BnaPSK26 gene and application thereof in promoting formation of callus

Abstract

The invention discloses a BnaPSK26 gene and application thereof in promoting callus formation, and belongs to the field of plant genetic engineering. The gene can regulate and control the callus of the rape, and a new way is provided for improving the genetic transformation efficiency of the rape. According to the invention, the coding sequence of the brassica napus BnaPSK26 is synthesized by a company, and overexpression of the BnaPSK26 in the brassica napus is beneficial to formation of plant calluses, so that the function and the application way of the gene are proved.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and particularly relates to a BnaPSK26 gene and its application in promoting callus formation. Background Art

[0002] Plant tissue culture technology is a fundamental tool for studying plant functional genes. Using isolated plant tissues or organs as explants, the explanted tissues or cells are grown in artificial culture media and induced by hormones, inducing the formation of callus tissue, which then differentiates into various plant organs. This technology is therefore used in a variety of basic research (Ikeuchi M, Favero DS, Sakamoto Y, et al. Molecular mechanisms of plant regeneration). Auxin and cytokinin play key roles in tissue regeneration and organ differentiation, with their different ratios determining the type of organ differentiation (Ikeuchi M, Favero DS, Sakamoto Y, et al. Molecular mechanisms of plant regeneration). In recent years, researchers both domestically and internationally have conducted in-depth research on the molecular mechanisms of plant regeneration. These studies have uncovered numerous genes involved in regulating plant regeneration, such as WUS (WUSCHEL), WOX5 (WUSCHEL-HOMEOBOX5), and Bbm (Baby Boom). Among them, WOX5 mainly induces root formation (Zhao S, Jiang QT, Ma J, et al. Characterization and expression analysis of WOX5 genes from wheat and its relatives), WUS and Bbm mainly induce bud differentiation (Zuo J, Niu QW, Frugis G, et al. The WUSCHEL gene promotes vegetative-to-embryonic transition in Arabidopsis;Boutilier K, Offringa R, Sharma VK, et al. Ectopic expression of BABY BOOM triggers aconversion from vegetative to embryonic growth), and constitutive expression of WUS and Bbm can improve the transformation efficiency of some difficult-to-transform plants (Lowe K, La Rota M, Hoerster G, et al. Rapidgenotype "independent" Zea mays L. (maize) transformation via direct somatic embryogenesis).

[0003] Phytosulfokine (PSK), composed of five amino acids [Tyr(SO3H)-Ile-Tyr(SO3H)-Thr-Gln], is a small peptide growth regulator ubiquitous in plants. PSK is a post-translationally modified small peptide whose precursor protein contains 80-120 amino acids and belongs to a small protein family (Lorbiecke R and Sauter M. Comparative analysis of PSK peptide growth factor precursor homologs). The PSK signature sequence, YIYTQ / H, is located at the C-terminus of the precursor protein and is surrounded by two pairs of basic residues (Lorbiecke R and Sauter M. Comparative analysis of PSK peptide growth factor precursor homologs; Yang H, Matsubayashi Y, Nakamura K, et al. Oryza sativa PSK gene encodes a precursor of phytosulfokine-α, a sulfated peptide growth factor found in plants). The two tyrosines on the characteristic sequence YIYTQ / H must be sulfonylated by tyrosylprotein subfotransferase (TPST) located on the Golgi membrane to become active (Hanai H, Nakayama D, Yang H, et al. Existence of a plant tyrosylproteinsulfotransferase: novel plant enzyme catalyzing tyrosine O-sulfation ofpreprophytosulfokine variants in vitro).After sulfonylation, the precursor protein leaves the Golgi apparatus and is further cleaved in the cytoplasm by subtilisin-like serine proteases (SBTs) (Srivastava R, Liu JX and Howell SH. Proteolytic processing of a precursor protein for a growth-promoting peptide by a subtilisin serine protease in Arabidopsis; Stuhrwohldt N, Buhler E, Sauter M, et al. Phytosulfokine (PSK) precursor processing by subtilase SBT3.8 and PSK signaling improve drought stress tolerance in Arabidopsis). Studies have shown that PSKs can regulate plant growth and development as well as adaptability to biotic and abiotic stresses. PSKs can also improve the efficiency of genetic transformation in plants. Under normal conditions, the success rate of inducing positive callus in carrot hypocotyl explants after Agrobacterium infection is 7%. Adding exogenous PSK to selective culture medium can increase its success rate to 39% (Matsubayashi Y, Goto T and Sakagami Y. Chemical nursing: phytosulfokine improves genetic transformation efficiency by promoting the proliferation of surviving cells on selective media). In Arabidopsis, the volume of Arabidopsis callus constitutively expressing AtPSK2 and AtPSK3 doubled compared to the wild type (Yang H, Matsubayashi Y, Nakamura K, et al. Diversity of Arabidopsis genes encoding precursors for phytosulfokine, a peptide growth factor), indicating that PSK can promote the formation of Arabidopsis callus. Due to its physiological characteristics, protoplasts of sugar beet (Beta vulgaris L.) are difficult to differentiate into callus in vitro.However, PSK can promote callus differentiation of protoplasts from most sugar beet varieties (Phytosulfokine stimulates cell divisions in sugar beet (Beta vulgaris L.) mesophyll protoplast cultures). In addition, only 0.1 μM PSK is sufficient to trigger mitosis in cabbage (Brassica oleracea) protoplasts in vitro and significantly induce protoplast cell regeneration (. A andAdamus A.Peptide growth factor phytosulfokine-αstimulates cell divisions andenhances regeneration from B.oleracea var.capitata L.protoplast culture). PSK treatment of explants can greatly improve the transformation efficiency of plants, and most transformed calli can successfully differentiate into cotyledons and roots (Matsubayashi Y,Goto T and Sakagami Y.Chemical nursing:phytosulfokine improves genetic transformation efficiency by promoting theproliferation of surviving cells on selective media). PSK is a class of danger-associated molecular patterns, which are mainly recognized by the receptor protein PSKR1 (Hu Z,Fang H,Zhu C,et al.Ubiquitylation ofPHYTOSULFOKINE RECEPTOR 1modulates the defense response in tomato;Zhang H,HuZ,Lei C,et al.A plant phytosulfokine peptide initiates auxin-dependent immunity through cytosolic Ca 2+ The study found that PSKR1 increases Ca signaling in the cytoplasm. 2+concentration, activates the plant's auxin-dependent immune response and enhances tomato's resistance to gray mold (Zhang H, Hu Z, Lei C, et al. A plant phytosulfokine peptide initiates auxin-dependent immunity through cytosolic Ca 2+ Xanthomonas oryzae pv. oryzicola (Xoc), a serious fungal disease that causes bacterial leaf streaking in rice (Oryza sativa), affects rice growth and development worldwide. Rice plants overexpressing OsPSKR1 exhibit enhanced resistance to X. oryzae compared to wild-type plants (Yang W, Zhang B, Qi G, et al. Identification of the phytosulfokine receptor 1 (OsPSKR1) confers resistance to bacterial leaf streakin rice).

[0004] We discovered a rare PSK protein, BnaPSK26, through the pan-genome of Brassica napus. However, the function of BnaPSK26 in promoting callus formation in in vitro tissue culture in Brassica napus has not been reported in the literature or patents. Our study found that overexpressing BnaPSK26 in transgenic Brassica napus plants promoted callus formation and improved the efficiency of genetic transformation. Summary of the Invention

[0005] Technical problem to be solved: The present invention provides the application of BnaPSK26 in promoting callus formation, thereby solving some problems encountered in the planting and genetic transformation of Brassica napus.

[0006] Technical solution: A Brassica napus protein, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0007] The nucleic acid molecule BnaPSK26 encoding the Brassica napus protein has a nucleic acid sequence as shown in SEQ ID NO: 1.

[0008] A recombinant expression vector comprises the nucleic acid molecule BnaPSK26.

[0009] The application of the above recombinant expression vector in promoting the formation of Brassica napus callus.

[0010] A host bacterium comprises the recombinant expression vector.

[0011] The host bacteria is Agrobacterium tumefaciens GV3101.

[0012] The application of the host bacteria in promoting the formation of callus tissue of Brassica napus.

[0013] A method for promoting callus formation in Brassica napus comprises transferring nucleic acid molecule BnaPSK26 into Brassica napus for overexpression.

[0014] The specific steps are as follows: (1) synthesizing the DNA fragment shown in SEQ ID NO: 1 and connecting it to the expression vector to form a recombinant expression vector; (2) using the electroporation method to transform the plasmid carrying the recombinant expression vector into Agrobacterium GV3101; (3) using the Agrobacterium transformation method to transform the Agrobacterium carrying the recombinant vector plasmid into Brassica napus

[0015] Beneficial effects: (1) The present invention discovered a gene BnaPSK26 encoding plant sulfonyltransferase from Brassica napus. The above gene encodes a plant small peptide growth regulator that can promote plant callus growth and improve the plant's ability to cope with biological stress.

[0016] (2) The plasmid of the recombinant overexpression vector containing the BnaPSK26 gene coding sequence was transformed into Agrobacterium tumefaciens GV3101 by electroporation.

[0017] (3) Agrobacterium tumefaciens carrying a recombinant overexpression vector containing the BnaPSK26 gene coding sequence was transformed into Brassica napus J9712 by Agrobacterium infection to obtain a strain overexpressing the BnaPSK26 gene. Compared with the non-transgenic strain, the overexpression of BnaPSK26 showed a reduced degree of browning of the explants and a faster growth rate and higher quality of callus during plant tissue culture. The BnaPSK26 gene provides raw materials for the study of the function of Brassica napus in promoting callus growth and development.

[0018] (4) Through a series of studies on the growth and development of callus tissues in BnaPSK26 overexpressing strains, the present invention fully demonstrated that BnaPSK26 can regulate the growth and development of callus tissues, and clarified that BnaPSK26 has important biological significance in the in vitro culture of plant tissues of Brassica napus.

[0019] (5) Plant tissue culture technology is one of the fundamental tools for studying plant functional genes. Browning during in vitro tissue culture can severely impact the activity, normal growth, development, and differentiation of explants, a challenge that urgently needs to be addressed in plant genetic transformation. The screening of the BnaPSK26 gene in this study provides a new approach to improving the efficiency of genetic transformation in rapeseed. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the specific implementation scheme and technical solutions of the present invention, the specific implementation scheme is briefly introduced below.

[0021] Figure 1 : Schematic diagram of the construction of BnaPSK26 overexpression vector.

[0022] Figure 2 : Actual photos of Agrobacterium-mediated genetic transformation of Brassica napus hypocotyls.

[0023] Figure 3 : Expression of BnaPSK26 in BnaPSK26 overexpressing plants. J9712 in the figure is the wild-type control, and the others are BnaPSK26 transgenic overexpressing lines.

[0024] Figure 4 Actual image of the M2 stage of in vitro tissue culture of a T1-generation transgenic overexpressing Brassica napus strain. Phenotypic characterization of callus growth promotion in BnaPSK26-overexpressing transgenic Brassica napus. J9712 in the figure is a wild-type control; the others are BnaPSK26-overexpressing transgenic lines.

[0025] Figure 5 : Statistics on browning of explants at the M2 stage of T1 generation transgenic overexpression lines of Brassica napus.

[0026] Figure 6 Actual image of the M3 stage of in vitro tissue culture of a T1-generation transgenic overexpressing Brassica napus strain. Phenotypic characterization of callus growth promotion in BnaPSK26-overexpressing transgenic Brassica napus. J9712 in the figure is a wild-type control; the others are BnaPSK26-overexpressing transgenic lines.

[0027] Figure 7 : Statistics on browning of explants at the M3 stage of T1 generation transgenic overexpression lines of Brassica napus.

[0028] Figure 8 : DAB staining results of explants of wild-type rapeseed J9712 and T1 generation BnaPSK26-overexpressing transgenic Brassica napus at the M2 stage of in vitro tissue culture. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the specific embodiments of the present invention are now described in detail. This detailed description should not be understood as a limitation of the present invention, but should be understood as a clearer, complete and detailed explanation of the technical aspects of the present invention. Without departing from the scope and spirit of the present invention, those skilled in the art may make improvements to the specific embodiments of the present invention for multiple applications. All other embodiments obtained by those skilled in the art without making any creative work are within the scope of protection of the present invention.

[0030] Example 1: Obtaining transgenic plants overexpressing BnaPSK26

[0031] (1) Construction of BnaPSK26 overexpression vector

[0032] The CDS sequence of BnaPSK26 was synthesized by Jiangsu Saisuofei Biotechnology Co., Ltd. Using the gene plasmid prepared by the company as a template, specific primers with corresponding restriction sites and homology arms were designed based on the two selected restriction sites of AscI and SpeI. The primers are named:

[0033] PSK26-PMDC83-F:GGACCTCGACTCTAGAACTAGTATGGCCGGTGCTTTTTTG;

[0034] PSK26-PMDC83-R:CCTCGAGGCGCGCCTCATGGCTTTGGCTTGTG;

[0035] The CDS sequence of BnaPSK26, containing restriction sites and homology arms, was amplified by PCR. The pMDC83 empty vector was double-digested with two restriction endonucleases (SpeI and AscI). After PCR amplification and double-digestion of the vector, the product was analyzed by agarose gel electrophoresis to ensure quality and accuracy. A gel extraction kit (provided by Yangzhou Wanhe Biotechnology Co., Ltd.) was used to recover the band matching the expected target fragment size. The double-digested linearized pMDC83 vector and the BnaPSK26 cDNA fragment containing restriction sites and homology arms were recovered by gel extraction. The double-digested linearized pMDC83 vector and the BnaPSK26 cDNA fragment, containing restriction sites and homology arms, were ligated by homologous recombination using the Clone Express II OneStep Cloning Kit (provided by Nanjing Novozymes Biotechnology Co., Ltd.). The ligation product was transformed into Escherichia coli, and the culture was plated on LB solid medium containing kana antibiotics and incubated in an inverted position at 37°C for 12–16 hours for antibiotic selection. Single clones were picked for bacterial solution PCR, and the positive clones obtained were sequenced. The successfully sequenced bacterial solution was named pMDC83-BnaPSK26. An equal amount of 50% glycerol was added to the bacterial solution, mixed, and then quickly frozen in liquid nitrogen. The bacteria were stored in an ultra-low temperature freezer for subsequent use.

[0036] (2) Genetic transformation of rapeseed

[0037] The plasmid containing the recombinant vector pMDC83-BnaPSK26 was transformed into Agrobacterium GV3101, and the hypocotyls of Brassica napus J9712 were used as recipients for Agrobacterium infection. Transgenic plants were obtained through screening and differentiation. See the actual photos. Figure 2 The specific steps are as follows:

[0038] (a) Plasmids were extracted from the successfully sequenced E. coli culture. 2.5 μL of the constructed pMDC83-BnaPSK26 plasmid was added to 100 μL of competent Agrobacterium GV3101 and transformed into the competent Agrobacterium via electroporation. Immediately after electroporation, 500 μL of antibiotic-free LB liquid medium was added to the Agrobacterium and mixed thoroughly by pipetting. Within a clean hood, 30-50 μL of the mixed culture was applied to LB solid medium containing Kana and Rif antibiotics for antibiotic selection. After drying, the culture dish was sealed with tape, the bottom marked, and incubated upside down in a 28°C incubator for 36-48 hours. Single, clear colonies were selected for PCR analysis. An equal amount of 50% glycerol was added to the positive culture, mixed thoroughly, and then snap-frozen in liquid nitrogen. The culture was stored in an ultra-low temperature freezer for subsequent genetic transformation.

[0039] (b) Seed disinfection: Select pure J9712 Brassica napus seeds that are round, plump, and have similar morphological characteristics; place them in a seed cup and immerse them in a 75% ethanol solution for 1 minute. Immediately remove the seeds, pour the ethanol solution into a waste tank, and air-dry the seeds; place the seeds in a seed cup again and immerse them in a 50% sodium hypochlorite solution for 25-35 minutes (the soaking time is determined by the degree of drying of the seeds); remove the seeds, pour the sodium hypochlorite solution into a waste tank, and air-dry the seeds; after disinfection, thoroughly rinse the rapeseed seeds 4-5 times with sterilized ddH2O.

[0040] (c) Sowing: Wash and dry rapeseed seeds and inoculate them onto M0 medium, keeping a certain distance between each seed, and culture them at 24°C in the dark for 4-5 days.

[0041] (d) Activation of Agrobacterium: Incubate Agrobacterium containing the recombinant vector in a shaker at 250 rpm at 28°C for 20-24 hours until its OD 600 Reached 0.8.

[0042] (e) Explant Preparation and Infection: Use an alcohol burner in a clean bench to thoroughly heat tweezers and a scalpel. After cooling, cut the hypocotyls of healthy seedlings in a sterile glass dish. Cut the hypocotyls into approximately 1 cm long segments, cutting vertically and ensuring the cuts are as smooth as possible. Add an appropriate amount of sterile liquid M1 medium (DM solution) to prevent the cuts from drying out. Cut the hypocotyls in batches and immediately transfer the cut segments to a glass dish containing 36 mL of DM solution to await infection. After all hypocotyls have been cut, take two 2 mL tubes of Agrobacterium culture medium containing the recombinant vector and centrifuge at 4000 rpm for 5 minutes. Discard the supernatant, retaining the pellet, and resuspend the cells in 1 mL of DM solution in the clean bench. Centrifuge again at 4000 rpm for 5 min, discard the supernatant, retain the precipitate, add 2 mL of DM solution to resuspend the cells in a clean bench to prepare 4 mL of infection solution; add 70 μL of acetosyringone (AS) and 4 mL of infection solution to the plate with the cut stem segments and 36 mL of DM solution, and infect for 15-20 min. During the infection process, the plate should be shaken continuously to ensure that the infection solution is evenly distributed in the plate; after the infection is completed, transfer the explants to a sterile plate to dry.

[0043] (f) Plant tissue culture: The dried explants were transferred to M1 solid medium, arranged in a non-overlapping order, and cultured in an inverted manner at 24°C in the dark for 36-48 h. After culturing for 36-48 h, the explants were transferred to M2 solid medium, maintaining a certain distance between the explants, and cultured in an inverted manner at 24°C in the light (16 h of light and 8 h of darkness) for 20 days. The explants were transferred to M3 solid medium and subcultured every 15 days until green shoots appeared on the explants. Seedlings with obvious growth points were transplanted to M4 solid medium for rooting.

[0044] Table 1 Culture medium formula (taking 1L culture medium as an example)

[0045]

[0046] Example 2: Positive identification of transgenic plants overexpressing BnaPSK26

[0047] (1) Extraction of transgenic plant DNA

[0048] Take about 10 mg of fresh, young rapeseed leaves and place them in a labeled 2 mL EP tube; place 1-2 sterile steel balls in each EP tube; add 500 μL of buffer to the EP tube; grind the tube in a grinder, paying attention to balancing; fix the ground sample, incubate in a 95-100°C water bath for 10 minutes, centrifuge at 12,000 rpm for 5 minutes; aspirate 30-50 μL of the supernatant and dilute to 100 μg / μL by adding ddH2O.

[0049] (2) Detection of positive transgenic plants

[0050] 1 μL of diluted transgenic plant DNA was taken as a template for PCR amplification and positive identification was performed. The primers used were:

[0051] PSK26-pMDC83-F:ATGGCCGGTGCTTTTTTGATTC;

[0052] pMDC83-GFP-R:CATCACCTTCACCCTCTCCAC;

[0053] The negative control was wild-type J9712 rapeseed DNA, and the positive control was a plasmid containing the recombinant vector. After PCR amplification, the products were subjected to agarose gel electrophoresis. The presence of specific target bands determined whether the pMDC83-BnaPSK26 recombinant vector had been successfully introduced into the rapeseed genome.

[0054] Example 3: Expression level identification of transgenic Brassica napus overexpressing BnaPSK26

[0055] To determine whether BnaPSK26 is overexpressed in rapeseed, real-time fluorescence quantitative PCR was used to test the expression level of the T1 generation lines after propagation of the plants identified as positive in Example 2. The control group was wild-type rapeseed J9712. The specific steps are as follows:

[0056] (a) Extraction of total RNA from Brassica napus leaves

[0057] 0.2 g of young leaves from the plant were quickly frozen in a 2 mL EP tube. The sample was placed in a pre-cooled grinder at 30 Hz for 3 min and ground into a powder (no visible particles were observed). The ground sample was removed and placed on ice until ready for use. RNA was extracted using an RNA extraction kit (provided by Nanjing Novozymes Biotechnology Co., Ltd.) according to the manufacturer's instructions. RNA purity was assessed using a microplate reader (A260 / A280 value close to 2). 3000 ng of sample RNA was added to 36 μL of ddH2O. 9 μL was removed and mixed with 1 μL of 10× DNA Loading Buffer. The mixture was subjected to 1% agarose gel electrophoresis, and RNA integrity was assessed by observing ribosomal RNA (rRNA) bands.

[0058] (b) Real-time fluorescence quantitative PCR

[0059] The extracted total RNA was reverse transcribed into cDNA using the reverse transcription kit HiScript IIQ Select RT Super Mix for qPCR (+gDNAwiper) (provided by Nanjing Novozyme Biotechnology Co., Ltd.).

[0060] BnaActin7-F:AAGTACTCTTCCAGCCGTCGC;

[0061] BnaActin7-R:ATCTGTTGGAAAGTGCTGAGGG;

[0062] The quality of the reversed cDNA was tested. Fluorescence quantitative reagent used was 2×Q3 SYBR qPCR Master mix (Universal) (provided by Yangzhou Qingke Biotechnology Co., Ltd.).

[0063] BnaActin7-F:AAGTACTCTTCCAGCCGTCGC;

[0064] BnaActin7-R:ATCTGTTGGAAAGTGCTGAGGG;

[0065] and BnaUBC9:

[0066] naUBQ9-F:TCCATCCGACAGCCCTTACTCT;

[0067] BnaUBQ9-R:ACACTTTGGTCCTAAAAGCCACC;

[0068] The above genes were used as internal references, and specific primers were designed for the BnaPSK26 coding sequence. The primer sequences are:

[0069] PSK26-qPCR-F:GTTTGCATCACTTGTCAACCCA

[0070] PSK26-qPCR-R:AAGAAGACGAGCTAAGCAGGC.

[0071] The fluorescence quantitative reaction system was 10 μL: 5 μL SYBR Mix, 0.2 μL each of forward and reverse primers (10 μmol / L), 2.6 μL ddH2O, and 2 μL template cDNA. Amplification conditions were 95°C for 30 seconds, cycle reaction: 95°C for 10 seconds, 60°C for 30 seconds, for a total of 40 cycles. Melting curve: 95°C for 15 seconds, 60°C for 1 minute, 95°C for 15 seconds. At least three technical replicates were performed for each sample. 2 -ΔΔCt The real-time fluorescence quantitative PCR data were processed by computational methods, and the analysis results showed that the expression levels of BnaPSK26 overexpression lines were higher than those of the wild-type control group. Figure 3 .

[0072] Example 4: Overexpression of BnaPSK26 is beneficial for promoting callus formation

[0073] (1) In vitro culture of plant tissues

[0074] The wild-type rapeseed J9712 was used as the control group, and the T1 generation BnaPSK26 overexpression strain was used as the experimental group for plant callus culture. The method was the same as in Example 1 (2), but the culture medium formula was slightly different. AS was not added to the M1 solid culture medium, and hygromycin (Hyg) was not added to the M2 and M3 solid culture media. The hypocotyls of the control group and the experimental group each occupied half of the solid culture medium in the same dish. After culturing for the same period of time, the browning rate and bud differentiation of the explants were compared. The statistical analysis results showed that the browning rate of the explants of the overexpression BnaPSK26 strain on the M2 and M3 solid culture media was significantly lower than that of the wild-type rapeseed J9712 (see Table 2 for the M2 stage). Figure 4 and Figure 5 ; See M3 stage Figure 6 and Figure 7Furthermore, explants from the BnaPSK26-overexpressing strain sprouted more rapidly than explants from J9712 during the same culture period. These results suggest that overexpressing BnaPSK26 in Brassica napus facilitates callus formation and can effectively improve genetic transformation efficiency in rapeseed.

[0075] (2) Observation of H2O2 accumulation in explants by 3,3-diaminobenzidine (DAB) staining

[0076] Weigh an appropriate amount of DAB powder, add distilled water to dilute to 1 mg / mL, add concentrated hydrochloric acid to adjust the pH value to about 3.8, so that DAB is completely dissolved, and then adjust the pH value to 5.8 for staining. The explants of the wild-type rapeseed J9712 and the T1 generation BnaPSK26 overexpression strain cultured to the M2 stage in (1) were placed in a glass dish filled with DAB staining solution and stained at 28°C in the dark for 2 hours. After the staining is completed, the staining solution is discarded, 80% ethanol is added, and the explants are decolorized in a boiling water bath until the green color of the explants completely fades, and the staining is observed by photographing. The staining results show that the explants of the overexpression strain are stained lighter, indicating that the accumulation of H2O2 in the explants of the overexpression strain is lower than that of the wild-type rapeseed J9712 (see Figure 8 ), the antioxidant capacity of the overexpression strain was significantly higher than that of wild-type rapeseed.

[0077] It can be seen that BnaPSK26 can reduce the browning of plant tissues during in vitro culture, promote the formation of callus tissue, effectively improve the genetic transformation efficiency of rapeseed, and have a profound impact on improving the yield and quality of Brassica napus. The above embodiments describe the preferred embodiments of the present invention and do not limit the present invention. Without departing from the spirit or scope of the present invention, the technical improvements and equivalent substitutions made by relevant technical personnel to the present invention are all within the scope of protection of the present invention.

Claims

1. A Brassica napus protein, characterized in that The amino acid sequence of the protein is shown in SEQ ID NO:

2.

2. The nucleic acid molecule BnaPSK26 encoding the Brassica napus protein according to claim 1, characterized in that Its nucleic acid sequence is shown in SEQ ID NO:

1.

3. A recombinant expression vector, characterized in that: Comprising the nucleic acid molecule BnaPSK26 according to claim 2.

4. Use of the recombinant expression vector according to claim 3 in promoting callus formation in Brassica napus. A host bacterium comprising the recombinant expression vector according to claim 3 .

6. The host bacteria according to claim 5, characterized in that The host bacteria is Agrobacterium tumefaciens GV3101.

7. Use of the host bacteria according to claim 5 or 6 in promoting callus formation in Brassica napus.

8. A method for promoting callus formation in Brassica napus, characterized in that: The method comprises transferring the nucleic acid molecule BnaPSK26 into Brassica napus and over-expressing the same.

9. The method according to claim 8, characterized in that The steps are as follows: (1) synthesizing the DNA fragment shown in SEQ ID NO: 1 and connecting it to an expression vector to form a recombinant expression vector; (2) using the electroporation method to transform the plasmid carrying the recombinant expression vector into Agrobacterium GV3101; (3) using the Agrobacterium transformation method to transform the Agrobacterium carrying the recombinant vector plasmid into Brassica napus.

Images