the bubble according to the order close to tracrRNA 5' end (or crRNA 3' end) is referred to as "first bubble", "second bubble", "third bubble" etc., and the stem according to the order close to tracrRNA 5' end (or crRNA 3' end) is referred to as "first stem", "second stem", "third stem" etc.

[0105] The term "first stem of the crRNA repeat sequence of a crRNA", "first stem of the crRNA repeat sequence" or "first stem of the crRNA" means the region of the first stem of the crRNA repeat sequence of the crRNA that forms a stem-loop structure when hybridized with the anti-repeat sequence of the tracrRNA. The term "second stem of the crRNA repeat sequence of the crRNA", "second stem of the crRNA repeat sequence" or "second stem of the crRNA" means the region of the second stem of the crRNA repeat sequence of the crRNA that forms a stem-loop structure when hybridized with the anti-repeat sequence of the tracrRNA. Similarly, the term "first stem of the anti-repeat sequence of the tracrRNA", "first stem of the anti-repeat sequence" or "first stem of the tracrRNA" means the region of the first stem of the anti-repeat sequence of the tracrRNA that forms a stem-loop structure when hybridized with the crRNA repeat sequence of the crRNA. The term "second stem of the anti-repeat sequence of the tracrRNA", "second stem of the anti-repeat sequence" or "second stem of the tracrRNA" means the region of the second stem of the anti-repeat sequence of the tracrRNA that forms a stem-loop structure when hybridized with the crRNA repeat sequence of the crRNA.

[0106] In some embodiments, the stem loop formed within the molecule is a hairpin stem loop. Base pairing occurs in the stem portion of the stem loop, and is generally related to guanine-cytosine base pairing and adenine-uracil (thymidine) base pairing, although guanine-uracil base pairing is possible. Base stacking interactions promote spiral formation. The loop portion of the stem loop includes unpaired bases. In some embodiments, the ring is the point where the nucleic acid chain itself turns back to carry out nucleotide pairing to produce a stem. In some embodiments, it is spatially impossible and will not form a ring less than three bases long. In some embodiments, the optimal loop length is about 4 to 8 bases long. The common ring with four nucleotide sequences (such as GAAA, AAAG, ACUU or UUCG) is referred to as "tetraloop", and is particularly stable due to the base stacking interactions of its component nucleotides.

[0107] In some embodiments, the region of tracrRNA that is fully or partially complementary to the crRNA repeat sequence is located at the 5' end of the molecule, and the 3' end of tracrRNA includes a secondary structure. This region of secondary structure generally includes several hairpin structures, including connecting hairpins (nexus hairpin), which are found to be adjacent to anti-repeat sequences. The core of the interaction between the guide RNA and RGN is connected and is located at the intersection between the guide RNA, RGN and the target sequence. The connecting hairpin generally has a conserved nucleotide sequence in the base of the hairpin stem, and the motif UNANNC is found in many connecting hairpins of tracrRNA. In embodiments, the guide RNA of the present disclosure or RGN system uses a tracrRNA comprising a non-classical sequence in the base of the hairpin stem of the hairpin, including UNANNG and CNANNC. In some embodiments, the guide RNA of the present disclosure or RGN system uses a tracrRNA comprising a non-classical sequence of UNANNG in the base of the hairpin stem. In some embodiments, the guide RNA or RGN system of the present disclosure uses a tracrRNA including a non-classical sequence of CNANNC in the bases connecting the hairpin stem. There is usually a terminal hairpin at the 3' end of the tracrRNA, which can vary in structure and quantity, but generally includes a GC-rich Rho-independent transcription terminator hairpin, followed by a string of U at the 3' end. See, for example, Briner et al. (2014) Molecular Cell 56:333-339, Briner and Barrangou (2016) Cold Spring Harb Protoc; doi: 10.1101 / pdb.top090902, and U.S. Publication No. 2017 / 0275648, each of which is incorporated by reference in its entirety.

[0108] The tracrRNA of the present disclosure may include a tail. As used herein, the term "tail" refers to the non-complementary region closest to the 3' end of the tracrRNA of the present disclosure (e.g., within twelve, eleven, ten, nine, eight, seven, six, or five nucleotides from the 3' end). In some embodiments, the tail of the tracrRNA includes 1 to 12, 1 to 8, 1 to 7, or 1 to 6 nucleotides from the 3' end of the tracrRNA. In some embodiments, the tail of the tracrRNA includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more nucleotides from the 3' end of the tracrRNA.

[0109] In addition to linking hairpins, the tracrRNA of the present disclosure may include additional hairpins or stem-loop structures. In some embodiments, tracrRNA includes at least one stem-loop. In some embodiments, tracrRNA includes at least one stem-loop close to the anti-repeat sequence and at least one stem-loop close to the 3' end of tracrRNA. "Proximal" refers to 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides or 10 nucleotides in the region or end of the nucleic acid molecule. In certain embodiments, "proximal" refers to 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides or 6 nucleotides in the region or end of the nucleic acid molecule. "Nearest" refers to the region or end of the nucleic acid molecule that is closest to the end. For example, the stem-loop closest to the tail of the tracrRNA is the first stem-loop closest to the tail of the tracrRNA. "Far side" refers to a distance from the region or end of a nucleic acid molecule by at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides or more. In some embodiments, "far side" refers to a distance from the structure (e.g., bubble, loop) of a nucleic acid molecule by at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides or more. For example, the nucleotides of the first stem of the anti-repeating sequence of the dual-guide RNA at the far side of the first bubble of the stem loop are closer to the 3' terminal nucleotides of the crRNA and the 5' terminal nucleotides of the tracrRNA than they are to the first bubble. TracrRNA also forms a secondary structure when hybridizing with its corresponding crRNA. The anti-repeating sequence region of tracrRNA is completely or partially complementary to the crRNA repeat sequence of crRNA. In some embodiments, a portion of the anti-repeating sequence of tracrRNA hybridizes with a portion of the crRNA repeat sequence and forms a stem. In some embodiments, the crRNA:tracrRNA stem comprises at least one nucleotide pair (i.e., base pair), because these parts of the anti-repeat sequence and the crRNA repeat sequence are complementary. As described elsewhere herein, the part of the anti-repeat sequence of the tracrRNA forming the first stem is the first stem of the anti-repeat sequence, the part of the anti-repeat sequence of the tracrRNA forming the second stem is the second stem of the anti-repeat sequence, the part of the anti-repeat sequence of the tracrRNA forming the third stem is the third stem of the anti-repeat sequence, etc.As described elsewhere herein, the portion of the crRNA repeat sequence of the crRNA that forms the first stem is the first stem of the crRNA repeat sequence, the portion of the crRNA repeat sequence of the crRNA that forms the second stem is the second stem of the crRNA repeat sequence, the portion of the crRNA repeat sequence of the crRNA that forms the third stem is the third stem of the crRNA repeat sequence, and so on. In some embodiments, a portion of the anti-repeat sequence of the tracrRNA and a portion of the crRNA repeat sequence are not complementary to each other and therefore do not hybridize to form base pairs. In some embodiments, the non-complementary region between the anti-repeat sequence and the crRNA repeat sequence forms a bulge or bubble. In some embodiments, the hybridization of the anti-repeat sequence of the tracrRNA and the crRNA repeat sequence of the crRNA forms a secondary structure comprising at least one stem. In some embodiments, the hybridization of the anti-repeat sequence of the tracrRNA and the crRNA repeat sequence of the crRNA forms a secondary structure comprising at least one bubble. In some embodiments, the hybridization of the anti-repeat sequence of the tracrRNA and the crRNA repeat sequence of the crRNA forms a secondary structure comprising at least one stem and at least one bubble. In some embodiments, the hybridization of the anti-repeat sequence of the tracrRNA and the crRNA repeat sequence of the crRNA forms a secondary structure comprising two stems and a bubble therebetween.

[0110] In some embodiments, the anti-repeat sequence of the tracrRNA that is fully or partially complementary to the CRISPR repeat sequence comprises about 8 nucleotides to about 30 nucleotides or more. For example, the length of the base pairing region between the tracrRNA anti-repeat sequence and the CRISPR repeat sequence can be about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 or more nucleotides. In some embodiments, the base-paired region between the tracrRNA anti-repeat and the CRISPR repeat sequence is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides in length. In some embodiments, the degree of complementarity between a CRISPR repeat sequence and its corresponding tracrRNA anti-repeat sequence, when optimally aligned using a suitable alignment algorithm, is about or greater than about 50%, about 60%, about 70%, about 75%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more. In some embodiments, the degree of complementarity between a CRISPR repeat sequence and its corresponding tracrRNA anti-repeat sequence, when optimally aligned using a suitable alignment algorithm, is 50%, 60%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.

[0111] In some embodiments, the entire tracrRNA can comprise from about 60 nucleotides to more than about 210 nucleotides. For example, the length of the tracrRNA can be about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 105, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210 or more nucleotides. In some embodiments, the tracrRNA is 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 150, 160, 170, 180, 190, 200, 210, or more nucleotides in length. In some embodiments, the tracrRNA is about 70 to about 105 nucleotides in length, including about 70, about 71, about 72, about 73, about 74, about 75, about 76, about 77, about 78, about 79, about 80, about 81, about 82, about 83, about 84, about 85, about 86, about 87, about 88, about 89, about 90, about 91, about 92, about 93, about 94, about 95, about 96, about 97, about 98, about 99, about 100, about 101, about 102, about 103, about 104, and about 105 nucleotides in length. In embodiments, the tracrRNA is 70 to 105 nucleotides in length, including 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, and 105 nucleotides in length.

[0112] In some embodiments, the tracrRNA comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335, or an active variant or fragment thereof, which, when contained within a guide RNA, is capable of directing sequence-specific binding of a related RNA-guided nuclease provided herein to a target sequence disclosed herein within a TRAC gene. In some embodiments, the active tracrRNA sequence variant comprises a nucleotide sequence having at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleotide sequence as set forth in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335. In some embodiments, the active tracrRNA sequence fragment comprises at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335. The active tracrRNA sequence fragment differs from SEQ ID NO: 107 by 1 to 16 nucleotides in length. In some embodiments, the active tracrRNA has a nucleotide sequence that is 8 nucleotides shorter than the nucleotide sequence shown in SEQ ID NO: 107. In some embodiments, the active tracrRNA has a nucleotide sequence that is 11 nucleotides shorter than the nucleotide sequence shown in SEQ ID NO: 107. The active tracrRNA sequence fragment may comprise the nucleotide sequence shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335. In some embodiments, the active tracrRNA has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence shown in SEQ ID NO: 107. In some embodiments, the active tracrRNA has a nucleotide sequence as shown below:

[0113] UGGCUUUGAUGUUUCUAUGAUAAGGGUUUCGACCCGUGGCGUCGGGGAUCGCCUGCCCAUUGAAAUGGGCUUCUCCCCAUUUAUU (SEQ ID NO: 107).

[0114] The tracrRNA may include at least one chemical modification. In some embodiments, the tracrRNA of the present disclosure may include 2'-O-methyl 3' phosphorothioate (MS) modifications at the 3 terminal nucleotides in the 5' region of tracrRNA and the 3 terminal nucleotides in the 3' region. The tracrRNA including 2'-O-methyl 3' phosphorothioate (MS) modifications at the 3 terminal nucleotides in the 5' region of tracrRNA and the 3 terminal nucleotides in the 3' region may have a nucleotide sequence as shown in any one of SEQ ID NO: 431, 437 to 446, 584, 586, and 588.

[0115] Two polynucleotide sequences are considered substantially complementary when they hybridize to each other under stringent conditions. The term "hybridize" refers to the binding or association of one molecule with another, or the binding or association of regions of one molecule with each other. A guide RNA's spacer and its target sequence are considered substantially complementary when they sufficiently hybridize to allow localization to the guide RNA-bound RGN target sequence. Similarly, an RGN is considered to bind to a particular target sequence in a sequence-specific manner if the RGN-binding guide RNA binds to the target sequence under normal experimental or in vivo conditions. The term "sequence-specific" may also refer to an RGN polypeptide binding to a target sequence with greater affinity than to a randomized background sequence.

[0116] The Tm is the temperature (under defined ionic strength and pH) at which 50% of the complementary target sequence hybridizes to the perfectly matched sequence. For DNA-DNA hybrids, the Tm can be approximately calculated according to the equation in Meinkoth and Wahl (1984) Anal. Biochem. 138: 267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% form) - 500 / L; where M is the molar concentration of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) of the specific sequence and its complement at a defined ionic strength and pH. However, extremely stringent conditions may utilize hybridization and / or wash at 1° C., 2° C., 3° ​​C., or 4° C. below the thermal melting point (Tm); moderately stringent conditions may utilize hybridization and / or wash at 6° C., 7° C., 8° C., 9° C., or 10° C. below the thermal melting point (Tm); and low stringency conditions may utilize hybridization and / or wash at 11° C., 12° C., 13° C., 14° C., 15° C., or 20° C. below the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill in the art will understand that variations in the stringency of hybridization and / or wash solutions are inherently described. An extensive guide to nucleic acid hybridization is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, New York).

[0117] Guide RNA can be single guide RNA (sgRNA) or dual guide RNA (dgRNA). Single guide RNA includes crRNA and tracrRNA on a single RNA molecule, and the dual guide RNA system includes crRNA and tracrRNA present on two different RNA molecules, both of which are hybridized with each other by at least a portion of the CRISPR repeats of crRNA and at least a portion of tracrRNA (i.e., anti-repeats), which can be completely or partially complementary to the CRISPR repeats of crRNA. In the embodiment where guide RNA is a single guide RNA, crRNA and tracrRNA are separated by a joint nucleotide sequence. Generally, joint nucleotide sequence is a sequence that does not include complementary bases, to avoid forming a secondary structure in the nucleotides of the joint nucleotide sequence or a secondary structure of the nucleotides comprising the joint nucleotide sequence. In some embodiments, the length of the joint nucleotide sequence between crRNA and tracrRNA is at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 or more nucleotides. In some embodiments, the length of the joint nucleotide sequence of a single guide RNA is at least 4 nucleotides. In certain embodiments, the length of the linker nucleotide sequence of the single guide RNA is 4 nucleotides. In some embodiments, the linker nucleotide sequence includes a nucleotide sequence as shown in any one of AAAG, GAAA, ACUU, and CAAAGG. In certain embodiments, the linker nucleotide sequence includes a nucleotide sequence as shown in AAAG. In some embodiments, the linker nucleotide sequence includes a nucleotide sequence as shown in GAAA. In some embodiments, the linker nucleotide sequence includes a nucleotide sequence as shown in ACUU. In some embodiments, the linker nucleotide sequence includes a nucleotide sequence as shown in CAAAGG.

[0118] Single or dual guide RNAs can be chemically synthesized or synthesized via in vitro transcription. Assays for determining sequence-specific binding between RGNs and guide RNAs are known in the art and include, but are not limited to, in vitro binding assays between expressed RGNs and guide RNAs, which can be labeled with a detectable label (e.g., biotin) and used in pull-down assays in which the guide RNA:RGN complex is captured via a detectable label (e.g., with streptavidin beads). Control guide RNAs with sequences or structures unrelated to the guide RNAs can be used as negative controls for nonspecific binding of RGNs to RNAs. In some embodiments, the guide RNAs include any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259. In some embodiments, the guide RNAs have at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 204. In some embodiments, the guide RNA has the nucleotide sequence shown below: GCCGUGUACCAGCUGAGAGACUCUGUCAUAGUUCCAUAAAGAUGU UUCUAUGAUAAGGGUUUUCGACCCGUGGCGUCGGGGAUCGCCUGCCC AUUGAAAUGGGCUUCUCCCCAUUUAUU (SEQ ID NO: 204). In some embodiments, the guide RNA has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence shown in SEQ ID NO: 205. In some embodiments, the guide RNA has the nucleotide sequence shown below: AUCCUCUUGUCCCACAGAUAUCCGUCAUAGUUCCAUUAAAAAGUUG AUGUUUCUAUGAUAAGGGUUUCGACCCGUGGCGUCGGGGAUCGCC UGCCCUUGAAAGGGCUUCUCCCCAUU (SEQ ID NO: 205).

[0119] The guide RNA of the present disclosure may include at least one chemical modification. In a single guide RNA form, at least one chemical modification may include 2'-O-methyl 3' phosphorothioate (MS) at 3 terminal nucleotides in the 5' district of the single guide RNA and 3' district. In a double guide RNA form, at least one chemical modification may include 2'-O-methyl 3' phosphorothioate (MS) at 3 terminal nucleotides in the 5' district of crRNA and 3' district. It can also include 2'-O-methyl 3' phosphorothioate (MS) at 3 terminal nucleotides in the 5' district of tracrRNA and / or 3' district. The guide RNA modified through MS can have the nucleotide sequence shown in any one of SEQ ID NO:521 to 523, 525 to 536, 538 to 556, 558 to 564 and 566 to 582.

[0120] Guide RNA can be introduced into target cell or embryo as RNA molecule.Guide RNA can be transcribed in vitro or by chemical synthesis.In some embodiments, the nucleotide sequence encoding guide RNA is introduced into cell or embryo.In some embodiments, the nucleotide sequence encoding guide RNA is operably connected to promoter (for example, RNA polymerase III promoter).Promoter can be a natural promoter or a promoter heterologous to the guide RNA encoding nucleotide sequence.

[0121] In some embodiments, as described herein, a guide RNA can be introduced into a target cell or embryo as a ribonucleoprotein complex, wherein the guide RNA is associated with an RGN polypeptide.

[0122] Guide RNA guides the associated RGN to the specific target nucleotide sequence of interest by hybridization of guide RNA with the target sequence of interest. The target sequence can be bound (and in some embodiments, cut) by an RNA-guided nuclease in vitro or in a cell. The target sequence can comprise DNA, RNA, or a combination of the two, and can be single-stranded or double-stranded. The target sequence can be genomic DNA (i.e., chromosomal DNA), plasmid DNA, or an RNA molecule (e.g., messenger RNA, ribosomal RNA, transfer RNA, microRNA, small interfering RNA). In those embodiments where the target sequence is a chromosomal sequence, the chromosomal sequence can be a nuclear or mitochondrial chromosomal sequence. In the compositions and methods disclosed herein, the target sequence is within a target nucleic acid molecule that is double-stranded (e.g., a target DNA sequence). More specifically, the target sequence is within a TRAC gene. In some embodiments, the target sequence is unique in the target genome. In some embodiments, the target sequence has a nucleotide sequence as set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

[0123] The target sequence is adjacent to the protospacer adjacent motif (PAM), and the non-target strand of the target sequence is the strand comprising the PAM. The PAM is adjacent to the target sequence and generally comprises N, wherein each "N" represents any nucleotide. In some embodiments, the PAM comprises about 1 to about 10 Ns, including about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 Ns. In certain embodiments, the PAM comprises 1 to 10 Ns, including 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 Ns. The PAM can be 5' or 3' of the target sequence on its non-target strand. In some embodiments, for the guide RNA and RGN systems disclosed herein, the PAM is 3' of the target sequence on its non-target strand. Typically, the PAM is a consensus sequence of about 3 to 4 nucleotides, but in certain embodiments, its length can be 2, 3, 4, 5, 6, 7, 8, 9, or more nucleotides.

[0124] In some embodiments, the PAM sequence adjacent to the target sequence disclosed herein on its non-target strand comprises a consensus sequence as shown in any one of the PAM sequences in Table 1. In some embodiments, the PAM sequence adjacent to the target sequence disclosed herein on its non-target strand comprises a consensus sequence as shown in any one of the PAM sequences in Table 1. In some embodiments, the PAM sequence is 3' to the target sequence on its non-target strand.

[0125] It is well known in the art that PAM sequence specificity for a given nuclease is affected by enzyme concentration (see, e.g., Karvelis et al. (2015) Genome Biol 16:253), which can be modified by changing the promoter used to express the RGN or the amount of ribonucleoprotein complex delivered to the cell or embryo.

[0126] After recognizing its corresponding PAM sequence, the RGN can cleave one or both strands of the target sequence at a specific cleavage site. As used herein, a cleavage site consists of two specific nucleotides within the target sequence, between which the target strand, the non-target strand, or both strands of the target sequence are cleaved by the RGN. The cleavage site can comprise the first and second, second and third, third and fourth, fourth and fifth, fifth and sixth, seventh and eighth, or eighth and ninth nucleotides from the PAM in the 5' or 3' direction. In some embodiments, the cleavage site can be more than 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides from the PAM in the 5' or 3' direction. Because the RGN can cleave the target sequence, resulting in staggered ends, in certain embodiments, the cleavage site is defined based on the distance of two nucleotides from the PAM on the non-target strand of the target sequence and, for the target strand, based on the distance of two nucleotides from the complementary sequence of the PAM.

[0127] III. Modification of guide RNA length

[0128] Guide RNAs disclosed herein that are effective in targeting associated RNA-guided nucleases (RGNs) to target nucleotide sequences in TRAC genes can be engineered to be shorter than their corresponding natural guide RNAs, but have comparable efficiency in gene editing to their corresponding natural guide RNAs. Natural guide RNAs include naturally occurring guide RNAs, such as guide RNAs from organisms. Guide RNAs engineered to be shorter than their natural guide RNA lengths can be as effective as their non-engineered counterparts in their ability to bind to associated RGNs and cut and / or modify target sequences.

[0129] Modifications (e.g., deletions, truncations) "within" a region of the disclosed RNA molecules include all nucleotides and phosphate backbones in the region, including the first and last nucleotide positions considered to be part of the region.

[0130] In some embodiments, the spacer of the present disclosure, crRNA repeats, crRNA, anti-repeat sequence, tracrRNA, skeleton and / or guide RNA are engineered to be truncated or shortened.In some embodiments, compared with the same spacer before its engineering, crRNA repeats, crRNA, anti-repeat sequence, tracrRNA, skeleton and / or guide RNA, the truncated spacer, truncated crRNA repeats, truncated crRNA, truncated anti-repeat sequence, truncated tracrRNA, truncated skeleton and / or truncated guide RNA maintain or enhance gene editing efficiency.In the context of engineered spacer, crRNA repeats, crRNA, anti-repeat sequence, tracrRNA, skeleton or guide RNA, "truncation" and "deletion" are used interchangeably herein, and refer to removing at least one nucleotide from a reference spacer, crRNA repeats, crRNA, anti-repeat sequence, tracrRNA, skeleton or guide RNA, which may be naturally occurring or synthetic.

[0131] The engineered spacer may comprise a truncation of 1 nucleotide (nt), 2 nt, 3 nt, 4 nt, or 5 nt compared to the same spacer prior to engineering. The engineered spacer may comprise a truncation of 1 nt compared to the spacer prior to engineering. The engineered spacer may comprise a truncation of 2 nt compared to the spacer prior to engineering. The engineered spacer may comprise a truncation of 3 nt compared to the spacer prior to engineering. The engineered spacer may comprise a truncation of 4 nt compared to the spacer prior to engineering. The engineered spacer may comprise a truncation of 5 nt compared to the spacer prior to engineering. In some embodiments, a spacer of the present disclosure has a nucleotide sequence as set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103. In some embodiments, a spacer that is part of a guide RNA comprises 2'-O-methyl 3' phosphorothioate (MS) modifications at the 3 terminal nucleotides of the 5' region of the spacer.

[0132] Compared to the crRNA repeat sequence before its engineering, the engineered crRNA repeat sequence may include 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt or 10 nt of truncation. Compared to the nucleotide sequence shown in SEQ ID NO: 106, the engineered crRNA repeat sequence may include 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt or 10 nt of truncation from its 3 ' end. In some embodiments, compared to the nucleotide sequence shown in SEQ ID NO: 106, the engineered crRNA repeat sequence includes 1 nt of truncation from its 3 ' end. In some embodiments, compared to the nucleotide sequence shown in SEQ ID NO: 106, the engineered crRNA repeat sequence includes 2 nt of truncation from its 3 ' end. In some embodiments, the engineered crRNA repeat sequence comprises a truncation of 3 nt from its 3' end compared to the nucleotide sequence shown in SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence comprises a truncation of 4 nt from its 3' end compared to the nucleotide sequence shown in SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence comprises a truncation of 5 nt from its 3' end compared to the nucleotide sequence shown in SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence comprises a truncation of 6 nt from its 3' end compared to the nucleotide sequence shown in SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence comprises a truncation of 7 nt from its 3' end compared to the nucleotide sequence shown in SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence comprises a truncation of 8 nt from its 3' end compared to the nucleotide sequence shown in SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence comprises a truncation of 9 nt from its 3' end compared to the nucleotide sequence shown in SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence comprises a truncation of 10 nt from its 3' end compared to the nucleotide sequence shown in SEQ ID NO: 106.

[0133] In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence as set forth in SEQ ID NO: 106 or differs from SEQ ID NO: 106 by 1 to 8 nucleotides in length and / or sequence. In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 8 nucleotides in length and / or sequence. In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 7 nucleotides in length and / or sequence. In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 6 nucleotides in length and / or sequence. In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 5 nucleotides in length and / or sequence. In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 4 nucleotides in length and / or sequence. In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence that differs by 3 nucleotides in length and / or sequence from SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence that differs by 2 nucleotides in length and / or sequence from SEQ ID NO: 106. In some embodiments, the engineered crRNA repeat sequence has a nucleotide sequence that differs by 1 nucleotide in length and / or sequence from SEQ ID NO: 106.

[0134] The crRNA repeat sequence may include a total length of at least 10, 11, 12, 13, 14, 15 or 16 nucleotides. The crRNA repeat sequence may include a total length of up to 10, 11, 12, 13, 14, 15 or 16 nucleotides. In some embodiments, the crRNA repeat sequence may include a total length of 13 nucleotides. In some embodiments, the crRNA repeat sequence may include a total length of 16 nucleotides. In some embodiments, the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 106, 109 to 112, 328, 331 and 334. In some embodiments, the crRNA repeat sequence as a part of the guide RNA comprises 2'-O-methyl 3' phosphorothioate (MS) modification at the 3 terminal nucleotides of the 3' region of the crRNA repeat sequence. The crRNA repeat sequence modified by MS may have a nucleotide sequence as shown in any one of SEQ ID NOs: 430, 432 to 435, 583, 585 and 587.

[0135] Compared to the crRNA before its engineering, the engineered crRNA can include 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt or 15 nt of truncation. The engineered crRNA can include 1 nt, 2 nt, 3 nt, 4 nt or 5 nt of truncation from its 5' end. In some embodiments, the engineered crRNA includes 1 nt of truncation from its 5' end. In some embodiments, the engineered crRNA includes 2 nt of truncation from its 5' end. In some embodiments, the engineered crRNA includes 3 nt of truncation from its 5' end. The engineered crRNA may comprise a truncation of 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, or 12 nt from its 3' end. In some embodiments, the engineered crRNA comprises a truncation of 5 nt from its 3' end. In some embodiments, the engineered crRNA comprises a truncation of 8 nt from its 3' end.

[0136] The crRNA may have a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 136 to 197. In some embodiments, the crRNA has a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 136 to 197. In some embodiments, the crRNA has a nucleotide sequence having at least 95% sequence identity to any one of SEQ ID NOs: 136 to 197. In some embodiments, the crRNA has a nucleotide sequence having 100% sequence identity to any one of SEQ ID NOs: 136 to 197. The crRNA of the present disclosure may comprise 2'-O-methyl 3' phosphorothioate (MS) modifications at the 3 terminal nucleotides of the 5' region and the 3 terminal nucleotides of the 3' region of the crRNA. The crRNA modified with MS may have a nucleotide sequence as shown in any one of SEQ ID NOs: 459 to 520.

[0137] The engineered tracrRNA can include 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt or more truncations compared to the same tracrRNA before its engineering. In some embodiments, the engineered tracrRNA comprises a deletion of 1 to 12 nucleotides within the first stem of the anti-repeat sequence compared to the tracrRNA before its engineering. In some embodiments, the engineered tracrRNA comprises a deletion of 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt or 12 nt within the first stem of the anti-repeat sequence compared to the tracrRNA before its engineering. In some embodiments, the engineered tracrRNA comprises a deletion of 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, or 9 nt within the first stem of the anti-repeat sequence compared to its tracrRNA before engineering.

[0138] The engineered tracrRNA may comprise a deletion of nucleotides from the tail compared to the tracrRNA before engineering. In some embodiments, the engineered tracrRNA comprises a deletion of 1 to 6 nucleotides from the tail compared to the tracrRNA before engineering. In some embodiments, the engineered tracrRNA comprises a deletion of 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 nucleotides from the tail compared to the tracrRNA before engineering.

[0139] Compared to the tracrRNA before its engineering, the engineered tracrRNA can include a disappearance in the stem-loop closest to the tail. In some embodiments, compared to the tracrRNA before its engineering, the engineered tracrRNA includes a disappearance of 1 to 4 base pairs (bp) or 2 to 8 nt in the first stem of the stem-loop closest to the tail of tracrRNA. In some embodiments, compared to the tracrRNA before its engineering, the engineered tracrRNA includes a disappearance of 1 to 3 bp or 2 to 6 nt in the first stem of the stem-loop closest to the tail of tracrRNA. In some embodiments, compared to the tracrRNA before its engineering, the engineered tracrRNA includes a disappearance of 1 bp (2 nt), 2 bp (4 nt) or 3 bp (6 nt) in the first stem of the stem-loop closest to the tail of tracrRNA.

[0140] As disclosed herein, the tracrRNA can comprise a total length of at least 65, 70, 75, 80, or 85 nucleotides. The tracrRNA can comprise a total length of at most 65, 70, 75, 80, or 85 nucleotides. In some embodiments, the tracrRNA comprises a total length of 74 nucleotides. In some embodiments, the tracrRNA comprises a total length of 77 nucleotides.

[0141] The tail of the tracrRNA may comprise a total length of at least 1, 2, 3, 4, 5, 6, or 7 nucleotides. The tail of the tracrRNA may comprise a total length of at most 1, 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments, the tail of the tracrRNA comprises a total length of 3 nucleotides. In some embodiments, the tail of the tracrRNA comprises a total length of 1 nucleotide.

[0142] The tracrRNA can comprise a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335. In some embodiments, the tracrRNA has a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335. In some embodiments, the tracrRNA has a nucleotide sequence having at least 95% sequence identity to any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335. In some embodiments, the tracrRNA has a nucleotide sequence having 100% sequence identity to any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335. In some embodiments, the tracrRNA as a part of the guide RNA comprises 2'-O-methyl 3' phosphorothioate (MS) modifications at the 3 terminal nucleotides of the 5' region of the tracrRNA and at the 3 terminal nucleotides of the 3' region of the tracrRNA. The MS-modified tracrRNA can have a nucleotide sequence as shown in any one of SEQ ID NOs: 431, 437 to 446, 584, 586, and 588.

[0143] The gRNA of the present disclosure includes an sgRNA comprising a backbone, wherein the backbone of the sgRNA comprises a crRNA repeat sequence and a tracrRNA connected by a nucleotide linker. In some embodiments, the linker has a nucleotide sequence as shown in AAAG, GAAA, ACUU, or CAAAGG. In some embodiments, the linker has a nucleotide sequence as shown in AAAG.

[0144] The engineered sgRNA backbone disclosed herein can be 2 to 30 nucleotides shorter than its backbone prior to engineering. The engineered sgRNA backbone can be 12 to 24 nucleotides shorter than its backbone prior to engineering. In some embodiments, the engineered sgRNA backbone is 2 nucleotides, 4 nucleotides, 6 nucleotides, 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16 nucleotides, 18 nucleotides, 20 nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides, 28 nucleotides, 30 nucleotides or shorter than its backbone prior to engineering.

[0145] The sgRNA backbones of the present disclosure may comprise a total length of at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 nucleotides. The sgRNA backbones of the present disclosure can comprise a total length of up to 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 nucleotides. In some embodiments, the sgRNA backbone comprises a total length of 86 to 98 nucleotides. In some embodiments, the sgRNA backbone comprises a total length of 94 nucleotides. In some embodiments, the sgRNA has a nucleotide sequence as set forth in any one of SEQ ID NOs: 124 to 134.

[0146] The sgRNA backbone of the present disclosure can have a nucleotide sequence having at least 80% sequence identity with any one of SEQ ID NOs: 124 to 134. In some embodiments, the sgRNA backbone has a nucleotide sequence having at least 90% sequence identity with any one of SEQ ID NOs: 124 to 134. In some embodiments, the sgRNA backbone has a nucleotide sequence having at least 95% sequence identity with any one of SEQ ID NOs: 124 to 134. In some embodiments, the sgRNA backbone has a nucleotide sequence having 100% sequence identity with any one of SEQ ID NOs: 124 to 134. In some embodiments, the backbone as part of the guide RNA comprises 2'-O-methyl 3' phosphorothioate (MS) modifications at the three terminal nucleotides of the 3' region of the backbone. The MS-modified backbone can have a nucleotide sequence as set forth in any one of SEQ ID NOs: 447 to 457.

[0147] The gRNA of the present disclosure includes an sgRNA comprising a spacer and a skeleton, wherein the skeleton of the sgRNA comprises a crRNA repeat sequence and a tracrRNA connected by a nucleotide linker. In some embodiments, the engineered sgRNA comprises a truncation in the spacer and / or a truncation in the skeleton compared to the sgRNA before its engineering. In some embodiments, the engineered sgRNA comprises a truncation in the spacer compared to the sgRNA before its engineering. In some embodiments, the engineered sgRNA comprises a truncation in the skeleton compared to the sgRNA before its engineering. In some embodiments, the engineered sgRNA comprises a truncation in the spacer and a truncation in the skeleton compared to the sgRNA before its engineering. In the embodiment in which the engineered sgRNA comprises a truncation in the skeleton, the truncation can be within the first stem of the stem loop formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, within the first stem of the stem loop closest to the tail, and / or within the tail of the tracrRNA.

[0148] The engineered sgRNA can comprise a deletion of 1 to 30 total nucleotides compared to the sgRNA before engineering. In some embodiments, the engineered sgRNA comprises a deletion of 13 to 25 total nucleotides compared to the sgRNA before engineering. In some embodiments, the engineered sgRNA comprises a deletion of 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 total nucleotides or more compared to the sgRNA before engineering.

[0149] The first stem of the stem-loop formed by the hybridization of the crRNA repetitive sequence of gRNA and anti-repetitive sequence can include at least 3,4,5,6,7,8,9,10 or 11 base pairs (bp) or at least 6,8,10,12,14,16,18,20 or 22 nt.The first stem of the stem-loop formed by the hybridization of the crRNA repetitive sequence of gRNA and anti-repetitive sequence can include at most 3,4,5,6,7,8,9,10 or 11 bp or at most 6,8,10,12,14,16,18,20 or 22 nt.In some embodiments, the first stem of the stem-loop formed by the hybridization of the crRNA repetitive sequence of gRNA and anti-repetitive sequence includes a total length of 6 bp or 12 nt.In some embodiments, the first stem of the stem-loop formed by the hybridization of the crRNA repetitive sequence of gRNA and anti-repetitive sequence includes a total length of 3 bp or 6 nt.

[0150] The first stem of the stem-loop closest to the tail in the gRNA can include at least 1, 2, 3, 4, 5, or 6 bp, or a total length of at least 2, 4, 6, 8, 10, or 12 nt. The first stem of the stem-loop closest to the tail in the gRNA can include at most 1, 2, 3, 4, 5, or 6 bp, or a total length of at most 2, 4, 6, 8, 10, or 12 nt. In some embodiments, the first stem of the stem-loop closest to the tail in the gRNA includes a total length of 5 bp or 10 nt.

[0151] In some embodiments, the gRNA of the present disclosure comprises the following: the first stem of the stem-loop formed by hybridization of crRNA repeats and anti-repeat sequences comprises a total length of 6 bp (12 nt), the tail of tracrRNA comprises a total length of 3 nucleotides, and the first stem of the stem-loop closest to the tail comprises a total length of 3 bp (6 nt). In some embodiments, the gRNA of the present disclosure comprises the first stem of the stem-loop formed by hybridization of crRNA repeats and anti-repeat sequences, comprising a total length of 13 bp (26 nt).

[0152] The total length of the guide RNA may refer to the total length of the sgRNA or dgRNA. The gRNA of the present disclosure may include a total length of at least 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides. The gRNA of the present disclosure may include a total length of up to 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides. In some embodiments, the gRNA of the present disclosure includes a total length of 106 to 135 nucleotides. In some embodiments, the gRNA of the present disclosure includes a total length of 117 to 119 nucleotides. In embodiments where the gRNA includes a total length of 117 to 119 nucleotides, the gRNA is an sgRNA. In embodiments where the gRNA as an sgRNA includes a total length of 117 to 119 nucleotides, the total length of the gRNA as a dgRNA may be less than 4 to 6 nucleotides, or be 111 to 115 nucleotides. In some embodiments, the total length of the gRNA that is a dgRNA is 4 to 6 nucleotides less than the total length of the gRNA that is an sgRNA, or the number of nucleotides less is equal to the length of the linker connecting the crRNA and tracrRNA. 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135 nucleotides or more in total length. In some embodiments, the sgRNA has a nucleotide sequence as set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259. In some embodiments, the sgRNA has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 204. In some embodiments, the sgRNA has a nucleotide sequence as set forth in SEQ ID NO: 204. In some embodiments, the sgRNA has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 205. In some embodiments, the sgRNA has a nucleotide sequence as set forth in SEQ ID NO: 205.The sgRNA of the present disclosure may comprise 2'-O-methyl 3' phosphorothioate (MS) modifications at the three terminal nucleotides of the 5' region and the three terminal nucleotides of the 3' region of the sgRNA. The MS-modified sgRNA may have a nucleotide sequence as shown in any one of SEQ ID NOs: 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582.

[0153] IV. RNA-guided nucleases and other nucleases

[0154] Provided herein is an RNA-guided nuclease system comprising a guide RNA disclosed herein targeting a TRAC gene. Term RNA-guided nuclease (RGN) refers to a polypeptide that binds to a specific target sequence (e.g., a target DNA sequence) in a sequence-specific manner, and guides the target sequence by a guide RNA molecule that is complexed with the polypeptide and hybridized with the target strand of the target sequence (e.g., a target DNA sequence). The active fragment of naturally occurring RGN or its variant maintains binding to the target nucleotide sequence in an RNA-guided sequence-specific manner. Although RGN can cut the target sequence when combined, the term RGN also encompasses RGNs that can bind to the target sequence but do not cut the inactivated nuclease of the target sequence. Single-stranded or double-stranded breaks can be caused by cutting the target strand and / or non-target strand of the target sequence by RGN. RGNs that can only cut the single strand of a double-stranded target nucleic acid molecule are referred to herein as nickases.

[0155] The RGN system disclosed herein comprises an RGN that binds to a TRAC target sequence disclosed herein. In some embodiments, the RGN recognizes a PAM having a consensus nucleotide sequence, or an active fragment or variant thereof, comprising: NNNNCC (where N is A, C, T / U, or G; and R is G or A) at the 3' position of the target sequence on its non-target strand, or an active fragment or variant thereof. In some embodiments, the RGN recognizes a PAM having a consensus nucleotide sequence, or an active fragment or variant thereof, comprising: NNRNCC (where N is A, C, T / U, or G; and R is G or A) at the 3' position of the target sequence on its non-target strand, or an active fragment or variant thereof. In some embodiments, an active fragment or variant of an RGN that recognizes such a PAM sequence is capable of binding to the target sequence, and in some embodiments, is capable of cleaving or nicking the target sequence.

[0156] In some embodiments, RGNs or active variants or fragments thereof that are capable of binding to a target sequence adjacent to a PAM consensus sequence such as NNNNCC or NNRNCC (i.e., capable of recognizing a PAM consensus sequence) are used in the compositions and methods disclosed herein. In some embodiments, RGNs or active variants or fragments thereof that are capable of binding to a target sequence adjacent to a PAM consensus sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GGGCCCAG, TGTGCCTC, AAAACC RGNs containing a target sequence having a complete PAM sequence as set forth in any one of GT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG, or active variants or fragments thereof, are used in the compositions and methods disclosed herein. In some embodiments, the PAM sequence is 3' to the target sequence on its non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence as set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259. In some embodiments, the RGN binds to a guide RNA having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 204. In some embodiments, the RGN binds to a guide RNA having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 205. In some embodiments, the RGN binds to a guide RNA having the sequence set forth in SEQ ID NO: 204 or 205.In some embodiments, the RGN binds to a guide RNA comprising: a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, and 334, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, and 335, or an active variant or fragment thereof. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence having the nucleotide sequence set forth in SEQ ID NO: 106, or a nucleotide sequence that differs from SEQ ID NO: 106 by 1 to 8 nucleotides in length and / or sequence. In some embodiments, the RGN binds to a guide RNA comprising a tracrRNA that has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 107. In some embodiments, the RGN binds to a guide RNA comprising a tracrRNA having the nucleotide sequence set forth in SEQ ID NO: 107.

[0157] The RGNs useful in the compositions and methods disclosed herein can be wild-type RGN sequences derived from bacterial or archaeal species. Alternatively, the RGNs can be variants or fragments of wild-type polypeptides. For example, wild-type RGNs can be modified to alter nuclease activity or change PAM specificity. In some embodiments, the RGNs are not naturally occurring. RGN systems can be classified into Class 1 or Class 2. Class 1 and Class 2 systems are subdivided into various types (Types I, II, III, IV, V, VI), with some types further subdivided into subtypes (e.g., Type II-A, Type II-B, Type II-C, Type VA, Type VB). Class 2 systems contain a single effector nuclease and include Types II, V, and VI.

[0158] In certain embodiments, RGN is a naturally occurring type II CRISPR effector protein or an active variant or fragment thereof. As used herein, the term "type II CRISPR-Cas protein," "type II CRISPR-Cas effector protein," or "type II RNA-guided nuclease" refers to an RGN that requires trans-activation RNA (tracrRNA) and comprises two nuclease domains (i.e., RuvC and HNH), each of which is responsible for cutting a single strand of a double-stranded DNA molecule. Representative type II RGNs include Streptococcus pyogenes Cas9 proteins, such as Streptococcus pyogenes Cas9 (SpCas9 or SpyCas9) or SpCas9 nickases, whose sequences are shown in SEQ ID NOs: 324 and 325, respectively, and are described in U.S. Patent Nos. 10,000,772 and 8,697,359, each of which is incorporated herein by reference in its entirety. SpCas9 recognizes an NGG PAM sequence 3' of the target sequence, and some published TRAC target sequences can be targeted with SpCas9 associated with guide RNAs, as shown in Table 2 of the Examples. Another representative Cas9 ortholog that recognizes an NNNNCC PAM sequence 3' of the target sequence includes the compact, highly accurate Neisseria meningitidis Cas9 (Nme2Cas9), whose sequence is shown in SEQ ID NO: 326 and described in Edraki et al. Mol Cell. 2019 Feb 21; 73(4): 714-726.

[0159] Non-limiting examples of RGN systems and corresponding crRNA sequences and tracrRNA sequences (if desired) that can be used in the compositions and methods disclosed herein are presented in Table 1 below and in Examples 1 to 4 and Figures 1 to 10Further described in Table 1. In certain embodiments, the RGN system of the present disclosure includes the RGNs listed in Table 1 or their nickase or nuclease inactive variants. Also provided are guide RNA sequences (crRNA repeats and tracrRNA sequences) that can be used with each RGN in Table 1, as well as consensus PAM sequences (if known). In certain embodiments, the RGNs of the present disclosure include active variants of the RGNs listed in Table 1 (RGNs capable of binding to nucleic acid molecules in an RNA-guided manner) that have 80% to 99% or more sequence identity with any of the amino acid sequences listed in Table 1, including but not limited to about or more than about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more. In certain embodiments, the RGNs of the present disclosure include RGNs having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the RGN amino acid sequences disclosed in Table 1. In some embodiments, the RGNs of the present disclosure include fragments of the RGNs listed in Table 1, such as fragments that differ by as few as 1-15 amino acid residues, as few as 1-10, such as 6-10, as few as 5, as few as 4, as few as 3, as few as 2, or as few as 1 amino acid residue. In certain embodiments, the RGN comprises an N-terminal or C-terminal truncation, which can comprise a deletion of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 amino acids or more from the N- or C-terminus of the polypeptide. In some embodiments, the RGN comprises an internal deletion, which can comprise a deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60 amino acids or more.

[0160] Table 1. Non-limiting examples of RNA-guided nucleases and corresponding crRNA repeat sequences, tracrRNA sequences, and PAM sequences.

[0161]

[0162]

[0163] N=A, C, T / U or G; R=G or A

[0164]

[0165] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO: 105, or an active variant or fragment thereof, wherein the RGN is capable of binding to a target sequence adjacent to a PAM consensus sequence as set forth in NNNNCC. In some embodiments, the PAM sequence is 3' to the target sequence on its non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence as set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588, or an active variant or fragment thereof.

[0166] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO: 105, or an active variant or fragment thereof, wherein the RGN is capable of binding to an adjacent target sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACC In some embodiments, the PAM sequence is 3' to the target sequence on the non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence as set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582. In some embodiments, the RGN binds to a guide RNA having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 204. In some embodiments, the RGN binds to a guide RNA having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 205. In some embodiments, the RGN binds to a guide RNA having a sequence as set forth in SEQ ID NOs: 204 or 205.In some embodiments, the RGN binds a guide RNA comprising a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588, or an active variant or fragment thereof. In some embodiments, the RGN binds a guide RNA comprising a CRISPR repeat sequence as set forth in SEQ ID NO: 106, or an active variant or fragment thereof. In some embodiments, the RGN binds a guide RNA comprising a tracrRNA as set forth in SEQ ID NO: 107, or an active variant or fragment thereof.

[0167] RGNs useful in the methods and compositions disclosed herein include the APG05083.1 RNA-guided nuclease, the amino acid sequence of which is set forth in SEQ ID NO: 327, and active fragments or variants thereof that retain the ability to bind to a target sequence in an RNA-guided, sequence-specific manner. In some embodiments, active variants of the RGNs disclosed herein comprise an amino acid sequence having at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO: 327. In some embodiments, the active fragment of APG05083.1 RGN comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050 or more consecutive amino acid residues of the amino acid sequence shown in SEQ ID NO: 327.

[0168] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO: 327, or an active variant or fragment thereof, wherein the RGN is capable of binding to a target sequence adjacent to a PAM consensus sequence as set forth in NNNNCC. In some embodiments, the PAM sequence is 3' to the target sequence on its non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence as set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588, or an active variant or fragment thereof.

[0169] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO: 327, or an active variant or fragment thereof, wherein the RGN is capable of binding to an adjacent sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACC In some embodiments, the PAM sequence is 3' to the target sequence on the non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence set forth in any one of SEQ ID NOs: 198-200, 202-213, 215-233, 235-241, 243-259, 521-523, 525-536, 538-556, 558-564, and 566-582. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588, or an active variant or fragment thereof.

[0170] RGNs useful in the methods and compositions disclosed herein include the APG07513.1 RNA-guided nuclease, the amino acid sequence of which is set forth in SEQ ID NO: 330, and active fragments or variants thereof that retain the ability to bind to a target sequence in an RNA-guided, sequence-specific manner. In some embodiments, active variants of the RGNs disclosed herein comprise an amino acid sequence having at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence of SEQ ID NO: 330. In some embodiments, the active fragment of APG07513.1 RGN comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050 or more consecutive amino acid residues of the amino acid sequence shown in SEQ ID NO: 330.

[0171] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO: 330, or an active variant or fragment thereof, wherein the RGN is capable of binding to a target sequence adjacent to a PAM consensus sequence as set forth in NNNNCC. In some embodiments, the PAM sequence is 3' to the target sequence on its non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence as set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588, or an active variant or fragment thereof.

[0172] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO: 330, or an active variant or fragment thereof, wherein the RGN is capable of binding to an adjacent target sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACC In some embodiments, the PAM sequence is 3' to the target sequence on the non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence set forth in any one of SEQ ID NOs: 198-200, 202-213, 215-233, 235-241, 243-259, 521-523, 525-536, 538-556, 558-564, and 566-582. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588, or an active variant or fragment thereof.

[0173] RGNs useful in the methods and compositions disclosed herein include the APG08290.1 ​​RNA-guided nuclease, the amino acid sequence of which is set forth in SEQ ID NO: 333, and active fragments or variants thereof that retain the ability to bind to a target sequence in an RNA-guided, sequence-specific manner. In some embodiments, active variants of the RGNs disclosed herein comprise an amino acid sequence having at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the amino acid sequence of SEQ ID NO: 333. In some embodiments, the active fragment of APG08290.1 ​​RGN comprises at least 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050 or more consecutive amino acid residues of the amino acid sequence shown in SEQ ID NO: 333.

[0174] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO: 333, or an active variant or fragment thereof, wherein the RGN is capable of binding to a target sequence adjacent to a PAM consensus sequence as set forth in NNRNCC. In some embodiments, the PAM sequence is 3' to the target sequence on its non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence as set forth in any of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582. In some embodiments, the RGN binds a guide RNA comprising a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588, or an active variant or fragment thereof. In some embodiments, the RGN binds a guide RNA comprising a CRISPR repeat sequence as set forth in SEQ ID NO: 334, or an active variant or fragment thereof. In some embodiments, the RGN binds a guide RNA comprising a tracrRNA as set forth in SEQ ID NO: 335, or an active variant or fragment thereof.

[0175] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO: 333, or an active variant or fragment thereof, wherein the RGN is capable of binding to an adjacent target sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACC In some embodiments, the PAM sequence is 3' to the target sequence on the non-target strand. In some embodiments, the RGN binds to a guide RNA having a sequence set forth in any one of SEQ ID NOs: 198-200, 202-213, 215-233, 235-241, 243-259, 521-523, 525-536, 538-556, 558-564, and 566-582. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence as set forth in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587, or an active variant or fragment thereof, and a tracrRNA as set forth in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588, or an active variant or fragment thereof.

[0176] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO:324, or an active variant or fragment thereof, wherein the RGN is capable of binding to a target sequence adjacent to a complete PAM sequence as set forth in GGGCCCAG. In some embodiments, the PAM sequence is 3' to the target sequence on its non-target strand. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence as set forth in SEQ ID NO:407, or an active variant or fragment thereof, and a tracrRNA as set forth in SEQ ID NO:408, or an active variant or fragment thereof.

[0177] In some embodiments, the compositions and methods disclosed herein include an RGN capable of binding to a target sequence disclosed herein, or an RGN having an amino acid sequence as set forth in SEQ ID NO:404, or an active variant or fragment thereof, wherein the RGN is capable of binding to a target sequence adjacent to a complete PAM sequence as set forth in CAGGCCAA. In some embodiments, the PAM sequence is 3' to the target sequence on its non-target strand. In some embodiments, the RGN binds to a guide RNA comprising a CRISPR repeat sequence as set forth in SEQ ID NO:405, or an active variant or fragment thereof, and a tracrRNA as set forth in SEQ ID NO:406, or an active variant or fragment thereof.

[0178] According to the present invention, the target sequence within the TRAC gene disclosed in the present invention is bound by the RGN. The target strand of the target sequence hybridizes with the guide RNA associated with the RGN. If the polypeptide has nuclease activity, the target strand and / or non-target strand of the target sequence (e.g., target DNA sequence) can then be cut by the RGN. The term "cut" or "cutting" refers to the hydrolysis of at least one phosphodiester bond within the backbone of one or both chains of a double-stranded target sequence (e.g., target DNA sequence), which can result in single-strand or double-strand breaks within the target DNA sequence. Cutting of the target sequence disclosed in the present invention can result in staggered breaks or blunt ends.

[0179] In some embodiments, the RGN used in the compositions and methods disclosed herein is used as a nickase, which only cuts the single strand of a double-stranded target sequence (e.g., a target DNA sequence). Such RGN has a single functional nuclease domain. In some embodiments, a nickase can cut the target strand or non-target strand of a double-stranded target sequence (e.g., a target DNA sequence). In embodiments using a nickase, in order to achieve double-stranded cleavage of the target sequence in the TRAC gene, two nickases are needed, each of which cuts the single strand in the target sequence. In some embodiments, an additional nuclease domain has been mutated so that nuclease activity is reduced or eliminated.

[0180] In some embodiments, RGNs completely lack nuclease activity and are referred to herein as nuclease-inactive or nuclease-inactive. Any method known in the art for introducing mutations into amino acid sequences, such as PCR-mediated mutagenesis and site-directed mutagenesis, can be used to generate nickase- or nuclease-inactive RGNs. See, for example, U.S. Publication No. 2014 / 0068797 and U.S. Patent No. 9,790,490; each of which is incorporated herein by reference in its entirety.

[0181] In some embodiments, nucleases other than RGN are used in the compositions and methods disclosed herein. These nucleases can bind to other target sequences of the TRAC gene that are different from the target sequences disclosed herein. As used herein, the term "nuclease" refers to an enzyme that catalyzes the cutting of the phosphodiester bond between nucleotides in a nucleic acid molecule. Typically, a nuclease is an endonuclease that is capable of cutting the phosphodiester bond between nucleotides in a nucleic acid molecule. In some embodiments, the sequence-specific nuclease is selected from the group consisting of a meganuclease, a zinc finger nuclease, a TAL effector DNA binding domain-nuclease fusion protein (TALEN), and an RNA-guided nuclease (RGN) or a variant thereof, wherein the nuclease activity has been reduced or inhibited.

[0182] As used herein, the term "meganuclease" or "homing endonuclease" refers to an endonuclease that binds to a recognition site within double-stranded DNA of 12 to 40 bp in length. Non-limiting examples of meganucleases are those belonging to the LAGLIDADG family that contain the conserved amino acid motif LAGLIDADG (SEQ ID NO: 410). The term "meganuclease" may refer to a dimeric or single-chain meganuclease.

[0183] As used herein, the term "zinc finger nuclease" or "ZFN" refers to a chimeric protein comprising a zinc finger DNA binding domain and a nuclease domain.

[0184] As used herein, the term "TAL effector DNA binding domain-nuclease fusion protein" or "TALEN" refers to a chimeric protein comprising a TAL effector DNA binding domain and a nuclease domain.

[0185] RGNs or nucleases (such as meganucleases, zinc finger nucleases, or TALENs) that lack nuclease activity and therefore act as DNA-binding polypeptides can be used to deliver fusion polypeptides, polynucleotides, or small molecule payloads to specific genomic locations. In some embodiments, the RGN polypeptide, guide RNA, or nuclease can be fused to a detectable label to allow detection of a specific sequence. The detectable label or purification tag can be located directly or indirectly via a linker peptide at the N-terminus, C-terminus, or internal position of the RNA-guided nuclease. In some embodiments, the RGN component of the fusion protein is a nuclease-inactivated RGN. In some embodiments, the RGN component of the fusion protein is an RGN with nickase activity.

[0186] A detectable label is a molecule that can be visualized or otherwise observed. A detectable label can be fused to an RGN as a fusion protein (e.g., a fluorescent protein), or can be a small molecule conjugated to an RGN polypeptide that can be detected visually or otherwise. Detectable labels that can be fused to an RGN disclosed herein as a fusion protein include any detectable protein domain, including but not limited to fluorescent proteins or protein domains detectable with specific antibodies. Non-limiting examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, EGFP, ZsGreen1) and yellow fluorescent proteins (e.g., YFP, EYFP, ZsYellow1). Non-limiting examples of small molecule detectable labels include radiolabels, such as 3 H and 35 S.

[0187] RGN polypeptides may also include a purification tag, which is any molecule that can be used to isolate a protein or fusion protein from a mixture (e.g., a biological sample, culture medium). Non-limiting examples of purification tags include biotin, myc, maltose binding protein (MBP), glutathione-S-transferase (GST), and 3X FLAG tags.

[0188] Alternatively, a nuclease-inactivated RGN can be targeted to a TRAC gene to alter the expression of that gene. In some embodiments, binding of the nuclease-inactivated RGN to a target sequence within a TRAC gene results in a decrease in TRAC expression by interfering with the binding of an RNA polymerase or transcription factor within the targeted genomic region. In some embodiments, the RGN (e.g., a nuclease-inactivated RGN) or its composite guide RNA further comprises an expression regulator that, upon binding to a target sequence within a TRAC gene, acts to inhibit or activate the expression of the target gene.

[0189] In some embodiments, the expression regulator comprises a transcriptional repressor domain that interacts with transcriptional control elements and / or transcriptional regulatory proteins (such as RNA polymerases and transcription factors) to reduce or terminate transcription of the TRAC gene. Transcriptional repressor domains are known in the art and include, but are not limited to, Sp1-like repressors, IκB, and Krüppel-associated box (KRAB) domains.

[0190] In some embodiments, the expression regulator comprises a transcriptional activation domain that interacts with a transcriptional control element and / or a transcriptional regulatory protein (such as an RNA polymerase and a transcription factor) to increase or activate the transcription of the TRAC gene. Transcriptional activation domains are known in the art and include but are not limited to herpes simplex virus VP16 activation domains and NFAT activation domains.

[0191] In some embodiments, expression regulator regulates the expression of TRAC sequence by epigenetic mechanism.In some embodiments, epigenetic regulator covalently modifies DNA or histone to change histone structure and / or chromosomal structure and do not change DNA sequence, causes the variation (for example, raise or lower) of genetic expression.The limiting examples of epigenetic modification comprises methylation and the hydroxymethylation of cytosine residues in the acetylation or methylation, arginine methylation, serine and threonine phosphorylation, lysine ubiquitination and SUMOylation (sumoylation) and DNA of histone of lysine residues.The limiting examples of epigenetic regulator comprises histone acetyltransferase, histone deacetylase, histone methyltransferase, histone demethylase, DNA methyltransferase and DNA demethylase.

[0192] Nuclease-inactivated RGNs or RGNs with nickase activity can be targeted to specific genomic locations to modify the sequence of the target polynucleotide by fusing to base editing polypeptides (e.g., deaminase polypeptides or active variants or fragments thereof) that directly chemically modify (e.g., deaminase) nucleobases, resulting in conversion from one nucleobase to another. The base editing polypeptide can be fused to the RGN at its amino terminus (N-terminus) or carboxyl terminus (C-terminus). In addition, the base editing polypeptide can be fused to the RGN via a peptide linker. The fusion of base editing polypeptides and RGNs is described in International Application No. PCT / IB2023 / 061192, filed on November 6, 2023, which is incorporated herein by reference in its entirety. Non-limiting examples of deaminase polypeptides that can be used in such compositions and methods include cytosine deaminases or adenosine deaminases (such as the adenosine deaminase base editors described in Gaudelli et al. (2017) Nature 551:464-471, U.S. Publication Nos. 2017 / 0121693 and 2018 / 0073012, and International Publication No. WO 2018 / 027078, or any deaminase disclosed in International Publication No. WO 2020 / 139783, International Publication No. WO 2022 / 056254, International Application No. PCT / US2022 / 021271 filed on March 22, 2022, and International Application No. PCT / IB2023 / 061192 filed on November 6, 2023, each of which is incorporated herein by reference in its entirety). In some embodiments, the deaminase polypeptides useful in such presently disclosed compositions and methods are deaminases disclosed in Table 17 of International Publication No. WO 2020 / 139783, which is herein incorporated by reference in its entirety.

[0193] In addition, some fusion proteins between RGN known in the art and base editing enzymes (e.g., cytosine deaminase) may also include at least one uracil stabilizing polypeptide, which increases the mutation rate of cytidine, deoxycytidine or cytosine in nucleic acid molecules to thymidine, deoxythymidine or thymine by deaminase. Non-limiting examples of uracil stabilizing polypeptides include those disclosed in PCT Publication No. WO 2021 / 217002 and PCT Publication No. WO 2022 / 015969, each of which is incorporated herein by reference in its entirety. Disclosed uracil stabilizing polypeptides include USP2 and uracil glycosylase inhibitor (UGI) domains, which can increase base editing efficiency. Therefore, the fusion protein may include RGN as described herein or its variant, deaminase and optionally at least one uracil stabilizing polypeptide, such as UGI or USP2. In embodiments, the RGN fused to the base editing polypeptide is a nickase that cleaves the DNA strand without the action of the base editing polypeptide (e.g., a deaminase).

[0194] RGN can be fused with a reverse transcriptase (RT) editing polypeptide (also known as a lead editing polypeptide). RT editing (also known as lead editing) is a versatile and precise genome editing method that uses a nucleic acid-programmable DNA-binding protein working in conjunction with a polymerase to directly write new genetic information into a specified DNA site (described in, for example, US11,447,770B1; WO2021072328; WO2021226558; WO2020156575; WO2021042047; US11193123; each of these patents is incorporated herein by reference in its entirety). The RT editing system uses RGNs that act as nicking enzymes, and the system is programmed with RT editing guide RNAs. RT editing guide RNAs are guide RNAs that both specify the target sequence and, by engineering extensions onto the guide RNA (e.g., at the 5' or 3' end, or in the internal portion of the guide RNA), provide a template for the polymerization of the replacement chain containing the editor. The RGN nickase / RT editing polypeptide fusion is guided to the target sequence by the RT editing guide RNA and produces a nick on the non-target chain upstream of the sequence to be edited and upstream of the PAM, thereby producing a 3' flap on the non-target chain. The RT editing guide RNA includes a primer binding site (PBS) complementary to the 3' flap of the non-target chain. In some embodiments, the length of the PBS is at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. In certain embodiments, the RT editing guide RNA comprises a PBS of at least 5 (e.g., at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 28, 19, or 20) nucleotides in length. In some embodiments, the RT editing guide RNA may comprise a PBS of at least 8 nucleotides in length. The hybridization of the PBS and the 3' flap of the non-target chain allows the use of the extended region of the RT editing guide RNA as a template for the polymerization of the displacement chain containing the editor. The extended region of the RT editing guide RNA can be formed by RNA or DNA. In the case of an RNA extended region, the polymerase of the RT editor can be an RNA-dependent DNA polymerase (such as a reverse transcriptase). In the case of a DNA extended region, the polymerase of the RT editor can be a DNA-dependent DNA polymerase.

[0195] The replacement strand containing the desired edit (e.g., a single nucleobase substitution) shares the same sequence as the non-target strand of the target sequence to be edited (except that it includes the desired edit). Through DNA repair and / or replication machinery, the non-target strand of the target sequence is replaced by a newly synthesized replacement strand containing the desired edit. In some cases, RT editing can be considered a "search and replace" genome editing technology because the RT editor not only searches and locates the desired target sequence to be edited, but also simultaneously encodes a replacement strand containing the desired edit, which is installed at the position of the corresponding non-target strand of the target sequence. Therefore, in some embodiments, the guide RNA of the present disclosure includes an extension region, which includes an editing template for RT editing. In some embodiments, the RT editing polypeptide that can be fused to RGN includes a DNA polymerase. In certain embodiments, the DNA polymerase is a reverse transcriptase. In certain embodiments, RGN is a nickase.

[0196] RGN or other nucleases fused to a polypeptide or domain can be separated or connected by a linker. As used herein, the term "linker" refers to a chemical group or molecule that connects two molecules or parts, for example, a binding domain and a cleavage domain of a nuclease. In some embodiments, a linker connects the gRNA binding domain of an RGN and a detectable marker or epigenetic regulator. In some embodiments, a linker connects an RGN inactivated by a nuclease and a detectable marker or epigenetic regulator. Typically, a linker is located between or flanking two groups, molecules or other parts and is connected to each group, molecule or other part via a covalent bond, thereby connecting the two. In some embodiments, a linker is an amino acid or multiple amino acids (e.g., a peptide or protein). In some embodiments, a linker is an organic molecule, group, polymer or chemical part. In some embodiments, the length of the linker is 5 to 100 amino acids, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100, 100 to 150, or 150 to 200 amino acids in length. Longer or shorter linkers are also contemplated.

[0197] The compositions and methods disclosed herein can utilize RGNs or other nucleases comprising at least one nuclear localization signal (NLS) to enhance the transport of RGNs to the nucleus. Nuclear localization signals are known in the art and typically comprise a stretch of basic amino acids (see, e.g., Lange et al., J. Biol. Chem. (2007) 282: 5101-5105). In some embodiments, RGNs comprise 2, 3, 4, 5, 6 or more nuclear localization signals. The nuclear localization signal can be a heterologous NLS. Non-limiting examples of nuclear localization signals that can be used for the RGNs disclosed herein are the nuclear localization signals of SV40 large T antigen, nucleoplasmin, and c-Myc (see, e.g., Ray et al. (2015) Bioconjug Chem 26 (6): 1004-7). In embodiments, the RGN comprises an NLS sequence as shown in SEQ ID NO: 411 or 412. The RGN or other nucleases can comprise one or more NLS sequences at its N-terminus, C-terminus, or both the N-terminus and the C-terminus. For example, an RGN may comprise two NLS sequences at the N-terminal region and four NLS sequences at the C-terminal region.

[0198] In some embodiments, the compositions and methods disclosed herein utilize RGN or other nucleases, which include at least one cell-penetrating domain that promotes the cellular uptake of RGN. Cell-penetrating domains are known in the art and typically include multiple sections of positively charged amino acid residues (i.e., polycationic cell-penetrating domains), alternating polar amino acid residues and non-polar amino acid residues (i.e., amphipathic cell-penetrating domains) or hydrophobic amino acid residues (i.e., hydrophobic cell-penetrating domains) (see, e.g., Milletti F. (2012) Drug Discov Today 17: 850-860). A non-limiting example of a cell-penetrating domain is a transactivating transcriptional activator (TAT) from human immunodeficiency virus 1.

[0199] The nuclear localization signal and / or cell penetrating domain can be located at the N-terminus, C-terminus, or an internal location of the RGN or other nuclease.

[0200] V. Polynucleotides encoding RNA-guided nucleases, single guide RNAs, CRISPR RNAs, and / or tracrRNAs

[0201] The present disclosure provides polynucleotides comprising or encoding RGN, crRNA, tracrRNA and / or sgRNA disclosed herein. The polynucleotides disclosed herein include those comprising or encoding crRNA comprising a spacer capable of targeting a bound RGN to a target sequence in a TRAC gene, the spacer having a nucleotide sequence as shown in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0202] The use of the term "polynucleotide" or "nucleic acid molecule" is not intended to limit the present disclosure to polynucleotides comprising DNA. One of ordinary skill in the art will recognize that polynucleotides can comprise ribonucleotides (RNA) as well as combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogs. These include peptide nucleic acids (PNA), PNA-DNA chimeras, locked nucleic acids (LNA), and phosphorothioate-linked sequences. The polynucleotides disclosed herein also encompass all forms of sequences, including but not limited to single-stranded forms, double-stranded forms, DNA-RNA hybrids, triplex structures, stem-loop structures, and the like.

[0203] In some of the embodiments in which the compositions and methods disclosed herein comprise a nucleic acid molecule encoding an RGN, the nucleic acid molecule is an mRNA (messenger RNA) molecule. mRNA refers to any polynucleotide that encodes a polypeptide of interest and can be translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. In some embodiments, the essential components of an mRNA molecule include at least a coding region, a 5' untranslated region (UTR), a 3' untranslated region (UTR), a 5' cap, and a poly-A tail. In some embodiments, an mRNA encoding an RGN useful in the methods and compositions disclosed herein may include one or more structural and / or chemical modifications or alterations that impart useful properties to the polynucleotide. For example, useful properties of an mRNA include a lack of substantial induction of an innate immune response in cells into which the mRNA is introduced. A "structural" feature or modification is one in which two or more linked nucleotides are inserted, deleted, duplicated, inverted, or randomized in an mRNA without significant chemical modification of the nucleotides themselves. Because chemical bonds must be broken and reformed to achieve the structural modification, the structural modification is chemical in nature and is therefore a chemical modification. However, the structural modification will result in a different nucleotide sequence. Chemical modifications to the mRNA may involve the inclusion of 5-methylcytosine, N1-methyl-pseudouridine, pseudouridine, 2-thiouridine, 4-thiouridine, 5-methoxyuridine, 2'fluoroguanosine, 2'fluorouridine, 5-bromouridine, 5-(2-methoxycarbonylvinyl)uridine, 5-[3(1-E-propenylamino)]uridine, α-thiocytidine, N6-methyladenosine, 5-methylcytidine, N4-acetylcytidine, 5-formylcytidine, or a combination thereof in the mRNA.

[0204] Nucleic acid molecules encoding RGNs can be codon-optimized for expression in an organism of interest (e.g., a mammal). A "codon-optimized" coding sequence is a polynucleotide coding sequence whose codon usage frequency is designed to mimic the preferred codon usage frequency or transcription conditions of a particular host cell. Expression in a particular host cell or organism is enhanced by altering one or more codons at the nucleic acid level, such that the translated amino acid sequence is not altered. Nucleic acid molecules can be fully or partially codon-optimized. Codon tables and other references providing preference information for a wide range of organisms are available in the art (see, e.g., Gaspar et al. (2012) Bioinformatics 28(20):2683–2684; Komar et al. (1998) Biol. Chem. 379(10):1295–1300; and Inouye et al. (2015) Protein Expr. Purif. 109:47–54). Non-limiting examples of codon-optimized coding sequences of RGNs useful in the presently disclosed compositions and methods include SEQ ID NOs: 108, 428, and 429.

[0205] The polynucleotides encoding the RGN, crRNA, tracrRNA and / or sgRNA provided herein can be provided in an expression cassette for in vitro expression or expression in a cell, embryo or organism of interest. The cassette will include 5' and 3' regulatory sequences, which are operably connected to the polynucleotides encoding the RGN, crRNA, tracrRNA and / or sgRNA provided herein, which allow expression of the polynucleotides. The cassette may additionally contain at least one other gene or genetic element to be co-transformed into an organism. When including other genes or elements, these components are operably connected. The term "operably connected" is intended to represent the functional connection between two or more elements. For example, the operably connected between a promoter and a coding region of interest (e.g., a region encoding RGN, crRNA, tracrRNA and / or sgRNA) is a functional connection that allows expression of the coding region of interest. The operably connected elements can be continuous or discontinuous. When used to refer to the connection of two protein coding regions, operably connected or "operably fused" means that the coding regions are in the same reading frame. In some embodiments, "operably fused" polypeptides means that the structure and / or biological activity of each individual peptide is also present in the fusion. Alternatively, additional genes or elements can be provided on multiple expression cassettes. For example, the nucleotide sequence encoding the RGN disclosed in the present invention can be present on one expression cassette, while the nucleotide sequence encoding crRNA, tracrRNA or complete guide RNA can be on separate expression cassettes. Such expression cassettes provide multiple restriction sites and / or recombination sites for inserting polynucleotides under the transcriptional control of the regulatory region. The expression cassette may additionally contain a selectable marker gene.

[0206] The expression cassette will include in the 5'-3' direction of transcription: a transcription (and in some embodiments, translation) initiation region (i.e., a promoter), a polynucleotide encoding RGN, crRNA, tracrRNA and / or sgRNA of the present disclosure, and a transcription (and in some embodiments, translation) termination region (i.e., termination region) that is functional in the organism of interest. The promoter of the present disclosure can guide or drive the expression of the coding sequence in the host cell. The regulatory region (e.g., promoter, transcriptional regulatory region and translation termination region) can be endogenous or heterologous to the host cell or to each other. As used herein, "heterologous" with respect to a sequence is a sequence derived from an alien species, or if from the same species, a sequence that is substantially modified from its native form in composition and / or genomic site by intentional human intervention. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.

[0207] Convenient termination regions include those from simian virus (SV40), human growth hormone (hGH), bovine growth hormone (BGH), and rabbit beta-globin (rbGlob). See also Proudfoot (1991) Cell 64:671-674; Munroe et al. (1990) Gene 91:151-158; Schek et al. (1992) Molecular and Cellular Biology 12(12):5386-5393; Gil and Proudfoot (1987) Cell 49(3):399-406; Goodwin and Rottman (1992) The Journal of Biological Chemistry 267(23):16330-16334; and Lanoix and Acheson (1988) EMBO J. 7(8):2515-2522.

[0208] Additional regulatory signals include, but are not limited to, start sites for transcriptional initiation, operators, activators, enhancers, other regulatory elements, ribosome binding sites, start codons, termination signals, etc. See, for example, Sambrook et al. (1992) Molecular Cloning: A Laboratory Manual, edited by Maniatis et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY), hereinafter referred to as "Sambrook 11"; Davis et al., eds. (1980) Advanced Bacterial Genetics (Cold Spring Harbor Laboratory Press), Cold Spring Harbor, NY, and references cited therein.

[0209] In preparing the expression cassette, the various DNA fragments may be manipulated to provide the DNA sequence in the proper orientation and, if desired, in the correct reading frame. To this end, adapters or linkers may be employed to connect the DNA fragments, or other manipulations may be involved to provide convenient restriction sites, remove excess DNA, remove restriction sites, etc. To this end, in vitro mutagenesis, primer repair, restriction, annealing, and resubstitutions, such as conversions and transversions, may be involved.

[0210] Many promoters can be used in the practice of the present invention. Promoters can be selected based on the desired results. Nucleic acids can be combined with constitutive, inducible, growth stage specific, cell type specific, tissue preference, tissue specific or other promoters for expression in the organism of interest.

[0211] Exemplary constitutive promoters for expression in the cells of the present disclosure include: SV40 early promoter; mouse mammary tumor virus long terminal repeat (LTR) promoter; adenovirus major late promoter (Ad MLP); herpes simplex virus (HSV) promoter; cytomegalovirus (CMV) promoter, such as CMV immediate early promoter region (CMVIE); Rous sarcoma virus (RSV) promoter; human ubiquitin C promoter (UBC); human U6 small nuclear promoter (U6); enhanced U6 promoter; human H1 promoter from RNA polymerase III (H1); human elongation factor 1 alpha promoter (EF1A); human β-actin promoter (ACTB); human or mouse phosphoglycerate kinase 1 promoter (PGK); chicken β-actin promoter coupled to CMV early enhancer (CAGG); yeast transcription elongation factor promoter (TEF1); and the like. See, e.g., Miyagishi et al. (2002) Nature Biotechnology 20:497-500; Xia et al. (2003) Nucleic Acids Res. 31(17):e100-e100; Pasleau et al. (1985) Gene 38:227–232; Martin-Gallardo et al. (1988) Gene 70:51–56; Oellig and Seliger (1990) J Neurosci Res 26:390–396; Manthorpe et al. (1993) Hum Gene Ther 4:419–431; Yew et al. (1997) Hum Gene Ther 8:575–584; Xu et al. (2001) Gene 272:149–156; Nguyen et al. (2008) J Surg Res 148:60–66; Costa et al. (2005) Nat Meth. 2:259–260; Lam and Truong (2020) ACS Synth. Biol. 9(10):2625–2631.

[0212] Examples of inducible promoters include stress-regulated promoters, such as the Hsp70 and Hsp90 promoters (Wurm et al. (1986) Proc. Natl. Acad. Sci. USA. 83:5414-5418; Nover L. Heat Shock Response. CRC Press; Boca Raton, FL, USA: 1991); metal-regulated promoters (Mayo et al. (1982) Cell. 29:99-108; Searle et al. (1985) Mol. Cell. Biol. 5:1480-1489); hormone-responsive promoters, including the glucocorticoid-responsive promoter (Hynes et al. (1981) Proc. Natl. Acad. Sci. USA. 78:2038-2042; Klock et al. (1987) Nature. 329:734-736). Chemically-regulated promoters from prokaryotes that have been used include isopropyl-β-D-thiogalactoside (IPTG)-regulated promoters, lactose-regulated promoters, and tetracycline-regulated promoters (see, e.g., Gossen et al. (1993) Trends Biochem Sci. 18:471–475; Gossen and Bujard (1992) Proc. Natl Acad. Sci. USA 89:5547–5551; Zhou et al. (2006) Gene Ther. 13:1382–1390).Inducible expression can be obtained using operator systems including AlcR / acetaldehyde, ArgR / L-arginine, BirA / biotinyl-AMP, CymR / cumate, EthR / 2-phenylethylbutyrate, HdnoR / 6-hydroxynicotine, HucR / uric acid, MphR(A) / macrolides, PIP / streptogramin, Rex / NADH, RheA / heat, ScbR / SCB1, TraR / 3-oxo-C8-HSL, and TtgR / phloretin; see, e.g., U.S. Pat. No. 8,728,759 B2; U.S. Pat. No. 7,745,592 B2; Weber and Fussenegger (2004) Methods Mol. Biol. 267:451–466; Hartenbach et al. (2007) Nucleic Acids Res. 35:e136; Weber et al. (2009) Metab. Eng. 11:117–124; Weber et al. (2008) Proc. Natl. Acad. Sci. USA. 105:9994–9998; Malphettes et al. (2005) Nucleic Acids Res. 33:e107; Kemmer et al. (2010) Nat. Biotechnol. 28:355–360; Weber et al. (2002) Nat. Biotechnol. 20:901–907; Fussenegger et al. (2000) Nat. Biotechnol. 18:1203–1208; Weber et al. (2006) Metab. Eng. 8:273–280; Weber et al. (2003) Nucleic Acids Res. 31:e69; Weber et al. (2003) Nucleic Acids Res. 31:e71; Neddermann et al. (2003) EMBO Rep. 4:159–165; and Gitzinger et al. (2009) Proc. Natl. Acad. Sci. USA. 106:10638–10643.Inducible expression can be obtained using protein-protein interaction systems, including: rapamycin-induced interaction between FKBP12 (FK506 binding protein 12) and mTOR (Rivera et al. (1996) Nat. Med. 2:1028–1032; Belshaw et al. (1996) Proc. Natl. Acad. Sci. USA. 93:4604–46077); abscisic acid (ABA)-regulated interaction between PYL1 (abscisic acid receptor) and ABI1 (protein phosphatase 2C56) (Liang et al. (2011) Sci. Signal. 4(164):rs2-rs2); and light-induced protein-protein interaction systems (Wang et al. (2012) Nat. Methods. 9:266–269; Yamada et al. (2018) Cell. Rep. 25:487–500).

[0213] Tissue-specific or tissue-preferential promoters can be used to target expression constructs for expression in specific tissues. In embodiments, tissue-specific or tissue-preferential promoters are active in mammalian tissues. Examples of tissue-specific or tissue-preferential promoters include promoters that preferentially initiate transcription in certain tissues such as the heart, CNS, or eyes. A "tissue-specific" promoter is a promoter that initiates transcription only in certain tissues. Unlike constitutive expression of a gene, tissue-specific expression is the result of several interacting gene regulatory levels. Therefore, promoters from homologous or closely related species can be preferably used to achieve effective and reliable expression of transgenes in specific tissues. In some embodiments, expression comprises a tissue-preferential promoter. A "tissue-preferential" promoter is a promoter that preferentially initiates transcription in certain tissues, but not necessarily completely or only in certain tissues.

[0214] In some embodiments, the nucleic acid molecules encoding RGN, crRNA, tracrRNA and / or sgRNA comprise cell type-specific promoters. A "cell type-specific" promoter is a promoter that primarily drives expression in certain cell types in one or more organs. Some examples of cells in which cell type-specific promoters may be primarily active include, for example, cytotoxic T cells, regulatory T cells, or stem cells. The nucleic acid molecule may also include a cell type-preferred promoter. A "cell type-preferred" promoter is a promoter that primarily drives expression in certain cell types in one or more organs, but not necessarily entirely or solely. Some examples of cells in which cell type-preferred promoters may preferentially be active include, for example, lymphocytes, neurons, adipocytes, cardiomyocytes, smooth muscle cells, and photoreceptor cells.

[0215] The nucleic acid sequence encoding the RGN, crRNA, tracrRNA and / or sgRNA can be operably linked to a promoter sequence recognized by a bacteriophage RNA polymerase, for example, for in vitro mRNA synthesis. In some embodiments, the in vitro transcribed RNA can be purified for use in the methods described herein. For example, the promoter sequence can be a T7, T3, or SP6 promoter sequence or a variant of a T7, T3, or SP6 promoter sequence. In some embodiments, the expressed protein and / or RNA can be purified for use in the methods of genome modification described herein.

[0216] In embodiments, the polynucleotide encoding the RGN, crRNA, tracrRNA, and / or sgRNA may also be linked to a polyadenylation signal (e.g., the SV40 polyA signal and other signals functional in plants) and / or at least one transcription termination sequence. Additionally, the sequence encoding the RGN may also be linked to a sequence encoding at least one nuclear localization signal, at least one cell penetrating domain, and / or at least one signal peptide capable of transporting the protein to a specific subcellular location, as described elsewhere herein.

[0217] The polynucleotides encoding RGN, crRNA, tracrRNA and / or sgRNA can be present in one or more vectors." vector " refers to a polynucleotide composition for transferring, delivering or introducing nucleic acid into a host cell. Suitable vectors include plasmid vectors, phagemids, cosmids, artificial / mini-chromosomes, transposons and viral vectors (e.g., lentiviral vectors, adeno-associated viral vectors, baculoviral vectors). Vectors can include other expression control sequences (e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, transcription termination sequences), selectable marker sequences (e.g., antibiotic resistance genes), replication origins, etc. Other information can be found in "Current Protocols in Molecular Biology" Ausubel et al., John Wiley & Sons, New York, 2003 or "Molecular Cloning: A Laboratory Manual" Sambrook and Russell, Cold Spring Harbor Press, Cold Spring Harbor, NY, 3rd edition, 2001.

[0218] The vector can also include a selectable marker gene for selecting transformed cells. The selectable marker gene is used to select transformed cells or tissues. The marker gene includes a gene encoding antibiotic resistance, such as the gene encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT). The marker gene can include a gene that allows selection to grow on a specific nutrient or substance, such as dihydrofolate reductase (DHFR; Simonsen and Levinson (1983) Proc. Natl. Acad. Sci. USA 80:2495-2499), histidinol dehydrogenase (hisD; Hartman and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:8047-8051), puromycin-N-acetyltransferase (PAC or puro; de la Luna et al. (1988) Gene 62:121-126), thymidine kinase (TK; Littlefield (1964) Science 145:709-710) and xanthine-guanine phosphoribosyltransferase (XGPRT or gpt; Mulligan and Berg (1981) Proc. Natl. Acad. Sci. USA 78:2072-2076).

[0219] In some embodiments, the expression cassette or vector comprising a sequence encoding an RGN polypeptide may further comprise a sequence encoding crRNA and / or tracrRNA, or a combination of crRNA and tracrRNA to produce sgRNA. The sequence encoding crRNA and / or tracrRNA may be operably linked to at least one transcriptional control sequence for expressing crRNA and / or tracrRNA in an organism or host cell of interest. For example, the polynucleotide encoding crRNA and / or tracrRNA may be operably linked to a promoter sequence recognized by RNA polymerase III (Pol III). Examples of suitable PolIII promoters include, but are not limited to, mammalian U6, U3, H1, and 7SL RNA promoters and rice U6 and U3 promoters, such as the human U6 promoter set forth in SEQ ID NO: 413, and promoters disclosed in U.S. Provisional Application No. 63 / 209,660, filed June 11, 2021, and International Application No. PCT / US2022 / 032940, filed June 10, 2022, each of which is incorporated herein by reference in its entirety, including the promoters set forth herein as SEQ ID NOs: 414 to 423.

[0220] As noted, expression constructs comprising nucleotide sequences encoding RGN, crRNA, tracrRNA and / or sgRNA can be used to transform an organism of interest. The method for transformation involves introducing the nucleotide construct into the organism of interest. "Introduction" means introducing the nucleotide construct into a host cell in a manner that allows the construct to enter the interior of the host cell. The method disclosed herein does not require a specific method for introducing the nucleotide construct into the host organism, only that the nucleotide construct be able to enter the interior of at least one cell of the host organism. The host cell can be a eukaryotic cell or a prokaryotic cell. In some embodiments, the eukaryotic host cell is a mammalian cell, an avian cell or an insect cell. In some embodiments, the eukaryotic cell comprising or expressing the crRNA, tracrRNA, sgRNA and / or RGN disclosed in the present invention or modified by the RGN system disclosed in the present invention is a human cell. In some embodiments, the eukaryotic cell comprising or expressing the crRNA, tracrRNA, sgRNA and / or RGN disclosed in the present invention or modified by the RGN system disclosed in the present invention is a stem cell, including an induced pluripotent stem cell. In some embodiments, the mammalian cell or human cell comprising or expressing the crRNA, tracrRNA, sgRNA and / or RGN disclosed herein or modified by the RGN system disclosed herein is a lymphocyte. In some embodiments, the lymphocyte includes a cytotoxic T cell or a regulatory T cell.

[0221] Methods for introducing nucleotide constructs into host cells are known in the art and include, but are not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

[0222] The methods disclosed herein can produce transformed organisms or cell lines derived from these transformed cells.

[0223] A "transgenic organism" or "transformed organism" or "stably transformed" organism or cell or tissue refers to an organism that has incorporated or integrated a polynucleotide encoding the RGN, crRNA, tracrRNA and / or sgRNA of the present disclosure. It should be recognized that other exogenous or endogenous nucleic acid sequences or DNA fragments can also be incorporated into the host cell. Transformation of the host cell can be performed by infection, conjugation, transfection, microinjection, electroporation, microprojection, gene gun or particle bombardment, electroporation, silica / carbon fiber, ultrasound-mediated, PEG-mediated, calcium phosphate coprecipitation, polycationic DMSO technology, DEAE dextran procedure, as well as viral-mediated, liposome-mediated, etc. Viral-mediated introduction of polynucleotides encoding RGN, crRNA, tracrRNA and / or sgRNA includes retroviral, lentiviral, adenoviral and adeno-associated viral-mediated introduction and expression.

[0224] Transformation can result in stable or transient incorporation of nucleic acids into cells. "Stable transformation" is intended to mean that a nucleotide construct introduced into a host cell is integrated into the host cell's genome and can be inherited by its progeny. "Transient transformation" is intended to mean that a polynucleotide is introduced into a host cell and does not integrate into the host cell's genome.

[0225] In some embodiments, the transformed cells can be introduced into an organism. These cells can be derived from an organism in which the cells are transformed in vitro. These cells can be autologous (derived from the same subject and returned to the same subject), allogeneic (the donor and recipient subject are the same species). Generally speaking, the donor and recipient of the allogeneic cells are fully or partially HLA-paired.

[0226] Polynucleotides encoding or comprising RGNs, crRNAs, tracrRNAs, and / or sgRNAs can also be used to transform any prokaryotic species, including but not limited to archaea and bacteria (e.g., Bacillus, Klebsiella, Streptomyces, Rhizobium, Escherichia, Pseudomonas, Salmonella, Shigella, Vibrio, Yersinia, Mycoplasma, Agrobacterium, Lactobacillus).

[0227] Polynucleotides encoding or comprising RGNs, crRNAs, tracrRNAs, and / or sgRNAs can be used to transform any eukaryotic species, including but not limited to animals (e.g., mammals, humans, insects, fish, birds, and reptiles), fungi, amoebas, algae, and yeast.

[0228] Conventional viral and non-viral gene transfer methods can be used to introduce nucleic acids into mammalian, insect, or avian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of the RGN system to cells in culture or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the vectors described herein), naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes. Viral vector delivery systems include DNA and RNA viruses, which have free genomes or integrated genomes after delivery to cells. For reviews of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel and Feigner, TIBTECH 11:211-217 (1993); Mitani and Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer and Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology, Doerfler and Bohm (eds.) (1995); and Yu et al., Gene Therapy 1: 13-26 (1994).

[0229] Non-viral methods of delivering nucleic acids include lipofection, nucleofection, microinjection, gene guns, virosomes, liposomes, immunoliposomes, polycationic or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced DNA uptake. Lipofection is described in, for example, U.S. Patent Nos. 5,049,386, 4,946,787; and 4,897,355), and lipofection reagents are sold commercially (e.g., Transfectam TM and Lipofectin TM). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides include those of Feigner, WO 91 / 17424; WO 91 / 16024. Can be delivered to cells (e.g., in vitro or ex vivo administration) or target tissues (e.g., in vivo administration). The preparation of lipid:nucleic acid complexes (including targeted liposomes such as immunolipid complexes) is well known to those skilled in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028 and 4,946,787).

[0230] The system based on RNA or DNA virus is used to deliver nucleic acid and utilizes the process of high evolution, for the specific cell in virus targeting body and viral payload is transported to nucleus.Viral vector can be directly applied to patient (in vivo), or they can be used for in vitro treatment cell, and modified cell can optionally be applied to patient (ex vivo).Traditional system based on virus can comprise retrovirus, slow virus, adenovirus, adeno-associated virus and herpes simplex virus vector for gene transfer.Can be integrated into host genome with retrovirus, slow virus and adeno-associated virus gene transfer method, this usually causes the long-term expression of the transgenic of insertion.Additionally, high transduction efficiency has been observed in many different cell types and target tissues.

[0231] The tropism of retroviruses can be altered by incorporating foreign envelope proteins, thereby expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and generally produce high viral titers. Therefore, the choice of retroviral gene transfer system will depend on the target tissue. Retroviral vectors contain cis-acting long terminal repeats, which have the ability to package up to 6-10 kb of foreign sequences. The minimal cis-acting LTRs are sufficient for replication and packaging of the vector, which is then used to integrate the therapeutic gene into the target cells to provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Viral. 66:2731-2739 (1992); Johann et al., J. Viral. 66:1635-1640 (1992); Sommnerfelt et al., Viral. 176:58-59 (1990); Wilson et al., J. Viral. 63:2374-2378 (1989); Miller et al., J. Viral. 65:2220-2224 (1991); PCT / US94 / 05700).

[0232] In applications where transient expression is preferred, adenovirus-based systems can be used. Adenovirus-based vectors are capable of very high transduction efficiencies in many cell types and do not require cell division. High titers and expression levels have been achieved using such vectors. These vectors can be produced in large quantities in relatively simple systems. Adeno-associated virus ("AAV") vectors can also be used to transduce cells with target nucleic acids, e.g., for in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93 / 24641; Katin, Human Gene Therapy 5:793-801 (1994); Muzyczka, I. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors is described in numerous publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat and Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Viral. 63:03822-3828 (1989). Packaging cells are typically used to form viral particles capable of infecting host cells. Such cells include 293 cells for packaging adenoviruses, and ψJ2 cells or PA317 cells for packaging retroviruses.

[0233] Viral vectors used in gene therapy are typically produced by producer cell lines that package nucleic acid vectors into viral particles. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into the host, with other viral sequences replaced by expression cassettes for the polynucleotide to be expressed. The missing viral functions are typically provided in trans by the packaging cell line. For example, AAV vectors used for gene therapy typically only have ITR sequences from the AAV genome, which are required for packaging and integration into the host genome. The viral DNA is packaged in a cell line that contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacks ITR sequences.

[0234] This cell line can also be infected with adenovirus as a helper. The helper virus promotes the replication of the AAV vector and the expression of the AAV genes from the helper plasmid. Due to the lack of ITR sequences, the helper plasmid is not packaged in large quantities. Contamination with adenovirus can be reduced by, for example, heat treatment, as adenovirus is more sensitive to heat treatment than AAV. Other methods for delivering nucleic acids to cells are known to those skilled in the art. See, for example, US20030087817, which is incorporated herein by reference.

[0235] In some embodiments, host cells are transiently or non-transiently transfected with one or more nucleic acid molecules or vectors described herein. In some embodiments, cells are transfected as they naturally occur in a subject. In some embodiments, the transfected cells are taken from a subject. In embodiments, the cells are derived from cells taken from a subject, such as a cell line. In some embodiments, the cell line can be a mammalian, insect, or avian cell. A variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, C8161, CCRF-CEM, MOLT, mIMCD-3, NHDF, HeLaS3, Huhl, Huh4, Huh7, HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panel, PC-3, TF1, CTLL-2, CIR, Rat6, CVI, RPTE, A10, T24, 182, A375, ARH-77, Calul, SW480, SW620, SKOV3, SK-UT, CaCo2, P388D1, SEM-K2, WEHI-231, HB56, TIB55, lurkat, 145.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, and HeLa T4.COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelial cells, BALB / 3T3 mouse embryonic fibroblasts, 3T3 Swiss, 3T3-L1, 132-d5 human fetal fibroblasts; 10.1 mouse fibroblasts, 293-T, 3T3, 721, 9L, A2780, A2780ADR, A2780cis, A172, A20, A253, A431, A-549, ALC, B16, B35, BCP-1 cells, BEAS-2B, bEnd.3, BHK-21, BR 293, BxPC3, C3H-10T1 / 2, C6 / 36, Cal-27, CHO, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T, CHO Dhfr- / -, COR-L23, COR-L23 / CPR, COR-L235010, CORL23 / R23, COS-7, COV-434, CML Tl, CMT, CT26, D17, DH82, DU145, DuCaP, EL4, EM2, EM3, EMT6 / AR1, EMT6 / AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, HEK-293, HeLa, Hepalclc7, HL-60, HMEC, HT-29, lurkat, 1Y cells, K562 cells, Ku812, KCL22, KGl, KYOl, LNCap, Ma-Mel 1-48, MC-38, MCF-7, MCF-10A, MDA-MB-231, MDA-MB-468, MDA-MB-435, MDCKII, MDCKII, MOR / 0.2R, MONO-MAC 6. MTD-lA, MyEnd, NCI-H69 / CPR, NCI-H69 / LX10, NCI-H69 / LX20, NCI-H69 / LX4, NIH-3T3, NALM-1, NW-145, OPCN / OPCT cell line, Peer, PNT-lA / PNT 2, RenCa, RIN-5F, RMA / RMAS, Saos-2 cells, Sf-9, SkBr3, T2, T-47D, T84, THP1 cell line, U373, U87, U937, VCaP, Vero cells, WM39, WT-49, X63, YAC-1, YAR and transgenic varieties thereof. Clone lines can be obtained from various sources well known to those skilled in the art (see, e.g., American Type Culture Collection (ATCC) (Manassas, Va.).

[0236] In some embodiments, cells transfected with one or more nucleic acid molecules or vectors described herein are used to establish new cell lines comprising one or more vector-derived sequences. In some embodiments, cells transiently transfected with components of an RGN system as described herein (e.g., by transient transfection of one or more vectors, or transfection with RNA) and modified by activity of the RGN system are used to establish new cell lines comprising cells containing the modification but lacking any other exogenous sequences.

[0237] In some embodiments, one or more nucleic acid molecules or vectors described herein are used to generate non-human transgenic animals. In some embodiments, the transgenic animals are mammals, such as mice, rats, hamsters, rabbits, cows, or pigs. In some embodiments, the transgenic animals are birds, such as chickens or ducks. In some embodiments, the transgenic animals are insects, such as mosquitoes or ticks.

[0238] VI. Variants and Fragments of Polypeptides and Polynucleotides

[0239] The present disclosure provides active variants and fragments of crRNA, tracrRNA, sgRNA backbone, sgRNA and RGN of the present disclosure.Active variants or fragments of naturally occurring (i.e., wild-type) RGN are combined with target sequences as described herein in TRAC genes in a sequence-specific manner guided by RNA.In some embodiments, target sequences as described herein include having such as SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, the target strand of the nucleotide sequence shown in any one of 102 and 104. In some embodiments, the present disclosure provides active variants and fragments of RGN having an amino acid sequence as set forth in SEQ ID NO: 105 or 333, as well as active variants and fragments of naturally occurring CRISPR repeat sequences (including sequences as set forth in SEQ ID NO: 106, 109 to 112, 328, 331, 334, 430, 432 to 435, 583, 585, and 587), active variants and fragments of naturally occurring tracrRNA (such as any one of the sequences set forth in SEQ ID NO: 107, 114 to 123, 329, 332, 335, 431, 437 to 446, 584, 586, and 588), and active variants and fragments of sgRNA (such as any one of the sequences set forth in SEQ ID NO: 107, 114 to 123, 329, 332, 335, 431, 437 to 446, 584, 586, and 588). any one of the sequences shown in NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564 and 566 to 582), and polynucleotides encoding them.

[0240] Although the activity of a variant or fragment may be altered compared to the polynucleotide or polypeptide of interest, the variants and fragments should retain the functionality of the polynucleotide or polypeptide of interest. For example, a variant or fragment may have increased activity, decreased activity, a different activity profile, or any other alteration in activity when compared to the polynucleotide or polypeptide of interest.

[0241] Fragments and variants of naturally occurring RGN polypeptides, such as those disclosed herein, will retain sequence-specific RNA-guided DNA binding activity. In embodiments, fragments and variants of naturally occurring RGN polypeptides, such as those disclosed herein, retain nuclease activity (single-stranded or double-stranded).

[0242] Fragments and variants of naturally occurring CRISPR repeat sequences, such as those disclosed herein, when used as part of a guide RNA (including a tracrRNA), will retain the ability to bind and guide an RNA-guided nuclease (complexed with the guide RNA) to a target sequence in a sequence-specific manner.

[0243] Fragments and variants of naturally occurring tracrRNA, such as those disclosed herein, when part of a guide RNA (including a CRISPR RNA), will retain the ability to guide an RNA-guided nuclease (complexed with the guide RNA) to a target sequence in a sequence-specific manner.

[0244] Fragments and variants of the sgRNA backbone, such as those disclosed herein, when included as part of a guide RNA, will retain the ability to guide an RNA-guided nuclease (complexed with the guide RNA) to a target sequence in a sequence-specific manner.

[0245] Fragments and variants of sgRNAs, such as those disclosed herein, will retain the ability to guide an RNA-guided nuclease (complexed with the sgRNA) to a target sequence in a sequence-specific manner.

[0246] The term "fragment" refers to a portion of a polynucleotide or polypeptide sequence of the present disclosure. "Fragments" or "biologically active portions" include polynucleotides that contain a sufficient number of contiguous nucleotides to retain biological activity (i.e., when contained within a guide RNA, bind to and guide the RGN to a target sequence in a sequence-specific manner). "Fragments" or "biologically active portions" include polypeptides that contain a sufficient number of contiguous amino acid residues to retain biological activity (i.e., when complexed with a guide RNA, bind to a target sequence in a sequence-specific manner). Fragments of RGN proteins include those that are shorter than the full-length sequence due to the use of alternative downstream start sites. Biologically active portions of RGN proteins can be polypeptides comprising, for example, 10, 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700 or more consecutive amino acid residues of an RGN that binds a target nucleotide sequence disclosed herein or of SEQ ID NO: 105 or 333. Such biologically active portions can be prepared by recombinant techniques and assessed for sequence-specific, RNA-guided DNA binding activity. A biologically active fragment of a CRISPR repeat sequence may comprise at least 8 consecutive nucleotides of any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587. A biologically active portion of a CRISPR repeat sequence may be a polynucleotide comprising, for example, 8, 9, 10, 11, 12, or 13 consecutive nucleotides of any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587. A biologically active fragment of a crRNA sequence may comprise at least 20 consecutive nucleotides of any one of SEQ ID NOs: 136-197 and 459-520. The biologically active portion of the crRNA can be a polynucleotide comprising, for example, 20, 25, 30, 35, 40 or more consecutive nucleotides of any one of SEQ ID NOs: 136 to 197 and 459 to 520.The biologically active portion of the tracrRNA can be a polynucleotide comprising, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more contiguous nucleotides of any one of SEQ ID NOs: 107, 114 to 123, 329, 332, 335, 431, 437 to 446, 584, 586, and 588. The biologically active portion of the sgRNA backbone can be a polynucleotide comprising, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more contiguous nucleotides of any one of SEQ ID NOs: 124 to 134 and 447 to 457. The biologically active portion of the sgRNA can be a polynucleotide comprising, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more contiguous nucleotides of any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536,

[0247] Generally, " variant " is intended to mean a substantially similar sequence. For polynucleotides, variants include deletions and / or additions of one or more nucleotides at one or more internal sites within a natural polynucleotide and / or substitutions of one or more nucleotides at one or more sites in a natural polynucleotide. As used herein, "natural" or "wild-type" polynucleotides or polypeptides comprise naturally occurring nucleotide sequences or amino acid sequences, respectively. For polynucleotides, conservative variants include those sequences that encode the native amino acid sequence of a gene of interest due to the degeneracy of the genetic code. Naturally occurring allelic variants can be identified by using well-known molecular biology techniques, such as by polymerase chain reaction (PCR) and hybridization techniques as described below. Variant polynucleotides also include synthetically derived polynucleotides, such as those produced by, for example, using site-directed mutagenesis but still encoding a polypeptide of interest or polynucleotide. Typically, variants of a particular polynucleotide disclosed herein will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotide as determined by the sequence alignment programs and parameters described elsewhere herein.

[0248] The variant of specific polynucleotide disclosed herein (that is, reference polynucleotide) can also be assessed by comparing the polypeptide encoded by the variant polynucleotide with the polypeptide encoded by the reference polynucleotide by the sequence identity percentage ratio.The sequence identity percentage ratio between any two polypeptides can be calculated using the sequence alignment program and parameters described elsewhere herein.When assessing any given polynucleotide pair disclosed herein by comparing the sequence identity percentage ratio of two polypeptides encoded thereto, the sequence identity percentage ratio between the two encoded polypeptides is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0249] In certain embodiments, the polynucleotides disclosed herein encode RNA-guided nuclease polypeptides comprising an amino acid sequence that is at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to an amino acid sequence encoding an RGN that binds a target sequence disclosed herein, or the amino acid sequence set forth in SEQ ID NO: 105.

[0250] Biologically active variants of the RGN polypeptides of the present disclosure may differ by as few as about 1 to 15 amino acid residues, as few as about 1 to 10, such as about 6 to 10, as few as 5, as few as 4, as few as 3, as few as 2, or as few as 1 amino acid residue. , 1500, 1600, 1650, 1700 amino acids, or more, are deleted from the N- or C-terminus of the polypeptide.

[0251] In some embodiments, the polynucleotides disclosed herein comprise or encode a crRNA repeat sequence comprising a nucleotide sequence that is at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the nucleotide sequence shown in any one of SEQ ID NOs: 106, 109-112, 328, 331, 334, 430, 432-435, 583, 585, and 587.

[0252] In some embodiments, the polynucleotides disclosed herein comprise or encode a crRNA comprising a nucleotide sequence that is at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the nucleotide sequence shown in any one of SEQ ID NOs: 136 to 197 and 459 to 520.

[0253] The polynucleotides disclosed herein may comprise or encode a tracrRNA comprising a nucleotide sequence that is at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the nucleotide sequence shown in any one of SEQ ID NOs: 107, 114-123, 329, 332, 335, 431, 437-446, 584, 586, and 588.

[0254] The polynucleotides disclosed herein may comprise or encode an sgRNA backbone comprising a nucleotide sequence having at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to the nucleotide sequence shown in any one of SEQ ID NOs: 124 to 134 and 447 to 457.

[0255] The polynucleotides disclosed herein may comprise or encode an sgRNA comprising a nucleotide sequence having at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582.

[0256] Biologically active variants of the CRISPR repeat, crRNA, tracrRNA, sgRNA backbone, or sgRNA disclosed herein can differ by as few as about 1 to 15 nucleotides, as few as about 1 to 10, such as about 6 to 10, as few as 5, as few as 4, as few as 3, as few as 2, or as few as 1 nucleotide. In some embodiments, the polynucleotides can comprise a 5' or 3' truncation, which can comprise a deletion of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 95, 100, 105, 110 nucleotides, or more, from the 5' or 3' end of the polynucleotide.

[0257] It is recognized that the RGN polypeptides, CRISPR repeat sequences, crRNA, tracrRNA, sgRNA backbones, and sgRNAs provided herein can be modified to generate variant proteins and polynucleotides. Artificially designed changes can be introduced by applying site-directed mutagenesis techniques. Alternatively, natural, unknown, or as-yet unidentified polynucleotides and / or polypeptides that are structurally and / or functionally related to the sequences disclosed herein can also be identified and fall within the scope of the present disclosure. Conservative amino acid substitutions can be made in non-conserved regions that do not alter the function of the RGN protein. Alternatively, modifications can be made that improve the activity of the RGN.

[0258] Variant polynucleotides and proteins also encompass sequences and proteins derived from mutagenesis and recombination procedures such as DNA shuffling. Using such procedures, one or more of the different RGN proteins disclosed herein (e.g., SEQ ID NO: 105 or 333) are manipulated to generate new RGN proteins with desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions with substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding domains of interest can be shuffled between the RGN sequences provided herein and other known RGN genes to obtain proteins encoding proteins with improved properties of interest (such as increased K in the case of enzymes). m) a new gene for a protein. Strategies for such DNA shuffling are known in the art. For example, see, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91: 10747-10751; Stemmer (1994) Nature 370: 389-391; Crameri et al. (1997) Nature Biotech. 15: 436-438; Moore et al. (1997) J. Mol. Biol. 272: 336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94: 4504-4509; Crameri et al. (1998) Nature 391: 288-291; and U.S. Patent Nos. 5,605,793 and 5,837,458. A "shuffled" nucleic acid is a nucleic acid produced by a shuffling procedure, such as any of the shuffling procedures described herein. Reorganization nucleic acid is produced by reorganizing (physically or virtually) two or more nucleic acids (or strings), for example, in an artificial and optionally recursive manner. Typically, one or more screening steps are used to identify the nucleic acid of interest during the reorganization process; the screening step can be performed before or after any reorganization step. In some (but not all) reorganization embodiments, it is desirable to perform multiple rounds of reorganization to increase the diversity of the pool to be screened before selection. The entire process of reorganization and selection is optionally repeated recursively. Depending on the context, reorganization can refer to the entire process of reorganization and selection, or alternatively, can simply refer to the reorganization portion of the entire process.

[0259] As used herein, "sequence identity" or "identity" in the context of two polynucleotides or polypeptide sequences refers to the identical residues in the two sequences when aligned over a specified comparison window to obtain maximum correspondence. It should be recognized that non-identical residue positions are generally different due to conservative amino acid substitutions, in which amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity), and therefore do not change the functional properties of the molecule. Protein sequences that differ by such conservative substitutions are referred to as having "sequence similarity" or "similarity." Methods for measuring sequence similarity are well known to those skilled in the art. Typically, this involves scoring conservative substitutions as partial mismatches rather than complete mismatches. Therefore, for example, when the same amino acid is given a score of 1 and a non-conservative substitution is given a score of 0, a conservative substitution is given a score between 0 and 1. The scoring of conservative substitutions is calculated, for example, as implemented in program PC / GENE (Intelligenetics, Mountain View, California).

[0260] As used herein, "percentage of sequence identity" refers to a value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) to achieve optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in the two sequences to derive the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to produce a percentage of sequence identity.

[0261] Unless otherwise indicated, the sequence identity / similarity values ​​provided herein refer to the values ​​obtained using GAP version 10 using the following parameters: using a gap weight of 50 and a length weight of 3 and the nwsgapdna.cmp scoring matrix to calculate % identity and % similarity for nucleotide sequences; using a gap weight of 8 and a length weight of 2 and the BLOSUM62 scoring matrix to calculate % identity and % similarity for amino acid sequences; or any equivalent programs thereof. "Equivalent program" means any sequence comparison program that, for any two query sequences, produces an alignment having identical nucleotide or amino acid residue matches and an identical percentage of sequence identity when compared to the corresponding alignment produced by GAP version 10.

[0262] When two sequences are compared for similarity score using a defined amino acid substitution matrix (e.g., BLOSUM62), a gap presence penalty, and a gap extension penalty, the two sequences are "optimally aligned," so that the sequence is at its highest possible score. Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well known in the art and are described in, for example, Dayhoff et al. (1978) "A model of evolutionary change in proteins." In "Atlas of Protein Sequence and Structure," Vol. 5, Supplement 3 (Editor MO Dayhoff), pp. 345 to 352. Natl. Biomed. Res. Found., Washington, DC, and Henikoff et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919. The BLOSUM62 matrix is ​​typically used as a default scoring substitution matrix in sequence alignment protocols. For introducing a single amino acid gap in one of the aligned sequences, a gap presence penalty is applied, and a gap extension penalty is applied for each extra empty amino acid position that is inserted into the gap that has been opened. Alignment is defined by the amino acid position of each sequence that the alignment begins and ends, and is optionally defined by inserting one or more gaps in one or two sequences, so as to reach the highest possible score. Although optimal alignment and scoring can be completed manually, the process is promoted by using a computer-implemented alignment algorithm, for example, gapped BLAST 2.0, is described in (1997) Nucleic Acids Res.25:3389-3402, etc., and the public can obtain on the U.S. National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov). Optimal alignment, including multiple alignments, can be prepared using, for example, PSI-BLAST, which can be obtained and described in (1997) Nucleic Acids Res.25:3389-3402, etc., by www.ncbi.nlm.nih.gov.

[0263] With respect to an amino acid sequence that is optimally aligned with a reference sequence, an amino acid residue "corresponds to" the position of that residue in the reference sequence that is paired in the alignment. "Position" is represented by a number that sequentially identifies each amino acid in the reference sequence based on its position relative to the N-terminus. Due to deletions, insertions, truncations, fusions, etc. that must be considered when determining optimal alignment, in general, the numbering of amino acid residues in a test sequence determined by simply counting from the N-terminus is not necessarily the same as the numbering of their corresponding positions in the reference sequence. For example, in the case of a deletion in the aligned test sequence, there will be no amino acid corresponding to the position at the site of the deletion in the reference sequence. In the case of an insertion in the aligned reference sequence, the insertion will not correspond to any amino acid position in the reference sequence. In the case of truncations or fusions, there may be stretches of amino acids in the reference sequence or aligned sequence that do not correspond to any amino acid in the corresponding sequence.

[0264] VII. RGN Systems and Ribonucleoprotein Complexes for Binding Target Sequences of Interest and Methods for Preparing Them

[0265] The present disclosure provides an RGN system for binding to a target sequence in a TRAC gene. As used herein, an RGN system includes at least one RGN polypeptide or a polynucleotide comprising a nucleotide sequence encoding an RGN polypeptide and one or more guide RNAs. The one or more guide RNAs are capable of forming a complex (ribonucleoprotein complex) with the RGN polypeptide. The RGN system disclosed herein includes: a) one or more guide RNAs, or one or more polynucleotides comprising one or more nucleotide sequences encoding the one or more guide RNAs; and b) an RGN polypeptide or a polynucleotide comprising a nucleotide sequence encoding an RGN polypeptide. The one or more guide RNAs are capable of targeting the bound RGN polypeptide to the target sequence. The one or more guide RNAs are capable of forming a complex with the RGN polypeptide to guide the RGN polypeptide to bind to the target sequence in the TRAC gene. The guide RNA hybridizes with the target strand of the target sequence in the TRAC gene and also forms a complex with the RGN polypeptide, thereby guiding the RGN polypeptide to bind to the target sequence. In some embodiments, the target sequence is as set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104. In some embodiments, the target sequence within the TRAC gene has the nucleotide sequence shown below: GCCGTGTACCAGCTGAGAGACTCT (SEQ ID NO: 8). In some embodiments, the target sequence within the TRAC gene has the nucleotide sequence shown below: ATCCTCTTGTCCCACAGATATCC (SEQ ID NO: 10). In some embodiments, the RGN is capable of recognizing a consensus PAM sequence as shown in NNNNCC or NNRNCC.In some embodiments, the RGN is capable of recognizing the complete PAM sequence as set forth in any of AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GGGCCCAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG. In some embodiments, the RGN comprises an amino acid sequence as set forth in SEQ ID NO: 105, or an active variant or fragment thereof. In some embodiments, the RGN comprises an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO: 105. In some embodiments, the RGN comprises an amino acid sequence as set forth in SEQ ID NO: 333, or an active variant or fragment thereof. In some embodiments, the RGN comprises an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO: 333. In some embodiments, the guide RNA comprises a CRISPR repeat sequence comprising a nucleotide sequence as set forth in any one of SEQ ID NOs: 106, 109 to 112, 328, 331, 334, 430, 432 to 435, 583, 585, and 587, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises a CRISPR repeat sequence having a nucleotide sequence as shown in SEQ ID NO: 106, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises a crRNA comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 136 to 197 and 459 to 520, or an active variant or fragment thereof.In some embodiments, the guide RNA comprises a tracrRNA comprising a nucleotide sequence as set forth in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, 335, 431, 437 to 446, 584, 586, and 588, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises a tracrRNA having a nucleotide sequence as set forth in SEQ ID NO: 107, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises an sgRNA backbone comprising any one of the nucleotide sequences set forth in SEQ ID NOs: 124 to 134 and 447 to 457. In some embodiments, the guide RNA comprises an sgRNA comprising any one of the nucleotide sequences set forth in SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises an sgRNA having a nucleotide sequence set forth in SEQ ID NO: 204, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises an sgRNA having a nucleotide sequence set forth in SEQ ID NO: 205, or an active variant or fragment thereof. The guide RNAs of the system can be single guide RNAs or dual guide RNAs. In some embodiments, the system comprises an RNA-guided nuclease that is heterologous to the guide RNA, wherein the RGN and the guide RNA are not found complexed with each other (i.e., bound to each other) in nature.

[0266] The system for binding a target sequence of interest provided herein can be a ribonucleoprotein complex, which is at least one RNA molecule bound to at least one protein. The ribonucleoprotein complex provided herein comprises at least one guide RNA as an RNA component and an RNA-guided nuclease as a protein component. Such ribonucleoprotein complexes can be purified from cells or organisms that naturally express RGN polypeptides and cells or organisms that have been engineered to express specific guide RNAs, and the guide RNAs are specific to the target sequence of interest (e.g., the target sequence in the TRAC gene). Alternatively, the ribonucleoprotein complex can be purified from cells or organisms that have been transformed with polynucleotides (e.g., mRNA) encoding RGN polypeptides and guide RNAs, and cultured under conditions that allow the expression of RGN polypeptides and guide RNAs. In some embodiments, the ribonucleoprotein complex is purified from cells or organisms that have been transformed with polynucleotides (e.g., mRNA) encoding RGN polypeptides, and gRNAs of synthetic origin have been introduced therein. Therefore, a method for preparing RGN polypeptides or RGN ribonucleoprotein complexes is provided. Such methods comprise culturing cells comprising a nucleotide sequence encoding an RGN polypeptide, and in some embodiments, a nucleotide sequence encoding a guide RNA, under conditions that express an RGN polypeptide (and in some embodiments, a guide RNA). The RGN polypeptide or RGN ribonucleoprotein can then be purified from a lysate of the cultured cells. In some embodiments, the nucleotide sequence encoding the RGN polypeptide comprises mRNA (messenger RNA). In some embodiments, the method for assembling an RNP complex comprises combining one or more of the guide RNAs disclosed herein with one or more of the RGN polypeptides disclosed herein under conditions suitable for forming an RNP complex.

[0267] Methods for purifying RGN polypeptides or RGN ribonucleoprotein complexes from lysates of biological samples are known in the art (e.g., size exclusion and / or affinity chromatography, 2D-PAGE, HPLC, reverse phase chromatography, immunoprecipitation). In certain methods, the RGN polypeptide is recombinantly produced and contains a purification tag that facilitates its purification, including, but not limited to, glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly (NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG (e.g., 3X FLAG tag), HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 10xHis, biotin carboxyl carrier protein (BCCP), and calmodulin. Typically, immobilized metal affinity chromatography is used to purify the tagged RGN polypeptide or RGN ribonucleoprotein complex. It will be appreciated that other similar methods known in the art, including other forms of chromatography or, for example, immunoprecipitation, may be used alone or in combination.

[0268] An "isolated" or "purified" polypeptide, or biologically active portion thereof, is substantially or essentially free of components that normally accompany or interact with the polypeptide as found in its naturally occurring environment. Thus, an isolated or purified polypeptide is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Proteins that are substantially free of cellular material include preparations of protein having less than about 30%, 20%, 10%, 5% or 1% (by dry weight) of contaminating proteins. When a protein of the disclosure, or a biologically active portion thereof, is recombinantly produced, the culture medium optimally represents less than about 30%, 20%, 10%, 5% or 1% (by dry weight) of chemical precursors or chemicals not of the protein of interest. Similarly, an "isolated" polynucleotide or nucleic acid molecule is removed from its naturally occurring environment. An isolated polynucleotide is substantially free of chemical precursors or other chemicals when chemically synthesized, or has been removed from a genomic site via cleavage of a phosphodiester bond. An isolated polynucleotide may be part of a vector, composition of matter, or may be contained within a cell, so long as the cell is not the native environment of the polynucleotide.

[0269] Specific methods provided herein for binding and / or cleaving a target sequence of interest involve the use of in vitro assembled RGN ribonucleoprotein complexes. The in vitro assembly of the RGN ribonucleoprotein complex can be performed using any method known in the art, wherein the RGN polypeptide is contacted with the guide RNA under conditions that allow the RGN polypeptide to bind to the guide RNA. As used herein, "contact" or "contacting" refers to bringing together the components of the desired reaction under conditions suitable for carrying out the desired reaction. The RGN polypeptide can be purified from a biological sample, cell lysate, or culture medium and produced via in vitro translation or chemical synthesis. The guide RNA can be purified from a biological sample, cell lysate, or culture medium and transcribed or chemically synthesized in vitro. The RGN polypeptide and guide RNA can be contacted in a solution (e.g., a buffered saline solution) to allow in vitro assembly of the RGN ribonucleoprotein complex.

[0270] Some aspects of the present disclosure provide a kit comprising one or more elements of the RGN system described herein, including: guide RNA (i.e., crRNA, tracrRNA, and / or sgRNA), RGN, and / or polynucleotides encoding them; cells; and a complete RGN system, and in some embodiments, another type of nuclease. In some embodiments, the kit includes suitable reagents, buffers, and / or instructions for using one or more elements of the RGN system, for example, for in vitro or in vivo nucleic acid editing. The reagents can be provided in any suitable container (such as a vial, bottle, or tube). The reagents can be used in the process of utilizing one or more elements of the RGN system. For example, a restriction enzyme can be included to clone the polynucleotide encoding the RGN or guide RNA into a vector. In some embodiments, the kit includes instructions for designing and using suitable guide RNAs (i.e., crRNA, tracrRNA, and / or sgRNA) for targeted editing of nucleic acid sequences. The reagents can be provided in a form that is usable in a specific assay, or in a form that requires the addition of one or more other components before use (e.g., in a concentrate or lyophilized form). Buffer can be any buffer, including but not limited to sodium carbonate buffer, sodium bicarbonate buffer, borate buffer, Tris buffer, MOPS buffer, HEPES buffer and combination thereof. In some embodiments, buffer is alkaline. In some embodiments, the pH of buffer is about 7 to about 10.

[0271] Kits comprising one or more elements of the disclosed RGN systems have utility in a variety of applications, including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a variety of cell types.

[0272] In some embodiments, the kit of the present disclosure includes a kit comprising a composition as described herein. In some embodiments, the kit may include: (a) a container for accommodating a lyophilized form of the composition of the present disclosure and (b) a second container for accommodating an acceptable diluent (e.g., sterile water) for injection. An acceptable diluent can be used to reconstitute or dilute the lyophilized compound of the present disclosure. Optionally, associated with such a container may be a notification in a form prescribed by a governmental agency governing the manufacture, use, or sale of biological products.

[0273] VIII. Methods of Binding, Cleaving or Modifying Target Sequences

[0274] The present disclosure provides methods for binding, cleaving and / or modifying a target sequence in a TRAC gene. The methods include delivering an RGN system comprising at least one guide RNA or polynucleotides encoding the same and at least one RGN polypeptide or polynucleotides encoding the same to the target sequence or a cell or embryo comprising the target sequence. In some embodiments, the target sequence in the TRAC gene has a nucleotide sequence as set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104. In some embodiments, the target sequence within the TRAC gene has the nucleotide sequence set forth in SEQ ID NO: 8. In some embodiments, the target sequence within the TRAC gene has the nucleotide sequence set forth in SEQ ID NO: 10.

[0275] In some embodiments, the RGN is capable of recognizing a consensus PAM sequence as shown in NNNNCC or NNRNCC. In some embodiments, the RGN is capable of recognizing the complete PAM sequence as set forth in any of AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GGGCCCAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG. The RGN may comprise an amino acid sequence as set forth in SEQ ID NO: 105, or an active variant or fragment thereof. In some embodiments, the RGN comprises an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO: 105. In some embodiments, the RGN comprises an amino acid sequence as set forth in SEQ ID NO: 333, or an active variant or fragment thereof. In some embodiments, the RGN comprises an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO: 333. The guide RNA may comprise a CRISPR repeat sequence comprising a nucleotide sequence as set forth in any one of SEQ ID NOs: 106, 109 to 112, 328, 331, 334, 430, 432 to 435, 583, 585, and 587, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises a CRISPR repeat sequence having a nucleotide sequence as shown in SEQ ID NO: 106, or an active variant or fragment thereof. The guide RNA may comprise a crRNA comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 136 to 197 and 459 to 520, or an active variant or fragment thereof.The guide RNA may comprise a tracrRNA comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, 335, 431, 437 to 446, 584, 586, and 588, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises a tracrRNA having a nucleotide sequence as shown in SEQ ID NO: 107, or an active variant or fragment thereof. The guide RNA may comprise an sgRNA backbone comprising any one of the nucleotide sequences shown in SEQ ID NOs: 124 to 134 and 447 to 457, or an active variant or fragment thereof. The guide RNA may comprise an sgRNA comprising any one of the nucleotide sequences shown in SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises an sgRNA having a nucleotide sequence as shown in SEQ ID NO: 204, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises an sgRNA having a nucleotide sequence as shown in SEQ ID NO: 205, or an active variant or fragment thereof. The guide RNA of the system may be a single guide RNA or a dual guide RNA.

[0276] The RGN of the system can be a nuclease-inactivated RGN with nickase activity, or can be a fusion polypeptide. In some embodiments, the RGN fusion protein includes a polypeptide that recruits a member of a functional nucleic acid repair complex, such as a polypeptide of a member of a nucleotide excision repair (NER) or transcription-coupled nucleotide excision repair (TC-NER) pathway (Wei et al., 2015, PNAS USA 112(27): E3495-504; Troelstra et al., 1992, Cell 71: 939-953; Marnef et al., 2017, J Mol Biol 429(9): 1277-1288), as described in U.S. Provisional Application No. 62 / 966,203, filed January 27, 2020, which is incorporated by reference in its entirety. In some embodiments, the RGN fusion protein comprises CSB (van den Boom et al., 2004, J Cell Biol 166(1):27-36; van Gool et al., 1997, EMBO J 16(19):5955-65; an example of which is shown in SEQ ID NO:424), which is a member of the TC-NER (nucleotide excision repair) pathway and plays a role in recruiting other members. In further embodiments, the RGN fusion protein comprises the active domain of CSB, such as the acidic domain of CSB comprising amino acid residues 356 to 394 of SEQ ID NO:424 (Teng et al., 2018, Nat Commun 9(1):4115).

[0277] In certain embodiments, the RGN and / or guide RNA is heterologous to the cell or embryo into which the RGN and / or guide RNA (or a polynucleotide encoding at least one of the RGN and guide RNA) is introduced.

[0278] In embodiments where the method comprises delivering a polynucleotide encoding a guide RNA and / or an RGN polypeptide, the cell or embryo can then be cultured under conditions where the guide RNA and / or the RGN polypeptide are expressed. In some embodiments, the method comprises contacting the target nucleic acid molecule with an RGN ribonucleoprotein complex. The RGN ribonucleoprotein complex can comprise an RGN that is nuclease-inactivated or has nickase activity. In some embodiments, the method comprises introducing the RGN ribonucleoprotein complex into the cell or embryo comprising the target nucleic acid molecule. The RGN ribonucleoprotein complex can be purified from a biological sample, recombinantly produced and subsequently purified, or assembled in vitro as described herein. In embodiments where the RGN ribonucleoprotein complex contacted with the target nucleic acid molecule, cell, or embryo has been assembled in vitro, the method can further comprise assembling the complex in vitro prior to contacting the target nucleic acid molecule, cell, or embryo.

[0279] Purified or in vitro assembled RGN ribonucleoprotein complexes can be introduced into cells or embryos using any method known in the art, including but not limited to electroporation. Alternatively, RGN polypeptides and / or polynucleotides encoding or comprising guide RNAs can be introduced into cells or embryos using any method known in the art (e.g., electroporation).

[0280] Upon delivery to, or contact with, a target nucleic acid molecule, or a cell or embryo comprising the target nucleic acid molecule, the guide RNA directs the RGN to bind to a target sequence within the target nucleic acid molecule in a sequence-specific manner. In those embodiments in which the RGN has nuclease activity, the RGN polypeptide cleaves the target sequence upon binding. The target sequence can then be modified via endogenous repair mechanisms, such as non-homologous end joining, or homology-directed repair using a provided donor polynucleotide.

[0281] Methods for measuring the binding of RGN polypeptides to target sequences are known in the art and include chromatin immunoprecipitation assays, gel mobility shift assays, DNA pull-down assays, reporter gene assays, microplate capture and detection assays. Similarly, methods for measuring the cleavage or modification of target nucleic acid molecules comprising a target sequence are known in the art and include in vitro or in vivo cleavage assays, wherein cleavage is confirmed using PCR, sequencing, or gel electrophoresis, with or without suitable labels (e.g., radioisotopes, fluorescent substances) attached to the target sequence to facilitate detection of degradation products. Alternatively, a nick-triggered exponential amplification reaction (NTEXPAR) assay can be used (see, e.g., Zhang et al. (2016) Chem. Sci. 7: 4951-4957). In vivo cleavage can be assessed using the Surveyor assay (Guschin et al. (2010) Methods Mol Biol 649: 247-256).

[0282] In some embodiments, the methods involve the use of only one type of RGN and only one type of guide RNA disclosed herein. In some embodiments, the methods involve the use of a single type of RGN complexed with more than one guide RNA. In some embodiments, the methods involve the use of two types of RGN, each complexed with a guide RNA. More than one guide RNA can target different regions of a single gene or can target multiple genes. For example, a first guide RNA can target exon 1 in the TRAC gene, and a second guide RNA can target intron 1 in the TRAC gene.

[0283] In those embodiments where a donor polynucleotide is not provided, double-strand breaks introduced by the RGN polypeptide can be repaired by the non-homologous end joining (NHEJ) repair process. Due to the error-prone nature of NHEJ, repair of double-strand breaks can result in mutations in the target sequence. In certain embodiments, "mutation" with respect to a nucleic acid molecule refers to a change in the nucleotide sequence of the nucleic acid molecule, which can be a deletion, insertion, or substitution of one or more nucleotides, or a combination thereof. Mutation of a target nucleic acid molecule comprising a target sequence can result in altered expression of a protein product or inactivation of a coding sequence.

[0284] Described method can include using the RGN system of the present disclosure that donor polynucleotide is integrated into TRAC gene.In those embodiments in which there is donor polynucleotide, the donor sequence in the donor polynucleotide can be integrated into the target nucleotide sequence or exchanged with the target nucleotide sequence during the process of repairing the double-strand break introduced, resulting in the introduction of exogenous donor sequence.Therefore, donor polynucleotide comprises the donor sequence that expects to be introduced into the target sequence of interest (for example, the target sequence in TRAC gene).In some embodiments, donor sequence changes original target nucleotide sequence so that the newly integrated donor sequence will not be identified and cut by RGN.The integration of donor sequence can be enhanced by comprising flanking sequence in donor polynucleotide, flanking sequence is referred to as "homology arm" in this article, and it has substantial sequence identity with the sequence flanking the target nucleotide sequence, thereby allowing homology directed repair process.In some embodiments, homology arm has at least 50 base pairs, at least 100 base pairs and 2000 base pairs or more length at the most, and has at least 90%, at least 95% or more sequence homology with its corresponding sequence in target nucleotide sequence. In some embodiments, the donor polynucleotide comprises a nucleotide sequence encoding an engineered T cell receptor, a chimeric antigen receptor, or an antibody.

[0285] In those embodiments in which the RGN polypeptide introduces double-stranded staggered breaks, the donor polynucleotide can comprise a donor sequence flanked by compatible overhangs, thereby allowing for direct ligation of the donor sequence to the cleaved target nucleotide sequence comprising the overhangs by non-homologous repair processes during repair of the double-strand break.

[0286] In those embodiments in which the method involves the use of an RGN that is a nickase (i.e., capable of cleaving only a single strand of a double-stranded polynucleotide), the method can include introducing two RGN nickases that target the same or overlapping target sequences and cleave different strands of the polynucleotide. For example, an RGN nickase that cleaves only the plus (+) strand of a double-stranded polynucleotide can be introduced together with a second RGN nickase that cleaves only the minus (-) strand of the double-stranded polynucleotide.

[0287] In some embodiments, methods for binding to a target nucleotide sequence and detecting the target sequence are provided, wherein the method comprises introducing into a cell or embryo at least one guide RNA or polynucleotide encoding the same, and at least one RGN polypeptide or polynucleotide encoding the same (if coding sequences are introduced) that expresses the guide RNA and / or RGN polypeptide, wherein the RGN polypeptide is a nuclease-inactivated RGN and further comprises a detectable label, and the method further comprises detecting the detectable label. The detectable label can be fused to the RGN as a fusion protein (e.g., a fluorescent protein) or can be a small molecule conjugated to or incorporated into the RGN polypeptide that can be detected visually or otherwise.

[0288] Also provided herein is a method for regulating the expression of a TRAC gene. In some embodiments, the method includes regulating the expression of a TRAC gene in a cell population. In some embodiments, the cell population comprises a T cell. The method may include delivering an RGN system or RNP complex as described herein to a cell population, wherein the cell population comprises a target sequence within the TRAC gene, and wherein compared to the TRAC gene expression in a control cell population, TRAC gene expression is regulated. In some embodiments, the target sequence is cut or modified. The cutting or modification of the target sequence can be detected by sequencing. TRAC gene expression can be measured by quantitative PCR, microarray, RNA-seq, flow cytometry, immunoblotting, enzyme-linked immunosorbent assay (ELISA), protein immunoprecipitation, immunostaining, high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC / MS), mass spectrometry, or a combination thereof. In some embodiments, TRAC gene expression is reduced. The reduction in TRAC gene expression may include a reduction in TRAC mRNA levels and / or TRAC protein levels. In some embodiments, the reduction in TRAC mRNA levels and / or Trac protein levels is due to the cutting of the TRAC gene by the RGN system of the present disclosure. In some embodiments, the reduction of TRAC protein levels is measured by flow cytometry for detecting CD3+ cells. Compared with the level of CD3+ cells in the control cell population, the reduction of CD3+ cells can indicate the reduction of TRAC protein levels. In some embodiments, the reduction of CD3+ cells is 30% to 100%. In some embodiments, the reduction of CD3+ cells is 50% to 100%. The cutting or modification of the target sequence can occur at a ratio of 40% to 100%, or 60% to 99%, or 70% to 90%. In some embodiments, the cutting or modification of the target sequence can occur at a ratio of at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or higher. In some embodiments, cleavage or modification of the target sequence occurs at a rate of 80% to 100%.A control cell population can include a cell population that has not been subjected to delivery.

[0289] In some embodiments, the method for regulating the expression of a TRAC gene comprises introducing into a cell or embryo at least one guide RNA or polynucleotide encoding the same, and at least one RGN polypeptide or polynucleotide encoding the same, or a polynucleotide expressing the guide RNA and / or RGN polypeptide (if the coding sequence is introduced), wherein the RGN polypeptide is a nuclease-inactivated RGN. In some embodiments, the nuclease-inactivated RGN is a fusion protein comprising an expression regulator as described herein.

[0290] The method may include activating the TRAC gene using the RGN system of the present disclosure. In some embodiments, the RGN system can be targeted to the TRAC gene to increase or activate the expression of the gene. RGN (for example, the RGN of nuclease inactivation) or its composite guide RNA can be operably fused to an expression regulatory factor so that the combination of the RGN / guide RNA complex and the target sequence in the TRAC gene is used to increase or activate the expression of the TRAC gene. In some embodiments, the expression regulatory factor comprises a transcriptional activation domain, which interacts with a transcriptional control element and / or a transcriptional regulatory protein (such as RNA polymerase and transcription factor) to increase or activate the transcription of the TRAC gene. Transcriptional activation domains are known in the art and include but are not limited to herpes simplex virus VP16 activation domain and NFAT activation domain.

[0291] Those skilled in the art will appreciate that any of the methods disclosed herein can be used to target a single target sequence or multiple target sequences within a TRAC gene. Thus, these methods include the use of a single RGN polypeptide in combination with multiple different guide RNAs that can target multiple different sequences within a TRAC gene.

[0292] In some embodiments, the methods of the present disclosure are performed ex vivo or in vitro. In some embodiments, the methods of the present disclosure do not include methods for treating the human or animal body through therapy. In some embodiments, the methods of the present disclosure do not include methods comprising methods for altering the germline genetic identity of a person, or methods comprising using human embryos for industrial or commercial purposes.

[0293] IX. Cells Containing Polynucleotide Genetic Modifications

[0294] Provided herein are cells and organisms comprising a target sequence in a TRAC gene that has been modified using a RGN, crRNA, tracrRNA, and / or sgRNA-mediated process as described herein. In some embodiments, the RGN is capable of recognizing a consensus PAM sequence such as NNNNCC or NNRNCC. In some embodiments, the RGN is capable of recognizing the complete PAM sequence as set forth in any of AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GGGCCCAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG. The RGN may comprise an amino acid sequence as set forth in SEQ ID NO: 105, or an active variant or fragment thereof. In some embodiments, the RGN comprises an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO: 105. In some embodiments, the RGN comprises an amino acid sequence as set forth in SEQ ID NO: 333, or an active variant or fragment thereof. In some embodiments, the RGN comprises an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO: 333. The guide RNA may comprise a CRISPR repeat sequence comprising a nucleotide sequence as set forth in any one of SEQ ID NOs: 106, 109 to 112, 328, 331, 334, 430, 432 to 435, 583, 585, and 587, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises a CRISPR repeat sequence having a nucleotide sequence as shown in SEQ ID NO: 106, or an active variant or fragment thereof.The guide RNA may comprise a crRNA comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 136 to 197 and 459 to 520, or an active variant or fragment thereof. The guide RNA may comprise a tracrRNA comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, 335, 431, 437 to 446, 584, 586, and 588, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises a tracrRNA having a nucleotide sequence as shown in SEQ ID NO: 107, or an active variant or fragment thereof. The guide RNA may comprise an sgRNA backbone comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 124 to 134 and 447 to 457, or an active variant or fragment thereof. The guide RNA may comprise an sgRNA comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, 243 to 259, 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises an sgRNA having a nucleotide sequence as shown in SEQ ID NO: 204, or an active variant or fragment thereof. In some embodiments, the guide RNA comprises an sgRNA having a nucleotide sequence as shown in SEQ ID NO: 205, or an active variant or fragment thereof. The guide RNA of the system may be a single guide RNA or a dual guide RNA.

[0295] The modified cells can be eukaryotic cells (e.g., mammalian, insect, avian cells) or prokaryotic cells. Prokaryotic cells can be from a variety of species, including but not limited to archaea and bacteria (e.g., Bacillus, Klebsiella, Streptomyces, Rhizobium, Escherichia, Pseudomonas, Salmonella, Shigella, Vibrio, Yersinia, Mycoplasma, Agrobacterium, Lactobacillus).

[0296] Eukaryotic cells can include cells from animals (e.g., mammals, insects, fish, birds, and reptiles), fungi, amoebas, algae, and yeast. In some embodiments, the cells modified by the methods disclosed herein include lymphocytes. In some embodiments, lymphocytes include cytotoxic T cells or regulatory T cells. Cytotoxic T cells recognize and destroy infected, damaged, or cancerous cells and can be identified by various markers, including CD8; CD45; CD54; tumor necrosis factor (TNF) α, interferon (IFN) γ, IL-2CXCR3, and / or TBX21 for Tc1; IL-4, IL-5, CCR4, and / or GATA3 for Tc2; IL-9, IL-10, and / or IRF4 for Tc9; and CCR6, KLRB1, IL-17, IRF4, and / or RORC for Tc17. Regulatory T cells regulate or suppress immune response by, for example, secreting anti-inflammatory cytokines, expressing inhibitory proteins and / or by cytokine deprivation inducing apoptosis of effector T cells, and can be identified by various markers including TRAC, IL-2 receptor alpha (IL2RA or CD25), STAT5A, CTLA4, IL-10 and / or transforming growth factor (TGF) β. Also provided is an embryo comprising at least one TRAC gene, the TRAC gene having been modified by utilizing RGN, crRNA, tracrRNA and / or sgRNA as described herein. Genetically modified cells, organisms and embryos can be heterozygous or homozygous for the modified TRAC gene.

[0297] In some embodiments, the chromosomal modification of cell, organism or embryo can result in the expression of TRAC mRNA or protein by the TRAC gene encoding or protein is lowered or eliminated.In embodiments, chromosomal modification results in the production of TRAC mRNA with reduction compared with the TRAC protein translation by the TRAC mRNA transcribed from the wild-type TRAC gene of cells, organism or embryo that have never experienced chromosomal modification.In some embodiments, chromosomal modification results in the production of TRAC protein by the wild-type TRAC gene encoding of cells, organism or embryo that have not experienced chromosomal modification or the generation of the variant TRAC protein product that is more unstable expressed or reduces expression.In some embodiments, the variant TRAC protein of expression can have at least one amino acid replacement and / or at least one amino acid whose addition or disappearance.When compared with wild-type TRAC protein, the variant TRAC protein encoded by the chromosomal sequence of change can show the feature or activity of modification, include but not limited to the activation of change or the ability of suppressing TRAC target gene.

[0298] The modified cells can be introduced into an organism. In the case of autologous cell transplantation, these cells can be derived from the same organism (e.g., a human) in which the cells are modified in an ex vivo method. Alternatively, in the case of allogeneic cell transplantation, the cells are derived from another organism (e.g., another human) within the same species.

[0299] The articles "a" and "an" herein refer to one or more than one (ie, to at least one) of the grammatical object of the article. For example, "a polypeptide" means one or more polypeptides.

[0300] All publications and patent applications mentioned in this specification are indicative of the levels of those skilled in the art to which the present disclosure pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0301] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended embodiments.

[0302] Non-limiting embodiments include:

[0303] 1. A guide RNA (gRNA) comprising CRISPR RNA (crRNA) and a transactivating CRISPR RNA (tracrRNA), wherein the crRNA comprises:

[0304] (i) crRNA repeat sequences; and

[0305] (ii) a spacer region,

[0306] wherein the tracrRNA comprises:

[0307] (iii) anti-repeat sequences; and

[0308] (iv) tail,

[0309] wherein the spacer is capable of hybridizing to a target sequence in a T cell receptor alpha chain constant (TRAC) gene, wherein the target sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

[0310] 2. The gRNA of embodiment 1, wherein the spacer comprises a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 1 to 5 nucleotides.

[0311] 3. The gRNA of embodiment 2, wherein the spacer has a nucleotide sequence that differs by 5 nucleotides in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0312] 4. The gRNA of embodiment 2, wherein the spacer has a nucleotide sequence that differs by 4 nucleotides in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0313] 5. The gRNA of embodiment 2, wherein the spacer has a nucleotide sequence that differs by 3 nucleotides in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0314] 6. The gRNA of embodiment 2, wherein the spacer has a nucleotide sequence that differs by 2 nucleotides in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0315] 7. The gRNA of embodiment 2, wherein the spacer region comprises a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 1 nucleotide.

[0316] 8. The gRNA of embodiment 1, wherein the spacer has a nucleotide sequence as shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0317] 9. The gRNA of any one of embodiments 1 to 8, wherein the crRNA repeat sequence has a nucleotide sequence as shown in SEQ ID NO: 106 or a nucleotide sequence that differs from SEQ ID NO: 106 by 1 to 8 nucleotides in length and / or sequence.

[0318] 10. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 8 nucleotides in length and / or sequence.

[0319] 11. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 7 nucleotides in length and / or sequence.

[0320] 12. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 6 nucleotides in length and / or sequence.

[0321] 13. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 5 nucleotides in length and / or sequence.

[0322] 14. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 4 nucleotides in length and / or sequence.

[0323] 15. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 3 nucleotides in length and / or sequence.

[0324] 16. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 2 nucleotides in length and / or sequence.

[0325] 17. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 1 nucleotide in length and / or sequence.

[0326] 18. The gRNA of embodiment 9, wherein the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 106, 109 to 112, 328, 331, and 334.

[0327] 19. The gRNA of any one of embodiments 1 to 8, wherein the crRNA has a nucleotide sequence having at least 80% sequence identity with SEQ ID NOs: 136 to 197.

[0328] 20. The gRNA of embodiment 19, wherein the crRNA has a nucleotide sequence having at least 90% sequence identity with SEQ ID NOs: 136 to 197.

[0329] 21. The gRNA of embodiment 19, wherein the crRNA has a nucleotide sequence having at least 95% sequence identity with SEQ ID NOs: 136 to 197.

[0330] 22. The gRNA of embodiment 19, wherein the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 136 to 197.

[0331] 23. The gRNA of any one of embodiments 1 to 8, wherein the tracrRNA has a nucleotide sequence that has at least 80% sequence identity to SEQ ID NO: 107.

[0332] 24. The gRNA of embodiment 23, wherein the tracrRNA has a nucleotide sequence that has at least 90% sequence identity to SEQ ID NO: 107.

[0333] 25. The gRNA of embodiment 23, wherein the tracrRNA has a nucleotide sequence that has at least 95% sequence identity to SEQ ID NO: 107.

[0334] 26. The gRNA of any one of embodiments 1 to 8, wherein the tracrRNA has a nucleotide sequence that differs in length from SEQ ID NO: 107 by 1 to 16 nucleotides.

[0335] 27. The gRNA of embodiment 26, wherein the tracrRNA has a nucleotide sequence that is 8 nucleotides shorter than SEQ ID NO: 107.

[0336] 28. The gRNA of embodiment 26, wherein the tracrRNA has a nucleotide sequence that is 11 nucleotides shorter than SEQ ID NO: 107.

[0337] 29. The gRNA of any one of embodiments 23 to 28, wherein the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335.

[0338] 30. The gRNA of any one of embodiments 1 to 8, wherein the gRNA is a single guide RNA (sgRNA) comprising the crRNA and the tracrRNA connected by a linker, wherein the sgRNA comprises a backbone and the spacer, and wherein the backbone of the sgRNA comprises the crRNA repeat sequence, the linker, and the tracrRNA.

[0339] 31. The gRNA of embodiment 30, wherein the linker has a nucleotide sequence as shown in AAAG, GAAA, ACUU or CAAAGG.

[0340] 32. The gRNA of embodiment 31, wherein the linker has a nucleotide sequence as shown in AAAG.

[0341] 33. The gRNA of any one of embodiments 30 to 32, wherein the backbone of the sgRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides.

[0342] 34. The gRNA of any one of embodiments 30 to 32, wherein the backbone of the sgRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides.

[0343] 35. The gRNA of any one of embodiments 30 to 32, wherein the backbone of the sgRNA comprises a total length of 86 to 98 nucleotides.

[0344] 36. The gRNA of any one of embodiments 30 to 32, wherein the backbone of the sgRNA comprises a total length of 94 nucleotides.

[0345] 37. The gRNA of any one of embodiments 30 to 32, wherein the backbone of the sgRNA has a nucleotide sequence having at least 80% sequence identity with any one of SEQ ID NOs: 124 to 134.

[0346] 38. The gRNA of embodiment 37, wherein the backbone of the sgRNA has a nucleotide sequence having at least 90% sequence identity with any one of SEQ ID NOs: 124 to 134.

[0347] 39. The gRNA of embodiment 37, wherein the backbone of the sgRNA has a nucleotide sequence having at least 95% sequence identity to any one of SEQ ID NOs: 124 to 134.

[0348] 40. The gRNA of embodiment 37, wherein the backbone of the sgRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 124 to 134.

[0349] 41. The gRNA of any one of embodiments 1 to 8, wherein the gRNA comprises a first stem-loop formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, wherein the first stem-loop comprises a first stem and a second stem, and wherein the first stem of the first stem-loop comprises a total length of at least 3, 4, 5, 6, 7, 8, 9, 10, or 11 base pairs (bp).

[0350] 42. The gRNA of any one of embodiments 1 to 8, wherein the gRNA comprises a first stem-loop formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, wherein the first stem-loop comprises a first stem and a second stem, and wherein the first stem of the first stem-loop comprises a total length of at most 3, 4, 5, 6, 7, 8, 9, 10, or 11 bp.

[0351] 43. The gRNA of embodiment 41 or 42, wherein the first stem of the first stem-loop comprises a total length of 6 bp.

[0352] 44. The gRNA of embodiment 41 or 42, wherein the first stem of the first stem-loop comprises a total length of 3 bp.

[0353] 45. The gRNA of any one of embodiments 1 to 8, wherein the tail of the tracrRNA comprises a total length of at least 1, 2, 3, 4, 5, 6, or 7 nucleotides.

[0354] 46. ​​The gRNA of any one of embodiments 1 to 8, wherein the tail of the tracrRNA comprises a total length of at most 1, 2, 3, 4, 5, 6, or 7 nucleotides.

[0355] 47. The gRNA of embodiment 45 or 46, wherein the tail of the tracrRNA comprises a total length of 3 nucleotides.

[0356] 48. The gRNA of embodiment 45 or 46, wherein the tail of the tracrRNA comprises a total length of 1 nucleotide.

[0357] 49. The gRNA of embodiment 41 or 42, wherein the gRNA further comprises a second stem-loop proximal to the tail, wherein the second stem-loop comprises a first stem and a second stem.

[0358] 50. The gRNA of embodiment 49, wherein the first stem of the second stem-loop comprises a total length of at least 1, 2, 3, 4, 5, or 6 bp.

[0359] 51. The gRNA of embodiment 49, wherein the first stem of the second stem-loop comprises a total length of at most 1, 2, 3, 4, 5, or 6 bp.

[0360] 52. The gRNA of embodiment 50 or 51, wherein the first stem of the second stem-loop comprises a total length of 5 bp.

[0361] 53. The gRNA of any one of embodiments 49 to 52, wherein the first stem of the first stem-loop comprises a total length of 6 bp, the tail of the tracrRNA comprises a total length of 3 nucleotides, and the first stem of the second stem-loop comprises a total length of 5 bp.

[0362] 54. The gRNA of any one of embodiments 1 to 8, wherein the gRNA is a dual-guide RNA (dgRNA).

[0363] 55. The gRNA of embodiment 54, wherein the crRNA repeat sequence of the dgRNA comprises a total length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides.

[0364] 56. The gRNA of embodiment 54, wherein the crRNA repeat sequence of the dgRNA comprises a total length of at most 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides.

[0365] 57. The gRNA of embodiment 55 or 56, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 13 nucleotides.

[0366] 58. The gRNA of embodiment 55 or 56, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 16 nucleotides.

[0367] 59. The gRNA of embodiment 55 or 56, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 21 nucleotides.

[0368] 60. The gRNA of embodiment 54, wherein the tracrRNA of the dgRNA comprises a total length of at least 65, 70, 75, 80, or 85 nucleotides.

[0369] 61. The gRNA of embodiment 54, wherein the tracrRNA of the dgRNA comprises a total length of at most 65, 70, 75, 80, or 85 nucleotides.

[0370] 62. The gRNA of embodiment 60 or 61, wherein the tracrRNA of the dgRNA comprises a total length of 74 nucleotides.

[0371] 63. The gRNA of embodiment 60 or 61, wherein the tracrRNA of the dgRNA comprises a total length of 77 nucleotides.

[0372] 64. The gRNA of any one of embodiments 1 to 63, wherein the gRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides.

[0373] 65. The gRNA of any one of embodiments 1 to 63, wherein the gRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides.

[0374] 66. The gRNA of any one of embodiments 1 to 63, wherein the gRNA comprises a total length of 106 to 135 nucleotides.

[0375] 67. The gRNA of embodiment 66, wherein the gRNA comprises a total length of 117 to 119 nucleotides.

[0376] 68. The gRNA of any one of embodiments 1 to 67, wherein the gRNA is capable of targeting a bound RNA-guided nuclease (RGN) polypeptide to the target sequence.

[0377] 69. The gRNA of embodiment 68, wherein the RGN polypeptide is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC.

[0378] 70. The gRNA of embodiment 69, wherein the RGN polypeptide is capable of recognizing a gRNA having a sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, The complete PAM of the nucleotide sequence set forth in any one of GGGCCCAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG.

[0379] 71. The gRNA of any one of embodiments 68 to 70, wherein the RGN polypeptide has an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 105; and wherein the target sequence and the spacer are selected from the group consisting of:

[0380] a) a target sequence having the nucleotide sequence shown in SEQ ID NO: 8 and a spacer having the nucleotide sequence shown in SEQ ID NO: 7 or a nucleotide sequence that differs from SEQ ID NO: 7 in length and / or sequence by 1 to 5 nucleotides; and

[0381] b) a target sequence having the nucleotide sequence shown in SEQ ID NO: 10 and a spacer having the nucleotide sequence shown in SEQ ID NO: 9 or a nucleotide sequence that differs from SEQ ID NO: 9 in length and / or sequence by 1 to 5 nucleotides.

[0382] 72. The gRNA of embodiment 71, wherein the target sequence and the spacer are selected from the group consisting of:

[0383] a) a target sequence having the nucleotide sequence shown in SEQ ID NO: 8 and a spacer having the nucleotide sequence shown in SEQ ID NO: 7 or a nucleotide sequence that differs from SEQ ID NO: 7 by 5 nucleotides in length and / or sequence; and

[0384] b) a target sequence having the nucleotide sequence shown in SEQ ID NO: 10 and a spacer having the nucleotide sequence shown in SEQ ID NO: 9 or a nucleotide sequence that differs from SEQ ID NO: 9 by 5 nucleotides in length and / or sequence.

[0385] 73. The gRNA of embodiment 71, wherein the target sequence and the spacer are selected from the group consisting of:

[0386] a) a target sequence having the nucleotide sequence shown in SEQ ID NO: 8 and a spacer having the nucleotide sequence shown in SEQ ID NO: 7 or a nucleotide sequence that differs from SEQ ID NO: 7 by 4 nucleotides in length and / or sequence; and

[0387] b) a target sequence having the nucleotide sequence shown in SEQ ID NO: 10 and a spacer having the nucleotide sequence shown in SEQ ID NO: 9 or a nucleotide sequence that differs from SEQ ID NO: 9 by 4 nucleotides in length and / or sequence.

[0388] 74. The gRNA of embodiment 71, wherein the target sequence and the spacer are selected from the group consisting of:

[0389] a) a target sequence having the nucleotide sequence shown in SEQ ID NO: 8 and a spacer having the nucleotide sequence shown in SEQ ID NO: 7 or a nucleotide sequence that differs from SEQ ID NO: 7 by 3 nucleotides in length and / or sequence; and

[0390] b) a target sequence having the nucleotide sequence shown in SEQ ID NO: 10 and a spacer having the nucleotide sequence shown in SEQ ID NO: 9 or a nucleotide sequence that differs from SEQ ID NO: 9 by 3 nucleotides in length and / or sequence.

[0391] 75. The gRNA of embodiment 71, wherein the target sequence and the spacer are selected from the group consisting of:

[0392] a) a target sequence having the nucleotide sequence shown in SEQ ID NO: 8 and a spacer having the nucleotide sequence shown in SEQ ID NO: 7 or a nucleotide sequence that differs from SEQ ID NO: 7 by 2 nucleotides in length and / or sequence; and

[0393] b) a target sequence having the nucleotide sequence shown in SEQ ID NO: 10 and a spacer having the nucleotide sequence shown in SEQ ID NO: 9 or a nucleotide sequence that differs from SEQ ID NO: 9 by 2 nucleotides in length and / or sequence.

[0394] 76. The gRNA of embodiment 71, wherein the target sequence and the spacer are selected from the group consisting of:

[0395] a) a target sequence having the nucleotide sequence shown in SEQ ID NO: 8 and a spacer having the nucleotide sequence shown in SEQ ID NO: 7 or a nucleotide sequence that differs from SEQ ID NO: 7 by 1 nucleotide in length and / or sequence; and

[0396] b) a target sequence having the nucleotide sequence shown in SEQ ID NO: 10 and a spacer having the nucleotide sequence shown in SEQ ID NO: 9 or a nucleotide sequence that differs from SEQ ID NO: 9 by 1 nucleotide in length and / or sequence.

[0397] 77. The gRNA of embodiment 71, wherein the spacer region has a nucleotide sequence as shown in SEQ ID NO: 7 or 9.

[0398] 78. The gRNA of any one of embodiments 71 to 77, wherein the RGN polypeptide has an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 105.

[0399] 79. The gRNA of any one of embodiments 71 to 77, wherein the RGN polypeptide has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 105.

[0400] 80. The gRNA of any one of embodiments 71 to 77, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO: 105.

[0401] 81. The gRNA of any one of embodiments 71 to 80, wherein the RGN polypeptide has an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 333.

[0402] 82. The gRNA of embodiment 81, wherein the RGN polypeptide has an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 333.

[0403] 83. The gRNA of embodiment 81, wherein the RGN polypeptide has an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 333.

[0404] 84. The gRNA of embodiment 81, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO: 333.

[0405] 85. The gRNA of any one of embodiments 68 to 84, wherein the gRNA has a nucleotide sequence having at least 80% sequence identity with any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259.

[0406] 86. The gRNA of embodiment 85, wherein the gRNA has a nucleotide sequence having at least 90% sequence identity with any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259.

[0407] 87. The gRNA of embodiment 85, wherein the gRNA has a nucleotide sequence having at least 95% sequence identity with any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259.

[0408] 88. The gRNA of embodiment 85, wherein the gRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259.

[0409] 89. The gRNA of embodiment 88, wherein the gRNA has a nucleotide sequence as shown in SEQ ID NO: 204 or 205.

[0410] 90. The gRNA of embodiment 68 or 69, wherein the RGN polypeptide has an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 327 or 330.

[0411] 91. The gRNA of embodiment 90, wherein the RGN polypeptide has an amino acid sequence with at least 90% sequence identity to SEQ ID NO: 327 or 330.

[0412] 92. The gRNA of embodiment 90, wherein the RGN polypeptide has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 327 or 330.

[0413] 93. The gRNA of embodiment 90, wherein the RGN polypeptide has an amino acid sequence as shown in SEQ ID NO: 327 or 330.

[0414] 94. The gRNA of embodiment 70, wherein the RGN polypeptide is capable of recognizing a complete PAM having a nucleotide sequence as shown in GGGCCCAG.

[0415] 95. The gRNA of embodiment 94, wherein the RGN polypeptide has an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 324.

[0416] 96. The gRNA of embodiment 95, wherein the RGN polypeptide has an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 324.

[0417] 97. The gRNA of embodiment 95, wherein the RGN polypeptide has an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 324.

[0418] 98. The gRNA of embodiment 95, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO: 324.

[0419] 99. The gRNA of embodiment 70, wherein the RGN polypeptide is capable of recognizing a complete PAM having a nucleotide sequence as shown in CAGGCCAA.

[0420] 100. The gRNA of embodiment 99, wherein the RGN polypeptide has an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 404.

[0421] 101. The gRNA of embodiment 100, wherein the RGN polypeptide has an amino acid sequence that has at least 90% sequence identity to SEQ ID NO: 404.

[0422] 102. The gRNA of embodiment 100, wherein the RGN polypeptide has an amino acid sequence that has at least 95% sequence identity to SEQ ID NO: 404.

[0423] 103. The gRNA of embodiment 100, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO: 404.

[0424] 104. The gRNA of any one of embodiments 1 to 103, wherein the gRNA comprises at least one chemical modification.

[0425] 105. The gRNA of embodiment 104, wherein the at least one chemical modification comprises a bridging nucleic acid (BNA) modification; a 2'-O-methyl (2'-O-Me) modification; a 2'-O-methoxy-ethyl (2'MOE) modification; a 2'-fluoro (2'-F) modification; a 2'F-4'Cα-OMe modification; a 2',4'-di-Cα-OMe modification; a 2'-O-methyl 3' phosphorothioate (MS) modification; a 2'-O-methyl 3' thiophosphonoacetate (MSP) modification; a 2'-O-methyl 3' phosphonoacetate (MP) modification; a phosphorothioate (PS) modification; or a combination thereof.

[0426] 106. The gRNA of embodiment 105, wherein the at least one chemical modification comprises MS modification at the 3 terminal nucleotides of the 5' region and the 3 terminal nucleotides of the 3' region of the gRNA.

[0427] 107. The gRNA of embodiment 106, wherein the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 430, 432 to 435, 583, 585, and 587.

[0428] 108. The gRNA of embodiment 106 or 107, wherein the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 459 to 520.

[0429] 109. The gRNA of any one of embodiments 106 to 108, wherein the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 431, 437 to 446, 584, 586, and 588.

[0430] 110. The gRNA of any one of embodiments 106 to 109, wherein the gRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582.

[0431] 111. The gRNA of embodiment 105, wherein the BNA comprises a 2',4' BNA modification.

[0432] 112. The gRNA according to embodiment 111, wherein the 2', 4' BNA modification is selected from the group consisting of: locked nucleic acid (LNA) modification, BNA NC [N-Me] modification, 2'-O,4'-C-ethylene-bridged nucleic acid (2',4'-ENA) modification, and S-constrained ethyl (cEt) modification.

[0433] 113. The gRNA of embodiment 112, wherein the 2', 4' BNA is LNA modified.

[0434] 114. The gRNA of embodiment 112, wherein the 2', 4' BNA is cEt modified.

[0435] 115. The gRNA of embodiment 105, wherein the at least one chemical modification comprises a BNA modification, a 2'-O-Me modification, a PS modification, or a combination thereof.

[0436] 116. The gRNA of any one of embodiments 1 to 115, wherein the gRNA further comprises an extension region comprising an editing template for reverse transcriptase (RT) editing.

[0437] 117. A guide RNA (gRNA) comprising a CRISPR RNA (crRNA) and a transactivating CRISPR RNA (tracrRNA), wherein the crRNA comprises:

[0438] (i) crRNA repeat sequences; and

[0439] (ii) a spacer region,

[0440] wherein the tracrRNA comprises:

[0441] (iii) anti-repeat sequences; and

[0442] (iv) tail,

[0443] wherein the spacer has a nucleotide sequence as shown in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 and 103, or has a length and / or sequence similar to that of SEQ ID NO: 99, 101, and 103.

[0444] 118. The gRNA of embodiment 117, wherein the spacer has a nucleotide sequence that differs by 5 nucleotides in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0445] 119. The gRNA of embodiment 117, wherein the spacer region has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 4 nucleotides.

[0446] 120. The gRNA of embodiment 117, wherein the spacer has a nucleotide sequence that differs in length and / or sequence by 3 nucleotides from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0447] 121. The gRNA of embodiment 117, wherein the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 2 nucleotides.

[0448] 122. The gRNA of embodiment 117, wherein the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0449] 123. The gRNA of embodiment 117, wherein the spacer has a nucleotide sequence as shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

[0450] 124. The gRNA of any one of embodiments 117 to 123, wherein the spacer is capable of hybridizing to a target sequence as set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

[0451] 125. The gRNA of any one of embodiments 117 to 124, wherein the crRNA repeat sequence has a nucleotide sequence as shown in SEQ ID NO: 106 or a nucleotide sequence that differs from SEQ ID NO: 106 by 1 to 8 nucleotides in length and / or sequence.

[0452] 126. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 8 nucleotides in length and / or sequence.

[0453] 127. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 7 nucleotides in length and / or sequence.

[0454] 128. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 6 nucleotides in length and / or sequence.

[0455] 129. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 5 nucleotides in length and / or sequence.

[0456] 130. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 4 nucleotides in length and / or sequence.

[0457] 131. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 3 nucleotides in length and / or sequence.

[0458] 132. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence that differs from SEQ ID NO: 106 by 2 nucleotides in length and / or sequence.

[0459] 133. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence that differs in length and / or sequence from SEQ ID NO: 106 by 1 nucleotide.

[0460] 134. The gRNA of embodiment 125, wherein the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 106, 109 to 112, 328, 331, and 334.

[0461] 135. The gRNA of any one of embodiments 117 to 125, wherein the crRNA has a nucleotide sequence having at least 80% sequence identity with SEQ ID NOs: 136 to 197.

[0462] 136. The gRNA of embodiment 135, wherein the crRNA has a nucleotide sequence having at least 90% sequence identity with SEQ ID NOs: 136 to 197.

[0463] 137. The gRNA of embodiment 135, wherein the crRNA has a nucleotide sequence having at least 95% sequence identity with SEQ ID NOs: 136 to 197.

[0464] 138. The gRNA of embodiment 135, wherein the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 136 to 197.

[0465] 139. The gRNA of any one of embodiments 117 to 125, wherein the tracrRNA has a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 107.

[0466] 140. The gRNA of embodiment 139, wherein the tracrRNA has a nucleotide sequence that has at least 90% sequence identity to SEQ ID NO: 107.

[0467] 141. The gRNA of embodiment 139, wherein the tracrRNA has a nucleotide sequence that has at least 95% sequence identity to SEQ ID NO: 107.

[0468] 142. The gRNA of any one of embodiments 117 to 125, wherein the tracrRNA has a nucleotide sequence that differs in length from SEQ ID NO: 107 by 1 to 16 nucleotides.

[0469] 143. The gRNA of embodiment 142, wherein the tracrRNA has a nucleotide sequence that is 8 nucleotides shorter than SEQ ID NO: 107.

[0470] 144. The gRNA of embodiment 142, wherein the tracrRNA has a nucleotide sequence that is 11 nucleotides shorter than SEQ ID NO: 107.

[0471] 145. The gRNA of any one of embodiments 139 to 144, wherein the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335.

[0472] 146. The gRNA of any one of embodiments 117 to 124, wherein the gRNA is a single guide RNA (sgRNA) comprising the crRNA and the tracrRNA connected by a linker, wherein the sgRNA comprises a backbone and the spacer, and wherein the backbone of the sgRNA comprises the crRNA repeat sequence, the linker, and the tracrRNA.

[0473] 147. The gRNA of embodiment 146, wherein the linker has a nucleotide sequence as shown in AAAG, GAAA, ACUU or CAAAGG.

[0474] 148. The gRNA of embodiment 147, wherein the linker has a nucleotide sequence as shown in AAAG.

[0475] 149. The gRNA of any one of embodiments 146 to 148, wherein the backbone of the sgRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides.

[0476] 150. The gRNA of any one of embodiments 146 to 148, wherein the backbone of the sgRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides.

[0477] 151. The gRNA of any one of embodiments 146 to 148, wherein the backbone of the sgRNA comprises a total length of 86 to 98 nucleotides.

[0478] 152. The gRNA of any one of embodiments 146 to 148, wherein the backbone of the sgRNA comprises a total length of 94 nucleotides.

[0479] 153. The gRNA of any one of embodiments 146 to 148, wherein the backbone of the sgRNA has a nucleotide sequence having at least 80% sequence identity with any one of SEQ ID NOs: 124 to 134.

[0480] 154. The gRNA of embodiment 153, wherein the backbone of the sgRNA has a nucleotide sequence having at least 90% sequence identity with any one of SEQ ID NOs: 124 to 134.

[0481] 155. The gRNA of embodiment 153, wherein the backbone of the sgRNA has a nucleotide sequence having at least 95% sequence identity with any one of SEQ ID NOs: 124 to 134.

[0482] 156. The gRNA of embodiment 153, wherein the backbone of the sgRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 124 to 134.

[0483] 157. The gRNA of any one of embodiments 117 to 124, wherein the gRNA comprises a first stem-loop formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, wherein the first stem-loop comprises a first stem and a second stem, and wherein the first stem of the first stem-loop comprises a total length of at least 3, 4, 5, 6, 7, 8, 9, 10, or 11 base pairs (bp).

[0484] 158. The gRNA of any one of embodiments 117 to 124, wherein the gRNA comprises a first stem-loop formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, wherein the first stem-loop comprises a first stem and a second stem, and wherein the first stem of the first stem-loop comprises a total length of at most 3, 4, 5, 6, 7, 8, 9, 10, or 11 bp.

[0485] 159. The gRNA of embodiment 157 or 158, wherein the first stem of the first stem-loop comprises a total length of 6 bp.

[0486] 160. The gRNA of embodiment 157 or 158, wherein the first stem of the first stem-loop comprises a total length of 3 bp.

[0487] 161. The gRNA of any one of embodiments 117 to 124, wherein the tail of the tracrRNA comprises a total length of at least 1, 2, 3, 4, 5, 6, or 7 nucleotides.

[0488] 162. The gRNA of any one of embodiments 117 to 124, wherein the tail of the tracrRNA comprises a total length of at most 1, 2, 3, 4, 5, 6, or 7 nucleotides.

[0489] 163. The gRNA of embodiment 161 or 162, wherein the tail of the tracrRNA comprises a total length of 3 nucleotides.

[0490] 164. The gRNA of embodiment 161 or 162, wherein the tail of the tracrRNA comprises a total length of 1 nucleotide.

[0491] 165. The gRNA of embodiment 157 or 158, wherein the gRNA further comprises a second stem loop proximal to the tail, wherein the second stem loop comprises a first stem and a second stem.

[0492] 166. The gRNA of embodiment 165, wherein the first stem of the second stem-loop comprises a total length of at least 1, 2, 3, 4, 5, or 6 bp.

[0493] 167. The gRNA of embodiment 165, wherein the first stem of the second stem-loop comprises a total length of at most 1, 2, 3, 4, 5, or 6 bp.

[0494] 168. The gRNA of embodiment 166 or 167, wherein the first stem of the second stem-loop comprises a total length of 5 bp.

[0495] 169. The gRNA of any one of embodiments 165 to 168, wherein the first stem of the first stem-loop comprises a total length of 6 bp, the tail of the tracrRNA comprises a total length of 3 nucleotides, and the first stem of the second stem-loop comprises a total length of 5 bp.

[0496] 170. The gRNA of any one of embodiments 117 to 124, wherein the gRNA is a dual-guide RNA (dgRNA).

[0497] 171. The gRNA of embodiment 170, wherein the crRNA repeat sequence of the dgRNA comprises a total length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides.

[0498] 172. The gRNA of embodiment 170, wherein the crRNA repeat sequence of the dgRNA comprises a total length of at most 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides.

[0499] 173. The gRNA of embodiment 171 or 172, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 13 nucleotides.

[0500] 174. The gRNA of embodiment 171 or 172, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 16 nucleotides.

[0501] 175. The gRNA of embodiment 171 or 172, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 21 nucleotides.

[0502] 176. The gRNA of embodiment 170, wherein the tracrRNA of the dgRNA comprises a total length of at least 65, 70, 75, 80, or 85 nucleotides.

[0503] 177. The gRNA of embodiment 170, wherein the tracrRNA of the dgRNA comprises a total length of at most 65, 70, 75, 80, or 85 nucleotides.

[0504] 178. The gRNA of embodiment 176 or 177, wherein the tracrRNA of the dgRNA comprises a total length of 74 nucleotides.

[0505] 179. The gRNA of embodiment 176 or 177, wherein the tracrRNA of the dgRNA comprises a total length of 77 nucleotides.

[0506] 180. The gRNA of any one of embodiments 117 to 179, wherein the gRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides.

[0507] 181. The gRNA of any one of embodiments 117 to 179, wherein the gRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides.

[0508] 182. The gRNA of any one of embodiments 117 to 179, wherein the gRNA comprises a total length of 106 to 135 nucleotides.

[0509] 183. The gRNA of embodiment 182, wherein the gRNA comprises a total length of 117 to 119 nucleotides.

[0510] 184. The gRNA of any one of embodiments 117 to 183, wherein the gRNA is capable of targeting a bound ...

Claims

1. A guide RNA (gRNA) comprising CRISPR RNA (crRNA) and a transactivating CRISPR RNA (tracrRNA), wherein the crRNA comprises: (i) crRNA repeat sequences; and (ii) a spacer region, wherein the tracrRNA comprises: (iii) anti-repeat sequences; and (iv) tail, wherein the spacer is capable of hybridizing to a target sequence in a T cell receptor alpha chain constant (TRAC) gene, wherein the target sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

2. The gRNA of claim 1 , wherein the spacer has a nucleotide sequence that differs in length and / or sequence from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103 by 1 to 5 nucleotides.

3. The gRNA of claim 1 , wherein the spacer has a nucleotide sequence as shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

4. The gRNA according to any one of claims 1 to 3, wherein the crRNA repeats have a nucleotide sequence as shown in SEQ ID NO: 106 or a nucleotide sequence that differs from SEQ ID NO: 106 by 1 to 8 nucleotides in length and / or sequence.

5. The gRNA of claim 4, wherein the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 106, 109 to 112, 328, 331, and 334.

6. The gRNA of any one of claims 1 to 5, wherein the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 136 to 197.

7. The gRNA of any one of claims 1 to 6, wherein the tracrRNA has a nucleotide sequence that has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO:

107.

8. The gRNA of any one of claims 1 to 6, wherein the tracrRNA has a nucleotide sequence that differs from SEQ ID NO: 107 by 1 to 16 nucleotides in length.

9. The gRNA of claim 8, wherein the tracrRNA has a nucleotide sequence that is 8 nucleotides shorter than SEQ ID NO:

107.

10. The gRNA of claim 8, wherein the tracrRNA has a nucleotide sequence that is 11 nucleotides shorter than SEQ ID NO:

107.

11. The gRNA according to any one of claims 7 to 10, wherein the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335.

12. The gRNA of any one of claims 1 to 3, wherein the gRNA is a single guide RNA (sgRNA) comprising the crRNA and the tracrRNA connected by a linker, wherein the sgRNA comprises a backbone and the spacer, and wherein the backbone of the sgRNA comprises the crRNA repeats, the linker, and the tracrRNA.

13. The gRNA of claim 12, wherein the linker has a nucleotide sequence as shown in AAAG, GAAA, ACUU or CAAAGG.

14. The gRNA according to claim 13, wherein the linker has a nucleotide sequence as shown in AAAG.

15. The gRNA of any one of claims 12 to 14, wherein the backbone of the sgRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides.

16. The gRNA of any one of claims 12 to 14, wherein the backbone of the sgRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides.

17. The gRNA of any one of claims 12 to 14, wherein the backbone of the sgRNA comprises a total length of 86 to 98 nucleotides.

18. The gRNA of any one of claims 12 to 14, wherein the backbone of the sgRNA comprises a total length of 94 nucleotides.

19. The gRNA of any one of claims 12 to 14, wherein the backbone of the sgRNA has a nucleotide sequence having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to any one of SEQ ID NOs: 124 to 134.

20. The gRNA of any one of claims 1 to 3, wherein the gRNA comprises a first stem-loop formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, wherein the first stem-loop comprises a first stem and a second stem, and wherein the first stem of the first stem-loop comprises a total length of at least 3, 4, 5, 6, 7, 8, 9, 10, or 11 base pairs (bp).

21. The gRNA of any one of claims 1 to 3, wherein the gRNA comprises a first stem-loop formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, wherein the first stem-loop comprises a first stem and a second stem, and wherein the first stem of the first stem-loop comprises a total length of at most 3, 4, 5, 6, 7, 8, 9, 10, or 11 bp.

22. The gRNA of claim 20 or 21, wherein the first stem of the first stem-loop comprises a total length of 6 bp.

23. The gRNA of claim 20 or 21, wherein the first stem of the first stem-loop comprises a total length of 3 bp.

24. The gRNA of any one of claims 1 to 3, wherein the tail of the tracrRNA comprises a total length of at least 1, 2, 3, 4, 5, 6, or 7 nucleotides.

25. The gRNA of any one of claims 1 to 3, wherein the tail of the tracrRNA comprises a total length of at most 1, 2, 3, 4, 5, 6, or 7 nucleotides.

26. The gRNA of claim 24 or 25, wherein the tail of the tracrRNA comprises a total length of 3 nucleotides.

27. The gRNA of claim 24 or 25, wherein the tail of the tracrRNA comprises a total length of 1 nucleotide.

28. The gRNA of claim 20 or 21, wherein the gRNA further comprises a second stem-loop proximal to the tail, wherein the second stem-loop comprises a first stem and a second stem.

29. The gRNA of claim 28, wherein the first stem of the second stem-loop comprises a total length of at least 1, 2, 3, 4, 5, or 6 bp.

30. The gRNA of claim 28, wherein the first stem of the second stem-loop comprises a total length of at most 1, 2, 3, 4, 5, or 6 bp.

31. The gRNA of claim 29 or 30, wherein the first stem of the second stem-loop comprises a total length of 5 bp.

32. The gRNA of any one of claims 28 to 31 , wherein the first stem of the first stem-loop comprises a total length of 6 bp, the tail of the tracrRNA comprises a total length of 3 nucleotides, and the first stem of the second stem-loop comprises a total length of 5 bp.

33. The gRNA of any one of claims 1 to 3, wherein the gRNA is a double-guide RNA (dgRNA).

34. The gRNA of claim 33, wherein the crRNA repeat sequence of the dgRNA comprises a total length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides.

35. The gRNA of claim 33, wherein the crRNA repeat sequence of the dgRNA comprises a total length of at most 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides.

36. The gRNA of claim 34 or 35, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 13 nucleotides.

37. The gRNA of claim 34 or 35, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 16 nucleotides.

38. The gRNA of claim 34 or 35, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 21 nucleotides.

39. The gRNA of claim 33, wherein the tracrRNA of the dgRNA comprises a total length of at least 65, 70, 75, 80, or 85 nucleotides.

40. The gRNA of claim 33, wherein the tracrRNA of the dgRNA comprises a total length of at most 65, 70, 75, 80, or 85 nucleotides.

41. The gRNA of claim 39 or 40, wherein the tracrRNA of the dgRNA comprises a total length of 74 nucleotides.

42. The gRNA of claim 39 or 40, wherein the tracrRNA of the dgRNA comprises a total length of 77 nucleotides.

43. The gRNA of any one of claims 1 to 42, wherein the gRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides.

44. The gRNA of any one of claims 1 to 42, wherein the gRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides.

45. The gRNA of any one of claims 1 to 42, wherein the gRNA comprises a total length of 106 to 135 nucleotides.

46. ​​The gRNA of claim 45, wherein the gRNA comprises a total length of 117 to 119 nucleotides.

47. The gRNA of any one of claims 1 to 46, wherein the gRNA is capable of targeting a bound RNA-guided nuclease (RGN) polypeptide to the target sequence.

48. The gRNA of claim 47, wherein the RGN polypeptide is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC.

49. The gRNA of claim 48, wherein the RGN polypeptide is capable of recognizing a gRNA having a sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, The complete PAM of the nucleotide sequence set forth in any one of GGGCCCAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG.

50. The gRNA of any one of claims 47 to 49, wherein the RGN polypeptide has an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 105; and wherein the target sequence and the spacer are selected from the group consisting of: a) a target sequence having the nucleotide sequence shown in SEQ ID NO: 8 and a spacer having the nucleotide sequence shown in SEQ ID NO: 7 or a nucleotide sequence that differs from SEQ ID NO: 7 in length and / or sequence by 1 to 5 nucleotides; and b) a target sequence having the nucleotide sequence shown in SEQ ID NO: 10 and a spacer having the nucleotide sequence shown in SEQ ID NO: 9 or a nucleotide sequence that differs from SEQ ID NO: 9 in length and / or sequence by 1 to 5 nucleotides.

51. The gRNA of claim 50, wherein the spacer has a nucleotide sequence as shown in SEQ ID NO: 7 or 9.

52. The gRNA of claim 50 or 51, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO:

105.

53. The gRNA of any one of claims 47 to 49, wherein the RGN polypeptide has an amino acid sequence that has at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to SEQ ID NO:

333.

54. The gRNA of claim 53, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO:

333.

55. The gRNA of any one of claims 47 to 54, wherein the gRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241, and 243 to 259.

56. The gRNA of claim 55, wherein the gRNA has a nucleotide sequence as shown in SEQ ID NO: 204 or 205.

57. The gRNA of claim 47 or 48, wherein the RGN polypeptide has an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to SEQ ID NO: 327 or 330.

58. The gRNA of claim 57, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO: 327 or 330.

59. The gRNA of any one of claims 1 to 58, wherein the gRNA comprises at least one chemical modification.

60. The gRNA of claim 59, wherein the at least one chemical modification comprises a bridging nucleic acid (BNA) modification; a 2'-O-methyl (2'-O-Me) modification; a 2'-O-methoxy-ethyl (2'MOE) modification; a 2'-fluoro (2'-F) modification; a 2'F-4'Cα-OMe modification; a 2',4'-di-Cα-OMe modification; a 2'-O-methyl 3' phosphorothioate (MS) modification; a 2'-O-methyl 3' thiophosphonoacetate (MSP) modification; a 2'-O-methyl 3' phosphonoacetate (MP) modification; a phosphorothioate (PS) modification; or a combination thereof.

61. The gRNA of claim 60, wherein the at least one chemical modification comprises MS modifications at the 3 terminal nucleotides of the 5' region and the 3 terminal nucleotides of the 3' region of the gRNA.

62. The gRNA of claim 61, wherein the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 430, 432 to 435, 583, 585, and 587.

63. The gRNA of claim 61 or 62, wherein the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 459 to 520.

64. The gRNA of any one of claims 61 to 63, wherein the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 431, 437 to 446, 584, 586, and 588.

65. The gRNA of any one of claims 61 to 64, wherein the gRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 521 to 523, 525 to 536, 538 to 556, 558 to 564, and 566 to 582.

66. The gRNA of claim 60, wherein the BNA comprises a 2', 4' BNA modification.

67. The gRNA of claim 66, wherein the 2', 4' BNA modification is selected from the group consisting of: locked nucleic acid (LNA) modification, BNA NC [N-Me] modification, 2'-O,4'-C-ethylene-bridged nucleic acid (2',4'-ENA) modification, and S-constrained ethyl (cEt) modification.

68. The gRNA of claim 67, wherein the 2', 4' BNA is LNA modified.

69. The gRNA of claim 67, wherein the 2', 4' BNA is cEt modified.

70. The gRNA of claim 60, wherein the at least one chemical modification comprises a BNA modification, a 2'-O-Me modification, a PS modification, or a combination thereof.

71. The gRNA of any one of claims 1 to 70, wherein the gRNA further comprises an extension region comprising an editing template for reverse transcriptase (RT) editing.

72. A guide RNA (gRNA) comprising a CRISPR RNA (crRNA) and a transactivating CRISPR RNA (tracrRNA), wherein the crRNA comprises: (i) crRNA repeat sequences; and (ii) a spacer region, wherein the tracrRNA comprises: (iii) anti-repeat sequences; and (iv) tail, wherein the spacer has a nucleotide sequence as shown in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 and 103, or has a length and / or sequence similar to that of SEQ ID NO: 99, 101, and 103.

73. The gRNA of claim 72, wherein the spacer has a nucleotide sequence as shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

74. The gRNA of claim 72 or 73, wherein the spacer is capable of hybridizing to a target sequence as set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

75. A nucleic acid molecule comprising a CRISPR RNA (crRNA) or encoding a crRNA, wherein the crRNA comprises a spacer and a crRNA repeat sequence, wherein the spacer is capable of hybridizing to a target sequence in a T cell receptor alpha chain constant (TRAC) gene, and wherein the target sequence has a nucleotide sequence as shown in any one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 and 104.

76. A nucleic acid molecule according to claim 75, wherein the spacer region has a nucleotide sequence that differs from any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 and 103 by 1 to 5 nucleotides in length and / or sequence.

77. A nucleic acid molecule according to claim 75, wherein the spacer region has a nucleotide sequence as shown in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 and 103.

78. The nucleic acid molecule of any one of claims 75 to 77, wherein the crRNA repeat sequence has a nucleotide sequence as shown in SEQ ID NO: 106 or a nucleotide sequence that differs from SEQ ID NO: 106 by 1 to 8 nucleotides in length and / or sequence.

79. The nucleic acid molecule of claim 78, wherein the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 106, 109 to 112, 328, 331 and 334.

80. The nucleic acid molecule of any one of claims 75 to 79, wherein the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 136 to 197.

81. The nucleic acid molecule of any one of claims 75 to 80, wherein the crRNA is capable of binding to a trans-activated CRISPR RNA (tracrRNA) to form a guide RNA (gRNA), wherein the tracrRNA comprises an anti-repeat sequence and a tail.

82. The nucleic acid molecule of claim 81, wherein the tracrRNA has a nucleotide sequence that has at least 80% sequence identity, at least 90% sequence identity, or at least 95% sequence identity to SEQ ID NO:

107.

83. The nucleic acid molecule of claim 81, wherein the tracrRNA has a nucleotide sequence that differs in length from SEQ ID NO: 107 by 1 to 16 nucleotides.

84. The nucleic acid molecule of claim 83, wherein the tracrRNA has a nucleotide sequence that is 8 nucleotides shorter than SEQ ID NO:

107.

85. The nucleic acid molecule of claim 83, wherein the tracrRNA has a nucleotide sequence that is 11 nucleotides shorter than SEQ ID NO:

107.

86. The nucleic acid molecule of claim 82 or 83, wherein the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 107, 114 to 123, 329, 332, and 335.

87. The nucleic acid molecule of claim 81, wherein the gRNA is a single guide RNA (sgRNA) comprising the crRNA and the tracrRNA connected by a linker, wherein the sgRNA comprises a backbone and the spacer, and wherein the backbone of the sgRNA comprises the crRNA repeat sequence, the linker, and the tracrRNA.

88. The nucleic acid molecule of claim 87, wherein the backbone of the sgRNA comprises a total length of 86 to 98 nucleotides.

89. The nucleic acid molecule of claim 87, wherein the backbone of the sgRNA comprises a total length of 94 nucleotides.

90. The nucleic acid molecule of any one of claims 87 to 89, wherein the backbone of the gRNA has a nucleotide sequence that has at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to any one of SEQ ID NOs: 124 to 134.

91. A nucleic acid molecule according to any one of claims 81 to 90, wherein the gRNA comprises a first stem-loop comprising a first stem and a second stem formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, and wherein the first stem of the first stem-loop comprises a total length of at least 3, 4, 5, 6, 7, 8, 9, 10 or 11 bp.

92. A nucleic acid molecule according to any one of claims 81 to 90, wherein the gRNA comprises a first stem-loop comprising a first stem and a second stem formed by hybridization of the crRNA repeat sequence and the anti-repeat sequence, and wherein the first stem of the first stem-loop comprises a total length of at most 3, 4, 5, 6, 7, 8, 9, 10 or 11 bp.

93. The nucleic acid molecule of claim 91 or 92, wherein the first stem of the first stem-loop comprises a total length of 6 bp.

94. The nucleic acid molecule of claim 91 or 92, wherein the first stem of the first stem-loop comprises a total length of 3 bp.

95. The nucleic acid molecule of any one of claims 81 to 94, wherein the tail of the tracrRNA comprises a total length of at least 1, 2, 3, 4, 5, 6, or 7 nucleotides.

96. The nucleic acid molecule of any one of claims 81 to 94, wherein the tail of the tracrRNA comprises a total length of at most 1, 2, 3, 4, 5, 6, or 7 nucleotides.

97. The nucleic acid molecule of claim 95 or 96, wherein the tail of the tracrRNA comprises a total length of 3 nucleotides.

98. The nucleic acid molecule of claim 95 or 96, wherein the tail of the tracrRNA comprises a total length of 1 nucleotide.

99. The nucleic acid molecule of any one of claims 91 to 98, wherein the gRNA further comprises a second stem loop proximal to the tail, wherein the second stem loop comprises a first stem and a second stem.

100. The nucleic acid molecule of claim 99, wherein the first stem of the second stem-loop comprises a total length of at least 1, 2, 3, 4, 5 or 6 bp.

101. The nucleic acid molecule of claim 99, wherein the first stem of the second stem-loop comprises a total length of at most 1, 2, 3, 4, 5 or 6 bp.

102. The nucleic acid molecule of claim 100 or 101, wherein the first stem of the second stem-loop comprises a total length of 5 bp.

103. The nucleic acid molecule of any one of claims 99 to 102, wherein the first stem of the first stem-loop comprises a total length of 6 bp, the tail of the tracrRNA comprises a total length of 3 nucleotides, and the first stem of the second stem-loop comprises a total length of 5 bp.

104. The nucleic acid molecule of claim 81, wherein the gRNA is a dual-guide RNA (dgRNA).

105. nucleic acid molecules according to claim 104, wherein the crRNA repetitive sequence comprises a total length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides.

106. nucleic acid molecules according to claim 104, wherein the crRNA repeat sequence comprises a total length of at most 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides.

107. The nucleic acid molecule of claim 105 or 106, wherein the crRNA repeat sequence comprises a total length of 13 nucleotides.

108. The nucleic acid molecule of claim 105 or 106, wherein the crRNA repeat sequence comprises a total length of 16 nucleotides.

109. The nucleic acid molecule of claim 105 or 106, wherein the crRNA repeat sequence of the dgRNA comprises a total length of 21 nucleotides.

110. The nucleic acid molecule of any one of claims 104 to 109, wherein the tracrRNA comprises a total length of at least 65, 70, 75, 80, or 85 nucleotides.

111. The nucleic acid molecule of any one of claims 104 to 109, wherein the tracrRNA comprises a total length of at most 65, 70, 75, 80, or 85 nucleotides.

112. The nucleic acid molecule of claim 110 or 111, wherein the tracrRNA comprises a total length of 74 nucleotides.

113. The nucleic acid molecule of claim 110 or 111, wherein the tracrRNA comprises a total length of 77 nucleotides.

114. The nucleic acid molecule of any one of claims 81 to 113, wherein the gRNA comprises a total length of at least 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides.

115. The nucleic acid molecule of any one of claims 81 to 113, wherein the gRNA comprises a total length of at most 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, or 135 nucleotides.

116. A nucleic acid molecule according to any one of claims 81 to 113, wherein the gRNA comprises a total length of 106 to 135 nucleotides.

117. The nucleic acid molecule of claim 116, wherein the gRNA comprises a total length of 117 to 119 nucleotides.

118. The nucleic acid molecule of any one of claims 81 to 117, wherein the gRNA is capable of targeting a bound RNA-guided nuclease (RGN) polypeptide to a target sequence.

119. The nucleic acid molecule of claim 118, wherein the RGN polypeptide is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC.

120. The nucleic acid molecule of claim 119, wherein the RGN polypeptide recognizes a nucleic acid sequence having a sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GGGCC The entire protospacer-adjacent motif (PAM) of the nucleotide sequence set forth in any one of CAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG.

121. The nucleic acid molecule of any one of claims 118 to 120, wherein the RGN polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 105; and wherein the target sequence and the spacer are selected from the group consisting of: a) a target sequence having the nucleotide sequence shown in SEQ ID NO: 8 and a spacer having the nucleotide sequence shown in SEQ ID NO: 7 or a nucleotide sequence that differs from SEQ ID NO: 7 in length and / or sequence by 1 to 5 nucleotides; and b) a target sequence having the nucleotide sequence shown in SEQ ID NO: 10 and a spacer having the nucleotide sequence shown in SEQ ID NO: 9 or a nucleotide sequence that differs from SEQ ID NO: 9 in length and / or sequence by 1 to 5 nucleotides.

122. The nucleic acid molecule of claim 121, wherein the spacer region has a nucleotide sequence as shown in SEQ ID NO: 7 or 9.

123. The nucleic acid molecule of claim 121 or 122, wherein the RGN polypeptide comprises the amino acid sequence shown in SEQ ID NO:

105.

124. The nucleic acid molecule of any one of claims 118 to 120, wherein the RGN polypeptide has an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to SEQ ID NO:

333.

125. The nucleic acid molecule of claim 124, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO:

333.

126. A nucleic acid molecule according to any one of claims 81 to 125, wherein the gRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 198 to 200, 202 to 213, 215 to 233, 235 to 241 and 243 to 259.

127. A nucleic acid molecule according to claim 126, wherein the gRNA has a nucleotide sequence as shown in SEQ ID NO: 204 or 205.

128. The nucleic acid molecule of claim 118 or 119, wherein the RGN polypeptide has an amino acid sequence having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to SEQ ID NO: 327 or 330.

129. The nucleic acid molecule of claim 128, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO: 327 or 330.

130. The nucleic acid molecule of any one of claims 81 to 125, wherein the gRNA comprises at least one chemical modification.

131. A nucleic acid molecule according to claim 130, wherein the at least one chemical modification comprises a bridged nucleic acid (BNA) modification; a 2'-O-methyl (2'-O-Me) modification; a 2'-O-methoxy-ethyl (2'MOE) modification; a 2'-fluoro (2'-F) modification; a 2'F-4'Cα-OMe modification; a 2',4'-di-Cα-OMe modification; a 2'-O-methyl 3' phosphorothioate (MS) modification; a 2'-O-methyl 3' thiophosphonoacetate (MSP) modification; a 2'-O-methyl 3' phosphonoacetate (MP) modification; a phosphorothioate (PS) modification; or a combination thereof.

132. The nucleic acid molecule of claim 131, wherein the at least one chemical modification comprises MS modification at the 3 terminal nucleotides of the 5' region and the 3 terminal nucleotides of the 3' region of the gRNA.

133. The nucleic acid molecule of claim 132, wherein the crRNA repeat sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 430, 432 to 435, 583, 585, and 587.

134. The nucleic acid molecule of claim 132 or 133, wherein the crRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 459 to 520.

135. The nucleic acid molecule of any one of claims 132 to 134, wherein the tracrRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 431, 437 to 446, 584, 586, and 588.

136. A nucleic acid molecule according to any one of claims 132 to 135, wherein the gRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 521 to 523, 525 to 536, 538 to 556, 558 to 564 and 566 to 582.

137. The nucleic acid molecule of claim 131, wherein the BNA comprises a 2', 4' BNA modification.

138. The nucleic acid molecule of claim 137, wherein the 2',4' BNA modification is selected from the group consisting of: a locked nucleic acid (LNA) modification, a BNA NC [N-Me] modification, 2'-O,4'-C-ethylene-bridged nucleic acid (2',4'-ENA) modification, and S-constrained ethyl (cEt) modification.

139. The nucleic acid molecule of claim 138, wherein the 2', 4' BNA is LNA modified.

140. The nucleic acid molecule of claim 138, wherein the 2',4' BNA is cEt modified.

141. The nucleic acid molecule of claim 131, wherein the at least one chemical modification comprises a BNA modification, a 2'-O-Me modification, a PS modification, or a combination thereof.

142. The nucleic acid molecule of any one of claims 81 to 141, wherein the gRNA further comprises an extension region comprising an editing template for reverse transcriptase editing.

143. A nucleic acid molecule comprising a CRISPR RNA (crRNA) or encoding a crRNA, wherein the crRNA comprises a spacer and a crRNA repeat, wherein the spacer has a nucleotide sequence as shown in any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103, or has a length and / or sequence similar to that of SEQ ID NO: 99, 101, and 103.

144. The nucleic acid molecule of claim 143, wherein the spacer comprises a nucleotide sequence as set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, and 103.

145. The nucleic acid molecule of claim 143 or 144, wherein the spacer is capable of hybridizing to a target sequence, and wherein the target sequence has a nucleotide sequence as shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and 104.

146. A vector comprising a nucleic acid molecule according to any one of claims 75 to 80, wherein the nucleic acid molecule comprises a polynucleotide encoding the crRNA.

147. The vector of claim 146, wherein the nucleic acid molecule further comprises a heterologous promoter operably linked to the polynucleotide encoding the crRNA.

148. The vector of claim 147, wherein the heterologous promoter is an RNA polymerase III (pol III) promoter.

149. The vector of any one of claims 146 to 148, wherein the vector further comprises a nucleic acid molecule encoding a RGN polypeptide.

150. The vector of claim 149, wherein the crRNA is capable of binding to tracrRNA to form a guide RNA, and wherein the guide RNA is capable of binding to the RGN polypeptide.

151. The vector of claim 149 or 150, wherein the vector further comprises a promoter operably linked to the nucleic acid molecule encoding the RGN polypeptide.

152. A vector comprising the nucleic acid molecule of any one of claims 81 to 142, wherein the nucleic acid molecule comprises a polynucleotide encoding the crRNA, and wherein the vector further comprises a polynucleotide encoding the tracrRNA.

153. The vector of claim 152, wherein the polynucleotide encoding the crRNA and the polynucleotide encoding the tracrRNA are operably linked to the same promoter and are encoded as sgRNA.

154. The vector of claim 152, wherein the polynucleotide encoding the crRNA and the polynucleotide encoding the tracrRNA are operably linked to separate promoters.

155. The vector of any one of claims 152 to 154, wherein the vector further comprises a nucleic acid molecule encoding a RGN polypeptide.

156. The vector of claim 155, wherein the crRNA is capable of binding to the tracrRNA to form a guide RNA, and wherein the guide RNA is capable of binding to the RGN polypeptide.

157. The vector of claim 155 or 156, wherein the vector further comprises a promoter operably linked to the nucleic acid molecule encoding the RGN polypeptide.

158. A cell comprising the gRNA of any one of claims 1 to 74, the nucleic acid molecule of any one of claims 75 to 145, or the vector of any one of claims 146 to 157.

159. An RNA-guided nuclease (RGN) system for binding to a target sequence within a TRAC gene, wherein the RGN system comprises: a) one or more guide RNAs (gRNAs) according to any one of claims 1 to 74, or one or more polynucleotides comprising one or more nucleotide sequences encoding one or more gRNAs according to any one of claims 1 to 74; and b) an RGN polypeptide, or a polynucleotide comprising a nucleotide sequence encoding said RGN polypeptide.

160. The RGN system of claim 159, wherein the one or more gRNAs are capable of forming a complex with the RGN polypeptide to direct the RGN polypeptide to bind to the target sequence.

161. The RGN system of claim 159 or 160, wherein the RGN polypeptide is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC.

162. The RGN system of claim 161, wherein the RGN polypeptide is capable of recognizing a polypeptide having a sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG , GGGCCCAG, TGTGCCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG.

163. The RGN system of any one of claims 159 to 162, wherein the RGN polypeptide comprises the amino acid sequence shown in SEQ ID NO:

105.

164. The RGN system of any one of claims 159 to 162, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO:

333.

165. The RGN system of any one of claims 159 to 161, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO: 327 or 330.

166. The RGN system of any one of claims 159 to 165, wherein the polynucleotide comprising a nucleotide sequence encoding the RGN polypeptide is codon-optimized for expression in mammalian cells.

167. The RGN system of any one of claims 159 to 166, wherein at least one of the one or more nucleotide sequences encoding the one or more gRNAs and the nucleotide sequence encoding the RGN polypeptide is operably linked to a promoter heterologous to the nucleotide sequence.

168. The RGN system of any one of claims 159 to 167, wherein the one or more nucleotide sequences encoding the one or more gRNAs and the nucleotide sequence encoding the RGN polypeptide are located on one vector.

169. The RGN system of any one of claims 159 to 165, wherein the polynucleotide comprising a nucleotide sequence encoding the RGN polypeptide comprises mRNA.

170. The RGN system of any one of claims 159 to 169, wherein the RGN polypeptide is nuclease-inactive or is a nickase.

171. The RGN system of any one of claims 159 to 170, wherein the RGN polypeptide is fused to a base editing polypeptide.

172. The RGN system of claim 171 , wherein the base editing polypeptide comprises a deaminase.

173. The RGN system of any one of claims 159 to 170, wherein the RGN polypeptide is fused to a reverse transcriptase (RT) editing polypeptide.

174. The RGN system of claim 173, wherein the RT editing polypeptide comprises a DNA polymerase.

175. The RGN system of claim 174, wherein the DNA polymerase comprises a reverse transcriptase.

176. The RGN system of any one of claims 173 to 175, wherein the gRNA further comprises an extension region comprising an editing template for RT editing.

177. The RGN system of any one of claims 159 to 176, wherein the RGN polypeptide comprises one or more nuclear localization signals.

178. A ribonucleoprotein (RNP) complex comprising the one or more gRNAs and the RGN polypeptide of the RGN system of any one of claims 159 to 177.

179. A cell comprising the RGN system of any one of claims 159 to 177 or the RNP complex of claim 178.

180. The cell of claim 179, wherein the cell is a eukaryotic cell.

181. The cell of claim 180, wherein the eukaryotic cell is a mammalian cell.

182. The cell of claim 181, wherein the mammalian cell is a human cell.

183. The cell of claim 181 or 182, wherein the mammalian or human cell is a T cell or an induced pluripotent stem cell.

184. A method for binding to a target sequence within a TRAC gene, comprising delivering the RGN system of any one of claims 159 to 177 or the RNP complex of claim 178 to the target sequence or a cell comprising the target sequence.

185. The method of claim 184, wherein cleavage or modification of the target sequence occurs.

186. A method for assembling an RNA-guided nuclease (RGN) ribonucleoprotein complex, the method comprising combining the following under conditions suitable for formation of the complex: a) a guide RNA according to any one of claims 1 to 74; and b) an RGN polypeptide that binds to the guide RNA.

187. The method of claim 186, wherein the RGN polypeptide is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC.

188. The method of claim 186 or 187, wherein the complex directs cleavage of the target sequence.

189. The method of claim 188, wherein the cleavage produces a double-strand break.

190. The method of claim 188, wherein the cleavage produces a single-strand break.

191. A method for binding to a target sequence within a TRAC gene, the method comprising: a) combining the following under conditions suitable for the formation of a ribonucleoprotein (RNP) complex: i) a guide RNA according to any one of claims 1 to 74; and ii) an RGN polypeptide that binds to the guide RNA; thereby assembling the RNP complex; and b) contacting the target sequence or a cell comprising the target sequence with the assembled RNP complex.

192. The method of claim 191, wherein the guide RNA hybridizes to the target sequence, thereby directing the binding of the RNP complex to the target sequence.

193. The method of claim 191 or 192, wherein the RGN polypeptide is capable of recognizing a consensus protospacer adjacent motif (PAM) having a nucleotide sequence as shown in NNNNCC or NNRNCC.

194. The method of claim 193, wherein the RGN polypeptide is capable of recognizing a polypeptide having a sequence such as AAATCCAG, CTGACCCT, AGAACCCT, AGATCCAT, GAGGCCAC, CCCCCCAC, CCTCCCAT, TGTTCCAA, AACTCCAG, TTTGCCTT, GCCTCCCA, AATACCTC, TGTGCCGG, TCTGCCCA, AAAACCCC, ACAGCCTG, AGAGCCAA, CAGTCCTG, ATCCCCTC, CTCTCCGT, AGCACCTG, GGGCCC The entire protospacer-adjacent motif (PAM) of the nucleotide sequence set forth in any one of AG, TGTGCTCTC, AAAACCGT, CAATCCTG, CTGCCCAG, CAGGCCAA, CTCCCCAG, AGAACCTG, AGACCCAG, TGTCCCTT, CCCTCCTG, AATGCCAC, CTCACCTC, TGATCCCC, GACACCAT, TCCGCCTC, CCCGCCTC, TATTCCAG, TTCACCGA, AAAACCAA, TCGACCAG, CCTGCCGT, and GAACCCTG.

195. The method of any one of claims 191 to 194, wherein the RGN polypeptide comprises the amino acid sequence shown in SEQ ID NO:

105.

196. The method of any one of claims 191 to 194, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO:

333.

197. The method of any one of claims 191 to 193, wherein the RGN polypeptide has the amino acid sequence shown in SEQ ID NO: 327 or 330.

198. The method of any one of claims 191 to 197, wherein the method is performed in vitro or ex vivo.

199. The method of any one of claims 191 to 198, wherein the RGN polypeptide is capable of cleaving the target sequence, thereby allowing cleavage and / or modification of the target sequence.

200. The method of claim 199, wherein the cleavage produces a single-strand break.

201. The method of claim 199, wherein the cleavage produces a double-strand break.

202. The method of claim 199, wherein the cleavage results in insertion of a heterologous sequence into the target sequence.

203. The method of any one of claims 191 to 198, wherein the RGN polypeptide is nuclease-inactive or is a nickase.

204. The method of claim 203, wherein the RGN polypeptide is fused to a base editing polypeptide.

205. The method of claim 204, wherein the base editing polypeptide comprises a deaminase.

206. The method of any one of claims 191 to 198, wherein the RGN is fused to a reverse transcriptase (RT) editing polypeptide.

207. The method of claim 206, wherein the RT editing polypeptide comprises a DNA polymerase.

208. The method of claim 207, wherein the DNA polymerase comprises a reverse transcriptase.

209. The method of any one of claims 206 to 208, wherein the gRNA further comprises an extension region comprising an editing template for RT editing.

210. A method for modulating expression of a T cell receptor alpha chain (TRAC) gene in a cell population, the method comprising delivering the RGN system of any one of claims 159 to 177 or the RNP complex of claim 178 to the cell population, wherein the cell population comprises the target sequence and wherein TRAC gene expression is modulated compared to TRAC gene expression in a control cell population.

211. The method of claim 210, wherein cleavage or modification of the target sequence occurs.

212. The method of claim 211, wherein cleavage or modification of the target sequence is detected by sequencing.

213. The method of any one of claims 210 to 212, wherein TRAC gene expression is measured by quantitative PCR, microarray, RNA-seq, flow cytometry, immunoblotting, enzyme-linked immunosorbent assay (ELISA), protein immunoprecipitation, immunostaining, high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC / MS), mass spectrometry, or a combination thereof.

214. The method of any one of claims 210 to 213, wherein the TRAC gene expression is reduced.

215. The method of claim 214, wherein the reduction in TRAC gene expression comprises a reduction in TRAC mRNA and / or TRAC protein levels.

216. The method of claim 215, wherein the reduction in TRAC protein levels is measured by flow cytometry for detection of CD3+ cells.

217. The method of claim 216, wherein a decrease in CD3+ cells compared to the level of CD3+ cells in the control cell population is indicative of said decrease in TRAC protein levels.

218. The method of claim 217, wherein the reduction in CD3+ cells is 30% to 100%.

219. The method of claim 217, wherein the reduction in CD3+ cells is 50% to 100%.

220. The method of any one of claims 211 to 219, wherein cleavage or modification of the target sequence occurs at a rate of 40% to 100%.

221. The method of any one of claims 211 to 219, wherein cleavage or modification of the target sequence occurs at a rate of 80% to 100%.

222. The method of any one of claims 210 to 221, wherein the control cell population has not been subjected to the delivery.

223. The method of any one of claims 210 to 222, wherein the cell population comprises T cells.

Images