Trichoderma whisker strain and application thereof
By isolating and applying the fermentation broth of the endophytic fungus Trichoderma suillus DK strain from the Qinghai-Tibet Plateau, the problem of the lack of plant growth-promoting and stress-resistant agents in the Qinghai-Tibet Plateau was solved, the growth and stress resistance of oats and forage were significantly improved, the rhizosphere soil enzyme activity and microbial community structure were enhanced, and the oat yield was significantly increased.
Patent Information
- Application Number
- CN202410318625.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-20
- Publication Date
- 2025-09-26
AI Technical Summary
The existing technology lacks growth-promoting and stress-resistant bacteria for plants in the Qinghai-Tibet Plateau, especially the Trichoderma strains used for oats and forage, which are rarely used and there are no related research and development reports, resulting in oat yield and adaptability that are insufficient to meet demand.
An endophytic fungus strain of Trichoderma barbatum DK from the Qinghai-Tibet Plateau was isolated and preserved. Its fermentation liquid was prepared and used in plant seed soaking and feed mixing to promote plant growth, improve stress resistance and inhibit pathogens.
It significantly improved the germination rate, growth rate, biomass and rhizosphere soil enzyme activity of oats and forage grasses, enhanced the plants' stress resistance, increased oat yield and enriched the root microbial community structure.
Smart Images

Figure CN120699776A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a Trichoderma sutchuenensis strain and application thereof. Background Art
[0002] Oats (Avenasativa L.) are annual herbaceous plants of the genus Avena in the Poaceae family. They are not only an important grain crop but also a high-quality forage crop. Oats are known for their exceptional tolerance to extreme environments, including barrenness, drought, and cold weather. Their wide adaptability makes them suitable for widespread cultivation. Among cereal crops, oats rank sixth in global cultivated area. With the rapid development of society, current oat production is no longer able to meet the urgent needs for feeding, satiating hunger, and nutrition, necessitating an urgent need to increase production.
[0003] The Qinghai-Tibet Plateau is located in an alpine, semi-arid ecological zone, characterized by a cold, dry climate, poor soil, and sparse vegetation. These unique environmental conditions pose certain limitations and challenges to the development of agriculture and animal husbandry. However, agriculture and animal husbandry have always been a major source of income for residents of the Qinghai-Tibet Plateau. Oats, as a primary crop, have excellent adaptability and productivity in the ecological conditions of the Qinghai-Tibet Plateau. Increasing oat yields is of great significance to the region.
[0004] Trichoderma, an endophytic fungus belonging to the Deuteromycotinae, Hyphomycetes, Combretalales, and Combretaceae family, is one of the most widely studied and applied biocontrol fungi. Trichoderma can promote plant growth by secreting substances such as plant growth hormones. Furthermore, Trichoderma can antagonize pathogens and induce disease resistance in plants. Therefore, discovering new, multifunctional, and high-performance Trichoderma strains holds great promise for future applications.
[0005] Currently, there are more than 50 commercial preparations of Trichoderma at home and abroad, but the application of Trichoderma on plants is relatively rare, and there are no reports on the research and development of growth-promoting and stress-resistant agents for plants on the Qinghai-Tibet Plateau. Summary of the Invention
[0006] In order to solve the above problems, the present invention isolated and obtained a new endophytic fungus Trichoderma barbatum DK strain from the Qinghai-Tibet Plateau, which has good growth-promoting and stress-resistant effects on feed crops in the Qinghai-Tibet Plateau.
[0007] The invention provides a Trichoderma, which is Trichoderma sp. DK and is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with a deposit number of CGMCC No.40932.
[0008] The Trichoderma sp. strain DK isolated by the inventors was deposited in the General Microbiology Center of the China Culture Collection Administration (CGMCC) on November 22, 2023, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 40932.
[0009] The present invention also provides a method for preparing bacterial fermentation liquid, which comprises taking Trichoderma sp. DK with the preservation number of CGMCC No. 40932, inoculating it into a potato glucose liquid culture medium, and culturing it at 24-26° C. and 170 rpm for 5-7 days.
[0010] The present invention also provides a bacterial fermentation liquid prepared by the above method.
[0011] The present invention also provides use of Trichoderma sp. DK with a preservation number of CGMCC No. 40932 or the fermentation liquid of the above strain in preventing and controlling plant pathogens.
[0012] Furthermore, the plant pathogens include Fusarium peonyii and Alternaria alternata.
[0013] The present invention also provides use of Trichoderma sp. DK with a preservation number of CGMCC No. 40932 or the fermentation liquid of the above strain in promoting plant growth and improving the germination rate of plant seeds.
[0014] Wherein, the promoting plant growth and improving the germination rate of plant seeds are carried out under salt stress.
[0015] The promoting of plant growth includes increasing plant height, root length, stem thickness, leaf width, fresh weight, dry weight, shortening plant growth cycle, promoting plant absorption of soil nutrients, and increasing at least one of enzyme activity in plant rhizosphere soil.
[0016] Wherein, the plants include oats and forage grass;
[0017] Furthermore, the forage grass is at least one of Tongde short-awned dwarf ...
[0018] The present invention also provides a plant growth regulator, which comprises Trichoderma sp. DK with a preservation number of CGMCC No. 40932, its fermentation liquid and / or at least one metabolite.
[0019] Trichoderma sp. DK, deposited under the accession number CGMCC No. 40932, is an endophytic fungus isolated from plants on the Qinghai-Tibet Plateau. It exhibits the characteristics of indigenous plateau microorganisms, such as high cold tolerance. This strain produces a large number of secondary metabolites that promote plant growth and stress resistance, such as diaminopimelate, fenpropimorph, oleamide, trigonelline, proline, and phenylalanine. Furthermore, this strain exhibits broad-spectrum inhibition of plant pathogens, with an inhibition rate of 56.71% to 71.11%.
[0020] Moreover, soaking seeds in the fermentation broth of the DK strain of the present invention can effectively promote the growth and stress resistance of pasture and oats. When the NaCl concentration is 0mmol / L to 200mmol / L, soaking seeds in the fermentation broth of Trichoderma DK can significantly increase the germination rate, plant height, root length, stem diameter, leaf width, fresh weight and dry weight of oats. Mixing the fermentation broth of this strain with feed can promote pasture growth and improve the microenvironment of the rhizosphere soil. It can significantly increase the plant height, root length, above-ground and underground biomass of pasture, and can significantly increase the cellulase (CL), polyphenol oxidase (PPO), urease (UE) and glucosidase (GC) in the rhizosphere soil of pasture. Similarly, soaking seeds in the fermentation broth of this strain can promote the accumulation of oat yield and enrich the microbial community structure of the oat root system. Compared with the control, the oat yield increased by 93.92% and the microbial community structure of the oat root system was enriched, with the Shannon index increased by 25.38%, the Pielou index increased by 60%, and the Simpson index decreased by 15.94%.
[0021] The Trichoderma sp. DK of the present invention, which has a preservation number of CGMCC No. 40932, has good growth-promoting, stress-resistant and antibacterial abilities, which are much higher than those of reported strains of the same species, and has good application prospects.
[0022] The present invention is further described below with reference to the accompanying drawings and specific embodiments of the present invention. However, the embodiments do not limit the present invention in any way. For those skilled in the art, any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered equivalent replacement methods and are included within the scope of protection of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 Macroscopic morphology of Trichoderma DK colonies.
[0024] Figure 2 The top 20 metabolites in relative content in Trichoderma DK fermentation broth; Figure A shows the top 20 metabolites in relative content in DK fermentation broth under positive ion mode; Figure B shows the top 20 metabolites in relative content in DK fermentation broth under negative ion mode.
[0025] Figure 3 The inhibitory effect of Trichoderma DK on plant pathogens; Note: The left plate is a confrontation picture of Trichoderma DK and plant pathogens, and the right plate is a control picture of plant pathogens.
[0026] Figure 4 Effects of endophytic fungi soaking on oat seed germination; Note: Figures A, B, C, D, and E are the germination rates of oats in 0mmol / L, 100mmol / L, 200mmol / L, 300mmol / L, and 400mmol / L NaCl solutions, respectively.
[0027] Figure 5 Effects of seed soaking with different endophytic fungi on oat growth under salt stress.
[0028] Figure 6 Effects of microbial fermentation broth mixing treatment on the physical and chemical properties of forage and its rhizosphere soil.
[0029] Figure 7 Effects of seed soaking on oat physiological parameters; Note: A: Effect on peroxidase activity in oats; B: Effect on vitamin C content in oats; C: Effect on proline content in oats; D: Effect on malondialdehyde content in oats. Different lowercase letters indicate significant differences (p < 0.05).
[0030] Figure 8 Analysis of the fungal community composition of oat roots soaked with Trichoderma DK fermentation broth.
[0031] Figure 9 Fungal community network of oat roots at the species and genus level using Trichoderma DK fermentation broth.
[0032] Figure 10 Effects of soaking oats with Trichoderma DK fermentation broth on their growth. Note: Data in the figures are (treatment group - control group) / control group. Figure A shows oat growth indicators, and Figure B shows the three key factors of oat yield. DETAILED DESCRIPTION
[0033] The present invention is further described in detail below with reference to the examples, but the present invention is not limited thereto.
[0034] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.
[0035] Example 1 Isolation and Identification of Trichoderma sp. Strain DK of the Present Invention
[0036] 1. Strain isolation and purification method
[0037] Samples were collected from the roots of Kobresia dwarf in Haiyan County, Haibei Prefecture, Qinghai Province. Fresh plant roots were rinsed with running tap water and then dried with sterile filter paper. After surface disinfection, the root tissue was placed on PDA culture medium, and forceps were used to hold the surface of the material in contact with the culture medium. This served as a control group to test the disinfection efficacy. Roots were cut into approximately 2 mm sections using a sterilized blade to expose the plant tissue to the greatest extent possible. The cut tissue samples were placed in PDA culture medium, with the cut surface touching the culture medium. The culture dish was sealed with parafilm and incubated in a 24°C incubator. PDA culture medium: 200 g of potatoes were boiled, the filtrate was collected through gauze, and the mixture was supplemented with 1000 ml of distilled water, 20 g of glucose, and 20 g of agar.
[0038] Purification: After mycelium grows out, use an inoculation loop to pick up the front end of the mycelium and place it in a new PDA culture medium for cultivation. When the bacteria grow to a certain size, observe their morphology and color. For colonies with different morphologies and colors, pick them up and place them in new culture medium to purify the strain and observe the colony morphology of the strain.
[0039] Seed preservation: When the purified strain grows to a diameter of about 4 cm, pick the front end of the mycelium and place it on a PDA slope and culture it at a constant temperature of 24°C. When the colony grows to the slope, store it in a refrigerator at 4°C.
[0040] DNA was amplified by PCR using the universal fungal primers ITS1 and ITS4. The PCR amplification products were sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.
[0041] 2. Strain identification
[0042] The isolated and purified strain colonies are white in color, round in shape, with dry, velvety hyphae with irregular edges and septate hyphae (see Figure 1 ), the diameter of the non-spore hyphae was 5.65±0132 (μm), which was consistent with the characteristics of Trichoderma, and the strain was numbered DK.
[0043] The strain was identified as Trichoderma barbatum by comparing the ITS sequence in NCBI.
[0044] ITSDNA sequence information
[0045] >KR995112.1Trichoderma rossicum isolateBK0618SribosomalRNA gene,partialsequence;internal transcribed spacer 1,5.8S ribosomal RNA gene,andinternal transcribed spacer 2,complete sequence;and28SribosomalRNA gene,partialsequence
[0046] GGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAG
[0047] TTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGC
[0048] CCCGGGCGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCCAAAACTC
[0049] TTTTTGTATACCCCCTCGCGGGTTTTTTACTTCTGAGAATTTCTCGGCGCCCCTAGTGGG
[0050] CGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGA
[0051] ACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA
[0052] ACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACC
[0053] CTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTCACCGGGTGCCGGCC
[0054] CCTAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACACTCGCA
[0055] CCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCCAACTTCTGAAATGTTGACCTCG
[0056] GATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGANCBI accession number: KR995112.1
[0057] Combined with the morphological characteristics of the bacteria and the results of molecular biological identification, the strain of the present invention was identified as Trichoderma sp. Trichoderma barbatum, named DK, and deposited in the General Microbiology Center of the China Culture Collection Administration (CGMCC) on November 22, 2023, with the deposit number CGMCC No.40932.
[0058] Example 2 Analysis of Metabolites in the Fermentation Broth of the Trichoderma sp. Strain DK of the Present Invention
[0059] The bacteria were collected from the laboratory and stored in sterile liquid paraffin. The bacteria were selected and inoculated on PDA solid medium (200 g / L potato, 20 g / L glucose, 20 g / L agar powder) and cultured at 25°C for 7 days. A 0.5 × 0.5 cm cake was quantitatively inoculated into a conical flask containing 100 ml of PDB (200 g / L potato, 20 g / L glucose) medium and cultured at 25°C and 170 r·min. -1 The culture was carried out for 7 days with three replicates for each strain. The metabolite content in the fermentation broth was determined by non-targeted metabolomics, and the metabolites with higher content obtained by non-targeted metabolomics were verified using a kit.
[0060] At 25℃, 170r·min -1 The 7-day fermentation broth of Trichoderma DK and the uninoculated PDB cultured under the same culture conditions were used as controls for non-targeted metabolomics research. Each treatment was repeated 3 times. The results are shown in the figure below. Figure 2 shown.
[0061] It can be seen that in the positive ion mode, the contents of diaminopimelonic acid, fenpropimorph, oleamide, proline and palmitic acid in the DK fermentation broth were greater than those in the fermentation broths of Bacillus cereus B0 and Floccularia uteovirens F18-3, and the DK fermentation broth contained valine, 2-hydroxycinnamic acid, L-tyrosine, trans-2-butene-1,4-dicarboxylic acid, L-phenylalanine, etc.; in the negative ion mode, the content of citric acid was the highest in the DK fermentation broth, B0 and F18-3 fermentation broth, and the content in the DK fermentation broth was lower than that in the blank PDB medium. The contents of long-chain lipid hydroperoxides, gibberellic acid, mevalonic acid and butynedioic acid in the DK fermentation broth were greater than those in the B0 and F18-3 fermentation broth.
[0062] Compared with the BO and F18-3 strains, some metabolites were more abundant in the fermentation broth of Trichoderma DK, such as proline, long-chain lipid hydroperoxides, mevalonic acid, gibberellic acid, and diaminopimelic acid, which have the potential to act as osmotic regulators in the plant cytoplasm, have antimicrobial activity against various fungal and bacterial pathogens, and can act as broad-spectrum growth regulators to promote plant growth and development, as well as responses to environmental stresses.
[0063] Example 3 Inhibition of plant pathogens by the Trichoderma sp. strain DK of the present invention
[0064] The inhibition rate of Trichoderma DK against pathogenic fungi was determined using the standoff method. Trichoderma DK and the pathogenic fungi were inoculated onto 90 mm PDA plates, with both bacteria located 35 mm from the center point on either end of the plate diameter line. A control was also inoculated with only the pathogenic fungi. Each treatment was replicated four times and incubated in a 25°C incubator for 6 days. The growth radius of the pathogenic fungi in the standoff direction was measured with a vernier caliper, and the inhibition rate was calculated. The inhibition rate was calculated as follows: if the Trichoderma spread completely covered the pathogenic fungi, the inhibition rate was 100%.
[0065] I = (R0-R) / R0×100%, where R0 is the radius of the control pathogenic fungus and R is the radius of the treated pathogenic fungus.
[0066] See the results Figure 3 and Table 1.
[0067] Table 1 Inhibitory effect of Trichoderma DK on plant pathogens
[0068]
[0069] The results showed that Trichoderma DK had a good inhibitory effect on the three plant pathogens, with an inhibition rate of 56.71% against Alternaria DT-DYLC, 65.57% against Fusarium peonyii DT-08C, and 71.11% against Alternaria DT-XRKA. This indicates that Trichoderma DK has a good broad-spectrum inhibitory effect on plant pathogens.
[0070] Example 4 Growth-promoting and stress-resistant effects of the Trichoderma sp. strain DK of the present invention
[0071] 1. Effect of Trichoderma DK fermentation broth on salt tolerance of oats
[0072] Germination strains were activated on PDA solid medium for 7 days. A 0.5×0.5 cm cake was inoculated onto 100 mL of PDB medium and cultured for 5 days before use. Sterilized filter paper was spread flat on sterile Petri dishes as a germination bed. After surface disinfection, oat seeds were soaked in the bacterial solution for 4 hours and then placed on the germination bed. 6 mL of NaCl solution of varying concentrations (0 mmol / L, 60 mmol / L, 120 mmol / L, 180 mmol / L, and 240 mmol / L) was added, with 20 seeds per dish, for three replicates. Garden soil for potting was sterilized three times and then cooled for later use. Oats with good growth were selected and transplanted, with four plants per pot. After 30 days of normal growth, 50 mL of NaCl solution of varying concentrations (0 mmol / L, 100 mmol / L, 200 mmol / L, 300 mmol / L, and 400 mmol / L) was added. Growth indicators were measured after 10 days of stress.
[0073] The results are shown in Figure 4 and Figure 5 .
[0074] Depend on Figure 4 It can be seen that the germination rate under no stress is Figure 4 A (strains 227, 303, 132, and 204 are Trichoderma alni227, Penicillium expansum303, Penicillium crustosum132, and Penicillium goetzii204, respectively); in 60 mmol / L NaCl solution, Trichoderma DK significantly increased the germination rate of oat seeds (11.76%) ( Figure 4 B); In 120mmol / L NaCl solution, Trichoderma DK significantly increased the germination rate of oat seeds (10.20%) ( Figure 4 C); In 180mmol / L NaCl solution, fungus soaking had no significant effect on the germination rate of oat seeds ( Figure 4D); Under 240mmol / L NaCl solution, Trichoderma DK can improve the germination rate of oat seeds ( Figure 4 E)(p>0.05). Therefore, soaking oat seeds with endophytic fungi under salt stress can improve the germination rate of oat seeds.
[0075] Depend on Figure 5 It can be seen that when the NaCl concentration is 0mmol / L~200mmol / L, soaking the seeds in Trichoderma DK fermentation liquid can significantly increase the plant height, root length, stem diameter, leaf width, fresh weight and dry weight of oats; when the NaCl concentration is 300mmol / L, soaking the seeds in Trichoderma DK fermentation liquid can significantly increase the plant height and leaf width of oats; and when the NaCl concentration is 400mmol / L, soaking the seeds in Trichoderma DK fermentation liquid can significantly increase the root length, stem diameter, fresh weight and dry weight of oats ( Figure 5 ). Therefore, soaking oats with Trichoderma DK fermentation broth can significantly promote the growth of oats.
[0076] 2. Effects of Trichoderma DK fermentation broth mixed with feed on forage growth and rhizosphere soil
[0077] The field experiment was conducted in the Muli mining area of Tianjun County, Haixi Mongol and Tibetan Autonomous Prefecture, Qinghai Province, at an altitude of 4026-4128m. Four experimental plots were set up in the experimental area, with strains B0, DK, F18-3 mixed with feed and no strain (CK). Each experimental plot was 5 mu, covering a total area of 20 mu. Before land preparation, 25.35m3 of water was added per mu. 3 Sheep manure is fully mixed with the tillage layer during land preparation and sown with a seeder in row sowing mode at a seed dosage of 6 kg / mu.
[0078] Forage grass: Tongde short-awned alkali grass (Elymus breviaristatuscv.Tongde), Qinghai Chinese fescue (Festuca sinensisKengcv.Qinghai), Qinghai cold-weather bluegrass (PoacrymophilaKengcv.Qinghai) and Qinghai meadow bluegrass (PoapratensisL.cv.Qinghai) (mixed planting) were grown to 120 days and the second year of grass growth (mid-August 2023). Three (5m×5m) evenly growing plots were selected in each treatment area for sampling. Each sampling point was 25m around the sampling point. 2Sampling was conducted at nine random locations within the plot. Soil was drilled simultaneously from the plant and its roots at a depth of 1 to 20 cm using a soil augers. The nine samples were mixed evenly to form a single sample. The plants were gently uprooted from the mixed sample, minimizing damage to the plant's integrity. After uprooting, the plants were gently shaken to remove any soil loosely attached to the roots. Rhizosphere soil was then collected using a sterile brush. The rhizosphere soil samples were then passed through a 2 mm sieve to remove visible roots and rocks. The rhizosphere soil samples were stored in ziplock bags, numbered, and placed on ice. Upon return to the laboratory, the samples were divided into two parts: one stored at 4°C for soil enzyme activity testing, and the other air-dried for soil physical and chemical property testing. Forage plant samples were used to measure growth indicators. At each sampling point, 10 grass plants were randomly selected and their stem diameter and leaf width were measured using a vernier caliper. Their root length and plant height were measured using a ruler. The number of tillers was manually counted. The plants were then rinsed with sterile water to remove soil and other impurities attached to the roots. After drying with filter paper, the aboveground and belowground biomass of the grasses were weighed. The average of these values was used as the measurement for that sampling point.
[0079] Fresh leaves were collected and assayed for POD, CAT, PRO, MDA, TP, chlorophyll a, and chlorophyll b according to the corresponding kit instructions from the Nanjing Jiancheng Bioengineering Institute. Each treatment was replicated three times. The pH and electrical conductivity of the rhizosphere soil were measured using a conductivity meter (water-to-soil ratio of 2.5:1). Total nitrogen in the rhizosphere soil was determined using the Kjeldahl method. Total phosphorus in the rhizosphere soil was determined using the acid dissolution-molybdenum antimony colorimetric method. Total potassium in the rhizosphere soil was determined using the sodium carbonate alkali fusion-flame photometry method. Soil organic carbon (SOC) in the rhizosphere soil was determined using the Walker-Black method. Available nitrogen (AN), available phosphorus (AP), available potassium (AK), nitrate nitrogen (NO₃⁻ -N), and ammonium nitrogen (NH₄⁻ -N) in the rhizosphere soil were determined using a colorimetric method. Soil enzyme activity was assayed using soil enzyme kits (Mlbio, Shanghai, China).
[0080] See the results Figure 6 It can be seen that there are great differences in the effects of different microbial strains on forage growth and rhizosphere soil. Compared with CK, Trichoderma DK treatment can significantly increase the plant height, root length, aboveground and underground biomass of forage in both 2022 and 2023 ( Figure 6 a, b). Compared with the control (CK), the treatment with Trichoderma DK could significantly reduce the AN, electrical conductivity, SOC, TN and TP of the rhizosphere soil of forage grass; in addition, compared with CK, F18-3 and DK did not significantly affect the pH of the rhizosphere soil of forage grass ( Figure 6 c, d). Compared with CK, F18-3 and B0, the treatment with Trichoderma DK could significantly increase the CL, polyphenol oxidase (PPO), urease (UE) and GC in the rhizosphere soil of forage, but significantly reduce the amylase (AL) in the soil ( Figure 6 e, f). Compared with CK, B0, F18-3, and DK can significantly increase the chlorophyll a, chlorophyll b, total protein content, and greening rate of forage. At the same time, Trichoderma DK can also significantly increase the coverage of forage during the greening period ( Figure 6 g, h).
[0081] 3. Effects of Trichoderma DK fermentation broth on oat growth and rhizosphere soil
[0082] 1. Experimental methods
[0083] The oat outdoor experiments were conducted in Delingha City, Qinghai Province in 2021 and 2023 respectively.
[0084] 2021: 500g of sterilized seeds were immersed in a 50% endophytic fungal solution. A further 500g of seeds were immersed in a 50% PDB culture solution as a control (CK). After 6 hours, the seeds were removed and air-dried. A block design was used, with each plot measuring 30 m². The control groups were designated as ACK, AEK, ADK, and AF (corresponding to the CK group, using Colletotrichum sp. EK, DK, and F18-3).
[0085] 2023: 500g of sterilized oat seeds were soaked in a 50% endophytic fungal solution. Another 500g of sterilized oat seeds were soaked in a 50% PDB culture solution as a control (CK). After 6 hours, the seeds were removed and air-dried. A block design was used, with each plot measuring 30 m². DK, F18-3, and FCK were designated (corresponding to the DK, F18-3, and CK controls). Sowing was done in rows, with 20 rows per plot, each 25 cm wide. Aside from the differences in endophytic fungi used for soaking oats, all other field management practices remained the same (10 kg hm-2 of diammonium phosphate applied before sowing, with no topdressing during the soaking period). When the oats were three months old, plants and their corresponding rhizosphere soil were collected using the S-type sampling method. Soil samples were sieved through a 2 mm sieve to remove impurities and analyzed for physical and chemical properties. Plant samples were then analyzed for growth and physical and chemical parameters, and DNA was extracted. Leaf enzyme activities (POD, CAT, PRO, MDA, TP, chlorophyll a, and chlorophyll b), soil physicochemical properties (pH, electrical conductivity, total nitrogen, total phosphorus, soil organic carbon (SOC) content, available nitrogen (AN), and available phosphorus (AP)) and soil enzyme activity were determined using a soil enzyme kit (Mlbio, Shanghai, China) using the same method as above.
[0086] 2. Experimental results
[0087] (1) Effect of soaking oats in Trichoderma DK fermentation broth on oat growth
[0088] Soaking seeds with different strains had significant (p<0.05) effects on plant height, root length, fresh weight and dry weight of oats (Table 2).
[0089] Table 2 Effect of soaking in Trichoderma DK fermentation broth on oat growth
[0090]
[0091] Note: Different lowercase letters indicate significant differences at the p<0.05 level.
[0092] Compared to CK, EK, DK, and F18-3 significantly increased oat plant height by 16.52-44.02% and root length by 3.19-18.06%. Both fresh and dry weights were significantly increased, with DK treatment achieving the highest dry weight of 7.28g. Seed soaking with fungi shortened the oat growth cycle, advancing maturity by 7-10 days compared to CK.
[0093] (2) Effects of soaking oats in Trichoderma DK fermentation broth on oat physiological indicators
[0094] See Figure 7 Soaking seeds of strains EK, DK, and F18-3 all affected the content and activity of malondialdehyde (MDA), peroxidase (POD), proline (PRO), and vitamin C (Vc) in oats. The CK treatment group had the highest MDA content, at 2.12 nmol / mgprot, which was significantly different from EK, DK, and F18-3 (p<0.05). EK, DK, and F18-3 all significantly (p<0.05) increased POD activity in oats by 76.00%-88.00%. F18-3 had the highest PRO content, at 104.07 ug / g, followed by EK at 75.53 ug / g and DK at 36.55 ug / g. All three groups were significantly (p<0.05) higher than CK. EK and F18-3 could significantly (p<0.05) increase the Vc content of oats; DK reduced the Vc content of oats, but there was no significant difference between DK and CK (p>0.05).
[0095] (3) Effects of Trichoderma DK fermentation broth on the physical and chemical properties of oat root soil
[0096] Seed soaking with different bacterial strains affected the pH, total nitrogen, total phosphorus and organic carbon content of the soil around the oat roots (Table 3).
[0097] Table 3 Effects of Trichoderma DK fermentation broth on oat soil physical and chemical properties
[0098]
[0099] Note: Different lowercase letters indicate significant differences at the P<0.05 level.
[0100] The soil pH in the F18-3 treatment group was significantly (p < 0.05) higher than that in the CK treatment group, by 0.18. EK and F18-3 reduced soil total nitrogen content, indicating that EK and F18-3 enhanced nitrogen absorption by oats. DK significantly (p < 0.05) increased soil total phosphorus content by 0.23 compared to CK. F18-3 significantly (p < 0.05) increased soil organic carbon content by 13.65% compared to CK.
[0101] (4) Effects of soaking seeds with Trichoderma DK fermentation broth on the fungal community in the oat root system
[0102] Using Illumina Miseq, 12,480, 33,195, 28,835, and 42,860 valid sequences were sequenced from oat root samples treated with ACK, AEK, ADK, and AF, respectively. The resulting OTU counts were 18, 286, 98, and 359, respectively. These sequences belonged to 5 phyla, 11 classes, 23 orders, 28 families, and 32 genera. The Shannon, Simpson, and Pielou indices were used to reveal the α-diversity of oat root fungi. As shown in Table 4, at a similarity of 97%, the Shannon index ranked ADK > AF > AEK > ACK, and the Pielou index ranked AEK > ADK > AF > ACK, indicating that fungal seed soaking increased the diversity of oat root fungi.
[0103] Table 4 α-diversity analysis of fungal communities in oat root systems after soaking seeds with Trichoderma DK fermentation broth
[0104]
[0105] Depend on Figure 8 A shows that the number of common OTUs in ACK, AEK, ADK and AF is 13, and the number of unique OTUs is 2, 105, 19 and 164 respectively. From the relative abundance Circos diagram of species in the fungal phylum, it can be seen that ( Figure 8 B), the root fungal community of ACK only annotated three phyla, namely Olpidiomycota (63.72%), Basidiomycota (56.53%) and Ascomycota (2.94%). The root fungal communities of AEK, ADK and AF annotated five phyla, with the dominant phyla being Olpidiomycota (47.54%), Basidiomycota (66.53%) and Olpidiomycota (76.93%). From the column stacking chart at the fungal order level, we can see that ( Figure 8C), 5, 15, 9, and 22 orders were annotated for the root fungal communities of ACK, AEK, ADK, and AF, respectively. The dominant order of root fungi in ACK, AEK, and AF was Olpidiales, with relative abundances of 63.72%, 47.54%, and 76.93%, respectively. The dominant order of root fungi in ADK was Russulales, followed by Olpidiales, with relative abundances of 63.88% and 49.85%, respectively. From the family level, ( Figure 8 D), 4, 19, 9 and 23 families were annotated in the root fungal communities of ACK, AEK, ADK and AF, respectively, and the dominant families were Olpidiaceae (63.72%), Olpidiaceae (47.54%), Russulaceae (63.88%) and Olpidiaceae (76.93%), respectively.
[0106] The results of the fungal community composition at the genus level in the roots of oats soaked with different strains showed that ( Figure 9 A), after oats were soaked in ACK, AEK, ADK, and AF, only three genera of fungi were found in the root system: Olpidium, Lactarius, and Didymella. After oats were soaked in AF, the most unique fungi were found in 10 genera: Acremonium, Microdochium, Dinemasporium, Mycosphaerella, Aspergillus, Fusariella, Spizellomyces, Trichopeziza, Fusicolla, and Holtermanniella. To identify the core fungi in the root system after oats were soaked in endophytic fungi, a visualization network of the oat root fungal community was constructed ( Figure 9 B) There are 35 nodes and 59 edges, with a modularity index of 0.187. Each node represents a genus-level fungus, and different node colors indicate different modules. The results show that Olpidium and Lactarius are core fungi in the oat root fungal network.
[0107] (5) Effects of soaking seeds in Trichoderma DK fermentation broth on oat growth and yield
[0108] See the results Figure 10 and Table 5.
[0109] Table 5 Effect of soaking seeds in Trichoderma DK fermentation broth on theoretical yield of oats
[0110]
[0111] In 2023, soaking seeds with Trichoderma DK fermentation broth had a significant effect on the growth and yield formation factors of oats ( Figure 10 A), specifically: the treatment with Trichoderma DK fermentation liquid can significantly increase the plant height, root length, leaf width, tiller number, above-ground dry weight and underground dry weight of oats compared with the control treatment. At the same time, the treatment with Trichoderma DK fermentation liquid can also significantly increase the number of grains per ear, number of ears and thousand-grain weight of oats compared with the control treatment ( Figure 10 B) The oat yield after soaking the seeds in Trichoderma DK fermentation broth was calculated using the theoretical yield calculation formula. The results are shown in Table 5. Compared to the control treatment, soaking the seeds in Trichoderma DK fermentation broth significantly increased the theoretical yield of oats by 93.92%, demonstrating a remarkable yield-increasing effect.
[0112] Comparative Example 1 Comparison of the growth-promoting effects of Trichoderma DK fermentation broth and other Trichoderma strains
[0113] 1. The Trichoderma DK of the present invention can greatly increase the activity of polyphenol oxidase and soil urease in rhizosphere soil
[0114] Liu et al. reported a significant increase in soil urease activity after applying a fertilizer containing Guizhou Trichoderma in pepper production. Polyphenol oxidase activity in wheat rhizosphere soil increased by 18.52% after applying Trichoderma fertilizer. The results of the present study showed that treatment with Trichoderma DK fermentation broth increased polyphenol oxidase activity by 53.35% and urease activity by 31.16% in the rhizosphere soil of forage grass compared to the control.
[0115] Polyphenol oxidase catalyzes the conversion of aromatic compounds in soil and is a key enzyme in soil remediation. Soil urease is primarily involved in the nitrogen cycle within the soil. The significant increase in both demonstrates the enormous potential of Trichoderma DK for soil remediation.
[0116] 2. The antibacterial effect of Trichoderma DK of the present invention is good and takes effect quickly
[0117] Cui Xuexue et al. conducted a plate confrontation experiment using Trichoderma viride Tv-1511 and Fusarium oxysporum and Fusarium oxysporum. They found that after 8 days of inoculation, the Tv-1511 colonies had occupied three-quarters of the plate, invading, covering, or surrounding the pathogen colonies, with inhibition rates of 68.50% and 66.65%, respectively. Wang et al. have shown that the Th62 strain of Trichoderma harzianum has a significant antagonistic effect against soil-borne plant pathogens such as Fusarium oxysporum and Alternaria alternata. In a plate confrontation experiment comparing the Trichoderma harzianum DK of the present invention with Fusarium oxysporum DT-08C, it was found that after 6 days of inoculation, the DK colonies had occupied three-quarters of the plate and also invaded, covered, or surrounded the pathogen colonies, with an inhibition rate of 65.57%. This indicates that the antibacterial ability of the DK of the present invention is comparable to existing reports, but with a faster onset of action.
[0118] 3. The Trichoderma DK of the present invention has a good growth-promoting effect
[0119] Liu Baoan et al. found that after applying Trichoderma harzianum T-22, the plant height, leaf area, and stem diameter of netted melon increased by 15.05%, 15.48%, and 11.43%, respectively, compared to the control treatment, and root length increased by 20.10%. The present study found that compared with CK, DK, F18-3, and EK seed soaking significantly increased oat plant height by 16.52-44.02% and root length by 3.19-18.06%. They also significantly increased the fresh and dry weight of oats, with DK seed soaking having the highest dry weight increase of 134.08%.
[0120] Wang Zheng et al. found that the organic matter content of the rhizosphere soil of flue-cured tobacco was reduced by 2.3% after applying Trichoderma harzianum T-22. The present invention found that compared with CK, the SOC content of the rhizosphere soil of forage grass was reduced by 51.63%, which greatly promoted the absorption of nutrients in the soil by forage grass.
[0121] In summary, the Trichoderma scutellariae DK of the present invention has good growth-promoting, stress-resistant and pathogen-inhibiting abilities, has significant advantages over reported strains of the same species, and has good application prospects.
Claims
1. A Trichoderma, characterized in that: It is Trichoderma sp. DK, which is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit number of CGMCC No.40932.
2. A method for preparing a bacterial fermentation broth, characterized in that: Take Trichoderma sp. DK with the accession number of CGMCC No. 40932, inoculate it into potato glucose liquid culture medium, and culture it at 24-26° C. and 170 rpm for 5-7 days.
3. The bacterial fermentation liquid prepared by the method according to claim 2.
4. Use of Trichoderma sp. DK (CGMCC No. 40932) or the fermentation liquid of the strain according to claim 3 in preventing and controlling plant pathogens.
5. The use according to claim 4, characterized in that: The plant pathogens include Fusarium peonyii and Alternaria alternata.
6. Use of Trichoderma sp. DK (CGMCC No. 40932) or the fermentation liquid of claim 3 in promoting plant growth and increasing the germination rate of plant seeds.
7. The use according to claim 6, characterized in that: The promoting of plant growth and improving of plant seed germination rate are carried out under salt stress.
8. The use according to claim 6 or 7, characterized in that: The promoting of plant growth includes increasing plant height, root length, stem thickness, leaf width, fresh weight, dry weight of plants, shortening plant growth cycle, promoting plant absorption of soil nutrients, and increasing at least one of enzyme activity in plant rhizosphere soil.
9. The use according to claim 6 or 7, characterized in that: The plants include oats and forage grass; Furthermore, the forage grass is at least one of Tongde short-awned dwarf ...
10. A plant growth regulator, characterized in that: The invention comprises Trichoderma sp. DK with the deposit number of CGMCC No. 40932, its fermentation liquid and / or at least one metabolite.