Yarrowia pastoris strain Q as well as fermentation inoculant and application thereof
By using Yarrowia parsneri strain Q and its fermentation agent, the problems of long production cycle and unstable quality of dry-fermented meat products have been solved, and the fermentation time has been shortened, the quality has been improved, and the maturation loss has been reduced. It is suitable for dry maturation of poultry and livestock meat.
Patent Information
- Application Number
- CN202510854506.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-09-26
AI Technical Summary
Dry-fermented meat products have problems such as long production cycle, unstable quality, and high maturation loss. In addition, commercial fermentation agents are difficult to adapt to all fermentation conditions and cannot effectively compete with local microbial communities.
Yarrowia parasaurolophus strain Q and its fermentation agent, including live bacteria, bacterial suspension and fermentation liquid, preferably in the form of freeze-dried powder or microencapsulated cells, are used for dry maturation of poultry and livestock meat, controlling fermentation conditions and improving fermentation efficiency and product quality.
It shortens fermentation time, improves the amino acid content and flavor of meat products, reduces maturation loss, ensures product safety and consumer preference, and is suitable for dry maturation of poultry and livestock meat such as beef, mutton, pork, etc.
Smart Images

Figure CN120699783A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of functional microorganisms, and in particular relates to a Yarrowia parophoni strain Q, a fermentation agent and an application thereof. Background Art
[0002] Traditional fermented meat products usually adopt natural fermentation, among which post-slaughter maturation is a common method to improve edible qualities such as tenderness and flavor. At present, the commonly used post-slaughter maturation methods at home and abroad mainly include dry maturation and wet maturation. Although wet maturation is simple to operate and has a high yield, it has limited effect in improving flavor. In contrast, dry-aged meat products have more advantages in taste and flavor, and can give the meat a richer beef flavor, barbecue flavor, butter flavor, nutty flavor and sweetness and other pleasant flavor characteristics. However, the production of dry-aged beef still faces problems such as long cycle, unstable quality, and high maturation loss. In addition, commercial starter cultures often find it difficult to adapt to all fermentation conditions and cannot effectively compete with local microbial communities. Summary of the Invention
[0003] In view of this, the object of the present invention is to provide a Yarrowia parnerii strain Q, which can not only shorten the cycle of dry fermentation of meat products, but also improve the quality of fermented meat products and reduce maturation loss.
[0004] The invention provides a Yarrowia parnerii strain Q, whose preservation number is CGMCC No.34478.
[0005] The present invention provides a fermentation bacterial agent, wherein the active bacterial agent comprises the Yarrowia parrotii strain Q.
[0006] Preferably, the Yarrowia paramerini strain Q comprises at least one of the following: living cells of the Yarrowia paramerini strain Q, a bacterial suspension of the Yarrowia paramerini strain Q, and a fermentation broth of the Yarrowia paramerini strain Q;
[0007] The live bacteria of the Yarrowia paramerioreni strain Q include at least one of the following forms: freeze-dried powder, microencapsulated cells and immobilized cells.
[0008] Preferably, in the fermentation agent, the concentration of Yarrowia parrotii strain Q is 10 7 CFU / ml~10 10 CFU / ml or 10 7 CFU / ml~10 7 CFU / g.
[0009] The present invention provides the use of the Yarrowia parnereri strain Q or the fermentation agent in the dry preparation of mature meat products.
[0010] Preferably, the meat types of the mature meat product include poultry meat.
[0011] Preferably, the types of poultry meat include at least one of the following: beef, mutton, pork, chicken, goose, duck and rabbit.
[0012] The present invention provides a method for preparing a mature meat product by dry process, comprising the following steps:
[0013] The surface of the poultry and livestock meat is treated with the Yarrowia parrotii strain Q or the fermentation agent and then matured by a dry method.
[0014] Preferably, the inoculation amount of the bacterial suspension of Yarrowia paramerioregi strain Q is 2.0% to 3.0% of the mass of the sterilized poultry and livestock meat;
[0015] The concentration of the bacterial suspension of Yarrowia parrotii strain Q is 1×10 7 CFU / ml~10×10 7 CFU / ml.
[0016] Preferably, the temperature of the dry ripening method is 3-5°C; the wind speed of the dry ripening method is 1-1.5 m / s; and the relative humidity RH of the dry ripening method is 75%-85%.
[0017] The present invention provides a Yarrowia parrotii yeast strain Q, with a deposit number of CGMCC No. 34478. The Yarrowia parrotii yeast strain Q of the present invention is isolated from the traditional Korean food Qingguojiang, and is applied to the dry-aging process of low-fat buttocks of Yanbian yellow beef. The present invention can significantly improve the edible quality of beef, shorten the fermentation time, and increase the content of amino acids and flavor substances by directly spraying and inoculating the Yarrowia parrotii yeast strain Q on the surface of beef for dry maturation. Compared with sausage fermentation, the free amino acid content of dry-aged beef is significantly increased, the taste attributes are richer, and the umami taste is more prominent. At the same time, the relative content of aldehydes and ketones in the volatile flavor compounds is relatively high, giving the beef a unique flavor characteristic. In addition, the dry-aging process also exhibits good water retention performance, can effectively inhibit the growth of miscellaneous bacteria and harmful bacteria, and ensure the safety of the product.
[0018] This invention also provides a method for dry-aging meat products, which not only increases the consumer appeal and added value of low-fat meat but also provides technical support for the diversified production of Yanbian yellow beef rump. Compared with sausage fermentation, the dry-aging process focuses more on optimizing the texture and flavor of the beef itself, which has positive significance for the innovative development of my country's fermented meat products industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 is the phylogenetic tree of Yarrowia paramerioregi strain Q;
[0020] Figure 2 It is a line graph of the total number of yeasts in beef in different starter culture groups;
[0021] Figure 3 The figure is a line graph showing the pH value changes of beef in different starter culture groups; Note: Lowercase letters indicate significant differences between the same maturation method at different stages; uppercase letters indicate significant differences between maturation methods at the same stage (p < 0.05);
[0022] Figure 4 The figure is a line graph showing the change in the percentage of beef loss in different starter culture groups. Note: Lowercase letters indicate significant differences between the same maturation method at different times; uppercase letters indicate significant differences between maturation methods at the same time (p < 0.05).
[0023] Figure 5 The figure is a line graph showing the changes in moisture content of beef in different starter culture groups. Note: Lowercase letters indicate significant differences between different maturation periods for the same maturation method; uppercase letters indicate significant differences between maturation methods at the same period (p < 0.05).
[0024] Figure 6 The figure is a line graph showing the changes in protein content of beef in different starter culture groups. Note: Lowercase letters indicate significant differences between different maturation periods of the same method; uppercase letters indicate significant differences between different maturation methods at the same period (p < 0.05).
[0025] Figure 7 The following are the amino acid analysis results of beef from different starter culture groups;
[0026] Figure 8 These are the analysis results of beef flavor substances in different starter culture groups.
[0027] Biodeposit Material Information
[0028] Yarrowia parophoni strain Q was deposited on May 9, 2025 at the General Microbiology Center of China Culture Collection Administration, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the biological deposit number CGMCC No. 34478. DETAILED DESCRIPTION
[0029] The invention provides a Yarrowia parnerii strain Q, whose preservation number is CGMCC No.34478.
[0030] In the present invention, the Yarrowia parrotii yeast strain Q is isolated from the traditional Korean food Qingguojiang (commercially available on the market). The Yarrowia parrotii yeast strain Q is applied to the dry maturation process of Yanbian yellow beef low-fat buttocks, which not only shortens the fermentation time to 28 days, but also improves the edible quality of the mature meat and increases the free amino acid content of the beef, making the flavor attributes richer, especially the umami more prominent. At the same time, the relative content of aldehydes and ketones in the volatile flavor compounds is relatively high, giving the beef a unique flavor characteristic. In addition, the dry maturation process also exhibits good water retention performance, can effectively inhibit the growth of miscellaneous bacteria and harmful bacteria, and ensure the safety of the product.
[0031] The present invention provides a fermentation bacterial agent, wherein the active bacterial agent comprises the Yarrowia parrotii strain Q.
[0032] In the present invention, the Yarrowia paramerini strain Q preferably includes at least one of the following: live cells of the Yarrowia paramerini strain Q, a bacterial suspension of the Yarrowia paramerini strain Q, and a fermentation broth of the Yarrowia paramerini strain Q. The live cells of the Yarrowia paramerini strain Q preferably include at least one of the following forms: lyophilized powder, microencapsulated cells, and immobilized cells.
[0033] In the present invention, the method for culturing Yarrowia paramerioregi strain Q preferably comprises inoculating Yarrowia paramerioregi strain Q into YPD liquid medium for activation culture, inoculating the resulting activation solution into YPD liquid medium for expansion culture, separating the resulting culture medium into bacterial cells, washing, centrifuging, and collecting the precipitate as viable cells of the Yarrowia paramerioregi strain Q. The temperature for the activation culture or expansion culture is preferably 26-30°C, and may be 28°C. The duration of the activation culture or expansion culture is preferably 2.5-3.5 days, and may be 3 days. The number of activation cultures is preferably 2-3. The washing solution is preferably sterile PBS buffer. The centrifugation speed is preferably 5000-7000 rpm, and may be 6000 rpm. The method for preparing a bacterial suspension of Yarrowia paramerioregi strain Q preferably comprises resuspending the collected viable cells of Yarrowia paramerioregi strain Q in a buffer to obtain a bacterial suspension. The buffer is preferably sterile PBS buffer.
[0034] In the present invention, the concentration of the Yarrowia parrotii strain Q in the fermentation agent is preferably 10 7 CFU / ml~10 10 CFU / ml or 10 7 CFU / ml~10 7 CFU / g, more preferably 10 8 CFU / ml~10 9 CFU / ml or 10 8 CFU / ml~109 The present invention has no particular limitation on the preparation method of the fermentation agent, and any preparation method of the fermentation agent known in the art can be used.
[0035] The present invention provides the use of the Yarrowia parnereri strain Q or the fermentation agent in the dry preparation of mature meat products.
[0036] In the present invention, the mature meat products preferably include poultry and livestock meat. The poultry and livestock meat preferably includes at least one of the following: beef, mutton, pork, chicken, goose, duck, and rabbit. In the Examples of the present invention, the dry-process preparation of fermented meat products using Yarrowia parasitica strain Q is described using Yanbian yellow beef as an example. The Yanbian yellow beef is preferably low-fat yellow cattle rump. The mature meat products include ham, sausage, and the like.
[0037] The present invention provides a method for preparing a mature meat product by dry process, comprising the following steps:
[0038] The surface of the poultry and livestock meat is treated with the Yarrowia parrotii strain Q or the fermentation agent and then matured by a dry method.
[0039] In the present invention, the poultry meat is preferably cut into meat blocks. The weight of the meat blocks is preferably 0.8 to 1.2 kg, and can be 1.0 kg. The meat blocks are conducive to the rapid colonization and fermentation of the fermentation agent on the surface of the meat blocks.
[0040] In the present invention, the inoculation amount of the bacterial suspension of Yarrowia paramerini strain Q is preferably 2.0% to 3.0% of the mass of the sterilized poultry meat, or can be 2.2% to 2.8%. The concentration of the bacterial suspension of Yarrowia paramerini strain Q is preferably 1×10 7 CFU / ml~10×10 7 CFU / ml, which can be 5×10 7 CFU / ml.
[0041] In the present invention, the dry aging temperature is preferably 3-5°C, and may be 4°C. The wind speed is preferably 1-1.5 m / s, and may be 1.2 m / s. The relative humidity is preferably 75%-85%, and may be 78%-82%, and may be 80%.
[0042] In the present invention, the dry-ripening environment is preferably sterilized in advance, and the sterilization method preferably includes treating with 75% alcohol followed by ultraviolet irradiation for sterilization.
[0043] The method provided by this invention avoids the processing steps of mincing and sausage stuffing. Instead, the meat is directly broken down into appropriately sized pieces and sprayed with a fermentation inoculum. This method not only increases the consumer appeal and added value of low-fat meat, but also provides technical support for the diversified production of Yanbian yellow beef rump. Compared with sausage fermentation, the dry-aging process focuses more on optimizing the texture and flavor of the beef itself, which has positive significance for the innovative development of my country's fermented meat products industry.
[0044] The following describes in detail a Yarrowia paramerinois strain Q, a fermentation agent and applications thereof provided by the present invention in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.
[0045] Example 1
[0046] A method for screening and identifying Yarrowia parnerii strain Q
[0047] Yeast screening was performed using Qingguo sauce as a sample. 25 g of sample was weighed and placed in a sterile homogenizing bag. 225 mL of 0.85% saline sterilized at 121°C was added and homogenized using a slapping homogenizer with standard procedures for 5 minutes. 1.0 mL of the homogenized mixture was diluted with 0.85% sterile saline for a gradient, and 200 μL of each appropriately diluted bacterial suspension was spread on YPD solid culture medium. Three replicates were set for each dilution and cultured at 28°C for 3 to 7 days. Yeast colonies were picked for further separation and purification. All single colonies were inoculated into YPD solid culture medium containing 1% skimmed milk and cultured at 28°C for 7 days. Yeast strains with protease production ability were screened by observing the formation of hydrolysis circles.
[0048] Identification method: ITS1 of strain Q (TCTCTTGTGGATATTTAATTACATTAAACTCAT CATATCATTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTGTGGTATTCCG CACCGCACGGATGGAAGAGCGTGTTCCCTTTGGGATCGCATTGCTTTCTTGAAATGAATCTATTACTTCAATATACATCATTTCACCTCTTTCATCCGAGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA, SEQ ID NO:1) and ITS4 (TGGATGAAGAGGT The amplified product of GAAATGATGTATATTGAAGTAATAGATTCATTTCAAGAAAGCAATGCGATCCCAAAGGGAACACGCTCTTCCATCCGTGCGGTGCGGAATACCACACCGCGCAATGTGCGTTCAAAGATTGATGATTCACATCTGCAAGTCACAAAAAATATCGCGGTTCGCTGCGTTCTTCATCGATGTGAGAGCCAAGAGATCCGTTGTTGATAGTTATAATTAAAATGATATGATGAGTTTAATGTAATTAAATATCCACAAGAGTATTCTAAAATCAATAATGATCCTTCCGCAGGTTCACCTACGGA, SEQ ID NO: 2) was sequenced and identified by China Jilin Kumei Biotechnology Co., Ltd. The sequencing results of ITS1 and ITS4 were compared with the GenBank database, and the phylogenetic tree was constructed using MEGA6.0 after ITS1 and ITS4 were spliced. Figure 1 It can be seen that strain Q was identified as Yarrowia parophoni.
[0049] Comparative Example 1
[0050] Strain TR2-1 isolation steps
[0051] Yanbian yellow cattle rump was cut into chunks weighing 1.0 ± 0.2 kg and hung in an aging cabinet at 4 ± 1°C, 80 ± 5% relative humidity, and a wind speed of 1.2 m / s. Sampling was performed on day 28 of aging. Under aseptic conditions, chunks were removed 1 cm from the epidermis using a sterile scalpel and placed in sterile bags for subsequent testing the same day.
[0052] Weigh 25g of sample into a sterile homogenizing bag, add 225mL of 0.85% saline sterilized at 121°C, and homogenize using a slapping homogenizer using the standard program for 5 minutes. Take 1.0mL of the homogenized mixture and perform a gradient dilution with 0.85% sterile saline. Spread 200μL of each appropriately diluted bacterial suspension onto YPD solid medium, setting up three replicates for each dilution. Incubate at 28°C for 3-7 days. Select yeast colonies for further isolation and purification. All single colonies are inoculated onto YPD solid medium containing 1% skim milk and incubated at 28°C for 3-7 days. By observing the formation of hydrolysis zones, a yeast strain with protease production capacity was identified and named TR2-1.
[0053] The amplified products of ITS1 and ITS4 of strain TR2-1 were identified by DNA sequencing by Jilin Kumei Biotechnology Co., Ltd., China. The amplified products of ITS1 (TGCTTGATTACTTTTGTGGAATTTATTACATT AAACTCATCATATCATTTTTAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTGTGGTATTCCGCACCGCACGGATGGAAGAGCGTGTTCCCTTTGGGATCGCATTGCTTTCTTGAAATGAATCTATTACTTCAATATACATCATTTCACCTCTTTCATCCGAGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA, SEQ ID NO: 3) and ITS4 (CGG The sequencing results of ITS1 (SEQ ID NO: 4) were compared with the GenBank database, and the phylogenetic tree was constructed using MEGA 6.0 with the spliced sequences of ITS1 and ITS4. Figure 1 It can be seen that the strain TR2-1 was identified as Yarrowia galli.
[0054] Example 2
[0055] A preparation method for a starter culture of Yarrowia parrotii strain Q
[0056] Preparation of starter stock solution: Yarrowia parva strain Q was activated in YPD liquid medium and cultured at 28°C for 3 days. The activation was repeated twice and the cells were inoculated into 150 mL of liquid medium for 3 days. After centrifugation at 4°C, the sediment was removed and washed twice with 200 mL of 0.02 M sterile PBS buffer and finally resuspended in 200 mL of 0.02 M sterile PBS buffer to a concentration of 10 7 CFU / ml yeast suspension and put it into a spray bottle for use.
[0057] Example 3
[0058] Preparation method of dry-aged beef
[0059] 1. Fermentation room treatment: The day before the experiment, the fermentation room was fully disinfected with alcohol and sterilized with ultraviolet light. The ambient temperature was maintained at 4±1°C, the wind speed was 1.2m / s, and the relative humidity was 80±5%.
[0060] 2. Raw meat: Select low-fat buttocks of freshly slaughtered adult male Yanbian Yellow Cattle.
[0061] 3. Sample processing: adult male Yanbian yellow cattle rump meat was selected, and the low-fat rump meat was cut into pieces weighing 1.0±0.2 kg. The pieces were hung in a fermentation box, and the bacterial suspension of Yarrowia parva strain Q (concentration 10 7 CFU / ml) with a yeast inoculum of 2.5% of the beef mass. The beef was matured for 28 days at a temperature of 4±1°C, a wind speed of 1.2 m / s, and a relative humidity of 80±5%. Samples were collected and assayed on days 0, 7, 14, 21, and 28.
[0062] Comparative Examples 1 and 2 were also set up, differing only in the starter culture sprayed: Comparative Example 1 was dry-ripened for 28 days without spraying the bacterial suspension, while Comparative Example 2 was dry-ripened for 28 days with spraying a Yarrowia parasitica TR2-1 bacterial suspension. The group inoculated with Yarrowia parasitica Q was designated as Group Q, the group inoculated with Yarrowia parasitica TR2-1 was designated as Group TR, and the uninoculated group was designated as Group C.
[0063] 4. Index determination
[0064] 4.1 Yeast Count Determination: 25 g of dry-aged beef sample was added to 225 mL of 0.85% sterile saline and blended for 5 min using a beating homogenizer. The resulting homogenate was serially diluted in 0.85% sterile saline at appropriate times and plated onto YPD solid medium. After incubation at 28°C for 3 days, the total yeast count was counted. Results are expressed as colony-forming units per gram (CFU / g).
[0065] 4.2 pH Determination: The pH of dry-aged beef was measured using a portable pH meter. Prior to measurement, the instrument was calibrated with potassium hydrogen phthalate (pH 4.00) and potassium dihydrogen phosphate (pH 6.86) standard solutions.
[0066] 4.3 Determination of Maturity Loss: Accurately weigh the weight of the sample before maturity, recorded as m1; each group took samples and weighed them at 0, 7, 14, 21 and 28 days of maturity, recorded as m 2 , calculate the maturity loss according to formula I.
[0067] Maturity loss (%) = (m1-m2) / m1×100% Formula I;
[0068] 4.4 Moisture Content Determination: Refer to the method in the national food safety standard "GB 5009.3-2016 National Food Safety Standard - Determination of Moisture in Foods." Accurately weigh 2g of minced beef (m1), place it in a crucible weighing m2, dry it at 100°C for 4 hours, and weigh it after cooling (m3). Calculate the moisture content according to Formula II.
[0069] Moisture content (%) = [(m1 + m2 - m3) / m1] × 100 Calculate the moisture content of each group at different maturity stages using Formula II;
[0070] 4.5 Protein Content Determination: Digest and determine protein content in samples according to the methods in the national food safety standard "GB 5009.5-2016 National Food Safety Standard - Determination of Protein in Foods." Accurately weigh 0.2g of minced meat sample, remove any visible fat and fascia, and place in a 250mL digestion flask. Add 2.0g of a Kjeldahl nitrogen catalyst tablet and 20.0mL of concentrated sulfuric acid in that order. Place the digestion flask in a digestion furnace and place a funnel at the flask opening. Adjust the temperature to 390°C, digest for 1.5 hours, and then cool until the liquid is transparent. Determine nitrogen content using a fully automated Kjeldahl apparatus.
[0071] 4.6 Electronic Tongue Analysis: Taste attribute analysis was performed using an SA402B electronic tongue equipped with five test sensors and two reference sensors. The five test sensors, AAE, CT0, CA0, C00, and AE1, represent umami, saltiness, sourness, bitterness, and astringency, respectively. 5g of each dry-aged beef sample was mixed with deionized water in a 1:7 ratio and homogenized in a centrifuge tube for 1 minute. After centrifugation at 10,000g for 10 minutes at 4°C, the supernatant was filtered twice through gauze and poured into a sample cup for subsequent analysis.
[0072] 4.7 Determination of free amino acid content: Accurately weigh 5 mL of the filtrate and add 10 mL of 4% trichloroacetic acid. Precipitate at 37°C for 30 min and filter. Pass the supernatant through a 0.45 μm organic filter membrane and inject it into a high performance liquid chromatograph to determine the type and content of free amino acids. The results are expressed in mg / 100 mL of sample.
[0073] 4.8 Electronic Nose Analysis: Electronic nose analysis was performed using a PEN3 electronic nose. The PEN3 system contains 10 metal oxide gas sensors (i.e., W1C, W5S, W3C, W6S, W5C, W1S, W1W, W2S, W2W, and W3S) that can detect olfactory cross-sensitivity. A 5 g sample of ground, dry-aged beef was weighed and placed in a 20 mL headspace vial. The sample was equilibrated at 40°C for 40 min. Three replicates were measured for each sample, and the average value was used for further analysis.
[0074] 4.9 Analysis of Volatile Compounds: Volatile flavor substances were analyzed by GC-MS. 2.0 g of sample was accurately weighed and placed in a headspace injection vial for headspace solid phase microextraction. Volatile compounds were extracted using SPME fiber optic extraction. After incubation at 60°C in a sand bath for 60 min, the sample was injected and tested.
[0075] 5. Test results:
[0076] 5.1 Changes in yeast count in dry-aged beef:
[0077] See the results Figure 2 After yeast was inoculated into dry-aged beef, yeast counts in both inoculated groups reached their highest values on day 7 of the maturation process and remained relatively stable throughout the fermentation process. In contrast, the total yeast count in Comparative Example 1 increased with maturation time.
[0078] 5.2 Effect of strains on pH value in dry-aged beef rump:
[0079] See the results Figure 3 . The pH value reached its lowest value at 7 days, which may be due to the stiffness of beef after slaughter, the anaerobic glycolysis of muscle glycogen to produce lactic acid and the decomposition of ATP to produce phosphate, which significantly reduced the pH of the sample. The pH value began to rise on the 7th day, which was attributed to the alkaline free amino acids and nitrogenous compounds produced during protein degradation by endogenous and microbial proteases. The pH value will increase with the use of yeast starter culture because yeast degrades protein and lactic acid. When the pH value is close to the isoelectric point of muscle protein, the lower pH value leads to lower water holding capacity, which may be related to the fact that PN has the highest water content and the highest pH value.
[0080] 5.3 Effects of strains on maturation loss of dry-aged beef:
[0081] See the results Figure 4. As the dry-aging time increases, the maturity loss rate of beef rump gradually increases. This is because a large amount of water evaporation occurs during the dry-aging process. Compared with Comparative Example 1, the two inoculated groups had less maturity loss (P < 0.05). This is because after the beef is inoculated with yeast, the yeast quickly occupies the ecological niche on the surface of the beef through interspecies competition, squeezing the growth space of spoilage bacteria, thereby regulating the bacterial community structure on the surface of dry-aged beef and reducing the production of spoilage shells. At the end of maturation, the maturity loss of beef in group Q was 32.14%, and the maturity loss of beef in group TR was 32.82%, which was significantly lower than the 38.52% of group C. This shows that inoculation with Yarrowia parasitica Q and Yarrowia gallinarum TR2-1 can reduce the loss of dry-aged beef and reduce the cost of dry-aging.
[0082] 5.4 Effects of strains on moisture and protein content in dry-aged beef rump:
[0083] See the results Figure 5 . The moisture content of meat affects various quality attributes, including juiciness and tenderness. As dry maturation progressed, the moisture content showed a downward trend, with the moisture mass fraction decreasing from 77.29±0.24% to 70.00±0.42% (Q group), 69.16±1.12% (C group), and 69.38±0.94% (TR group), respectively. After dry maturation, the moisture content decreased significantly due to surface dehydration during the maturation process. At the end of dry maturation, there was no significant difference in moisture content between the comparative example and the example, indicating that the effect of the example on moisture content was negligible, which may indicate that the concentration of flavor compounds caused by water loss has little effect on flavor formation.
[0084] During the fermentation process of dry-aged beef, protease-producing yeast can accelerate the decomposition of proteins, generating peptides and free amino acids. These compounds are the basic precursors of the main flavor components, including aldehydes, alcohols, acids, esters and alkanes. Figure 6 As can be seen, the protein content of both the Example and the Comparative Example increased with increasing maturation time. In the early stages of dry maturation, protein degradation or oxidation primarily occurred under the action of endogenous enzymes, and as maturation time increased, endogenous enzyme activity decreased. However, compared with Comparative Example 1, the protein content of Example 1 was significantly lower (P < 0.05), indicating that the addition of Yarrowia parasitica Q further facilitated the hydrolysis of protein in dry-aged beef.
[0085] 5.5 Electronic tongue analysis of dry-aged beef from different strains:
[0086] The electronic tongue sensor showed significant differences in relative intensity values, effectively distinguishing the flavors of different samples. Dry-aged beef exhibited relatively similar taste indices at the end of ripening. The astringency sensor exhibited the highest response to dry-aged beef, followed by the umami sensor and the richness sensor. The umami sensor's response value was slightly above the tasteless point. During ripening, Yarrowia parasitica Q and Yarrowia gallinarum TR2-1 degraded proteins to produce amines. Starting on day 14, the sourness decreased, with the difference from the blank control value being less than 1, indicating a less pronounced sourness, consistent with changes in pH.
[0087] Effects of 5.6 strains on the free amino acid content of dry-aged beef rump:
[0088] See the results Figure 7 . Changes in free amino acid composition and content can be used as an indirect measure of protein hydrolysis. The increase or decrease in free amino acid content depends on the balance between free amino acid formation and degradation. Table 1 shows the changes in free amino acids and total free amino acids after 28 days of dry maturation. A total of 16 free amino acids were detected in the three dry-aged beef groups. Compared with Comparative Example 1, the contents of aspartic acid, glutamic acid, alanine and glycine in the Yarrowia parva Q and Yarrowia gallinarum TR2-1 groups were higher (P < 0.05). The results showed that yeast starter significantly promoted the release of free amino acids and contributed to the flavor formation of fermented meat products.
[0089] Table 1 Results of free amino acid and total free amino acid contents after 28 days of dry maturation
[0090] amino acids C-28d Q-28d TR-28d Aspartic acid <![CDATA[7.42±0.11 b ]]> <![CDATA[8.39±0.23 a ]]> <![CDATA[8.41±0.27 a ]]> glutamate <![CDATA[39.96±0.20 b ]]> <![CDATA[43.07±0.25 a ]]> <![CDATA[42.79±0.34 a ]]> Serine <![CDATA[22.03±0.15 b ]]> <![CDATA[26.41±0.20 a ]]> <![CDATA[24.38±0.19 b ]]> Alanine <![CDATA[6.17±0.18 b ]]> <![CDATA[8.41±0.18 a ]]> <![CDATA[8.22±0.05 a ]]> Lysine <![CDATA[26.84±0.12 c ]]> <![CDATA[34.93±0.15 a ]]> <![CDATA[30.09±0.28 b ]]> Glycine <![CDATA[17.27±0.37 b ]]> <![CDATA[18.82±0.37 a ]]> <![CDATA[18.59±0.29 a ]]> Threonine <![CDATA[14.51±0.03 c ]]> <![CDATA[19.98±0.47 a ]]> <![CDATA[17.98±0.23 b ]]> Arginine <![CDATA[26.63±0.29 b ]]> <![CDATA[32.45±0.03 a ]]> <![CDATA[32.41±0.85 a ]]> Histidine <![CDATA[10.16±0.24 c ]]> <![CDATA[16.41±0.64 a ]]> <![CDATA[13.65±0.15 b <!-- 7 -->]]> Valine <![CDATA[14.16±0.25 c ]]> <![CDATA[15.09±0.35 b ]]> <![CDATA[18.65±0.11 a ]]> Methionine <![CDATA[17.28±0.36 b ]]> <![CDATA[17.29±0.24 b ]]> <![CDATA[17.87±0.07 a ]]> Phenylalanine <![CDATA[21.88±0.38 a ]]> <![CDATA[20.13±0.25 c ]]> <![CDATA[21.14±0.17 b ]]> Isoleucine <![CDATA[30.31±0.61 c ]]> <![CDATA[35.61±0.18 a ]]> <![CDATA[33.87±0.12 b ]]> Leucine <![CDATA[19.48±0.30 b ]]> <![CDATA[25.92±1.03 a ]]> <![CDATA[19.05±0.46 b ]]> Tyrosine <![CDATA[19.57±1.05 b ]]> <![CDATA[21.34±0.08 a ]]> <![CDATA[19.04±0.79 b ]]> Cysteine <![CDATA[42.52±0.29 c ]]> <![CDATA[51.32±0.37 b ]]> <![CDATA[53.46±0.43 a ]]> Total free amino acids <![CDATA[336.17±1.47 c ]]> <![CDATA[395.57±1.49 a ]]> <![CDATA[379.60±1.72 b ]]>
[0091] Note: a-c Different letters indicate significant differences among different inoculation groups at the same maturity stage (P<0.05).
[0092] 5.7 Electronic nose analysis of dry-aged beef of different strains:
[0093] The electronic nose is sensitive to the aroma in the sample, and small changes in volatile compounds can lead to differences in the sensor's response. Figure 8 It can be seen that the W2S, W1W, W1S and W5S sensors responded strongly to the volatile compounds of the samples, indicating that the abundance of alcohols, aldehydes, ketones, sulfur-containing compounds, methyl compounds and nitrogen oxides in dry-aged beef was high.
[0094] 5.8 Analysis of Volatile Flavor Compounds in Dry-Matured Beef from Different Strains:
[0095] The results are shown in Table 2. A total of 43 flavor compounds were detected in the dry-aged beef samples, including 11 aldehydes, 10 alcohols, 8 ketones, 4 acids, 3 esters, and 7 alkanes. These volatile compounds are primarily produced by the fermentation of carbohydrates and the degradation of free amino acids and fatty acids.
[0096] Table 2 Determination results of volatile flavor substances in dry-aged beef
[0097]
[0098]
[0099] Note: ND means not detected; different letters indicate significant differences among the groups (P<0.05)
[0100] Aldehydes are the most abundant volatile components in dry-aged beef, while the comparative examples contain only low levels. At the end of dry-aging, significant amounts of straight-chain aldehydes, including heptanal, octanal, nonanal, and decanal, are found. These compounds primarily originate from the oxidative degradation of unsaturated fatty acids (such as oleic acid, linoleic acid, arachidonic acid, and linolenic acid), contributing to the sweet, fruity, and fatty aroma of dry-aged beef. Overall, the higher aldehyde content in Example 1 compared to the comparative examples is attributed to yeast activity, which, under favorable conditions, releases FAA as a substrate to promote aldehyde formation.
[0101] Alcohol substances mainly come from the fermentation of carbohydrates and the bacterial metabolism of amino acids. Except for n-pentanol, the sensory threshold of alcohols is relatively high. 1-octen-3-ol is a common alcohol compound in fermented meat products. It comes from the β-oxidation hydrolysis of unsaturated fatty acids. It has the aroma of mushrooms and grass and is a typical aroma in dry-aged beef. At the end of dry maturation, the content of 1-octen-3-ol in Example 1 is higher than that in the comparative example. Except for tetrahydrolavandulol, the relative content of alcohols detected in the samples of the examples is higher than that in the comparative example. 2-ethylhexanol has a floral and rosin fragrance. Its content is higher in the early stage of dry maturation and gradually decreases as maturation proceeds. The contents of 1-octanol (orange peel and rose aroma) and n-pentanol (grease fragrance) in the examples are higher than those in the comparative example.
[0102] Ketones have a milky aroma and contribute to the flavor of beef. Nine ketone compounds were detected during the dry-aging process. Among them, 3-hydroxy-2-butanone has a distinctive buttery and sweet flavor with a very low sensory threshold, playing a significant role in the flavor of the product. The content of 3-hydroxy-2-butanone, which has a strong milky aroma, was significantly increased in the examples.
[0103] Esters are typically derived from the esterification of alcohols and carboxylic acids. The types and relative contents of esters in the samples of Example 1 increased to varying degrees. Some ethyl esters, such as ethyl palmitate, were absent from the 0-day samples but were detected in all samples at the end of maturity, imparting a floral and fruity aroma to the product.
[0104] The results of the above examples demonstrate that Yarrowia parrotii Q can reduce dry-aged beef loss during dry-aging, exhibits excellent protein-degrading capabilities, and significantly increases the free amino acid content of beef. Compared to the comparative examples, the abundance of alcohols, aldehydes, ketones, sulfur-containing compounds, methyl groups, and nitrogen oxides in the volatile compounds of the examples is higher, significantly improving flavor. In summary, Yarrowia parrotii Q has the potential to serve as a promising starter culture for meat products, providing a theoretical foundation for the subsequent development of superior starter cultures and novel dry-aging technologies, and has positive implications for the development of my country's fermented meat products industry.
[0105] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A Yarrowia parophoni strain Q, characterized in that The deposit number is CGMCC No.34478.
2. A fermentation agent, characterized in that: The active bacterial agent comprises the Yarrowia parrotii strain Q according to claim 1.
3. The fermentation agent according to claim 2, characterized in that The Yarrowia paramerini strain Q comprises at least one of the following: living cells of the Yarrowia paramerini strain Q, a bacterial suspension of the Yarrowia paramerini strain Q, and a fermentation broth of the Yarrowia paramerini strain Q; The live bacteria of the Yarrowia paramerioregi strain Q include at least one of the following forms: freeze-dried powder, microencapsulated cells and immobilized cells.
4. The fermentation agent according to claim 2 or 3, characterized in that In the fermentation agent, the concentration of Yarrowia parrotii strain Q is 10 7 CFU / ml~10 10 CFU / ml or 10 7 CFU / ml~10 7 CFU / g.
5. Use of the Yarrowia parnerii strain Q according to claim 1 or the fermentation agent according to any one of claims 2 to 4 in the preparation of mature meat products.
6. The application according to claim 5, characterized in that The meat types of the mature meat products include poultry and livestock meat.
7. The application according to claim 6, characterized in that The types of poultry meat include at least one of the following: beef, mutton, pork, chicken, goose, duck and rabbit.
8. A method for preparing mature meat products by dry process, characterized in that: The following steps are involved: The surface of the poultry and livestock meat is treated with the Yarrowia parva strain Q described in claim 1 or the fermentation agent described in any one of claims 2 to 4, and then dry-ripened.
9. The method according to claim 8, characterized in that: The inoculation amount of the bacterial suspension of Yarrowia parnerii strain Q is 2.0% to 3.0% of the mass of poultry meat; The concentration of the bacterial suspension of Yarrowia parrotii strain Q is 1×10 7 CFU / ml~10×10 7 CFU / ml.
10. The method according to claim 8 or 9, characterized in that: The temperature of the dry ripening method is 3-5° C.; the wind speed of the dry ripening method is 1-1.5 m / s; and the relative humidity RH of the dry ripening method is 75%-85%.