Biocontrol bacterium Z9 for preventing and treating fusarium wilt of sea-buckthorn and application of biocontrol bacterium Z9

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a biocontrol bacterium Z9 for preventing and treating sea-buckthorn fusarium wilt and application of the biocontrol bacterium Z9. The paenibacillus polymyxa provided by the invention can prevent and treat the sea-buckthorn fusarium wilt, the inhibition rate on pathogenic bacteria fusarium sporotrichum of the sea-buckthorn fusarium wilt and the prevention and treatment effect on the sea-buckthorn fusarium wilt both reach 60% or above, and pot culture and plot experiments prove that the bacillus polymyxa Z9 can effectively inhibit the growth of the pathogenic bacteria of the sea-buckthorn fusarium wilt and improve the biological prevention effect on the sea-buckthorn fusarium wilt.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a biocontrol bacterium Z9 for preventing and treating sea buckthorn wilt disease and an application thereof. Background Art

[0002] Sea buckthorn ( Sea buckthorn Seabuckthorn (Hippophae rhamnoides L.) is a perennial deciduous shrub, considered the king of vitamin C. It possesses both high nutritional and economic value, playing a vital role in soil and water conservation, preventing wind and sand, and contributing significantly to ecological and environmental governance. In recent years, wilt disease has severely impacted seabuckthorn yields, causing significant economic losses to agricultural production.

[0003] Seabuckthorn wilt is caused by Fusarium sporotrichioides ( Fusarium sporotrichioides Wilt disease can occur throughout the growth and development period, mainly affecting branches and leaves, causing some branches to wither and leaves to turn yellow. In the middle and late stages of the disease, leaves at the bottom of the branches will wither and fall off, and the vascular tissue will change color. In severe cases, the entire plant will die.

[0004] Currently, chemical pesticides are commonly used to control wilt disease. These pesticides harm human health and the ecological environment, and long-term use can also lead to increased resistance in pathogens. With the booming development of green agriculture, biological control of wilt disease has attracted considerable attention. Research has shown that bacteria and fungi can effectively prevent plant wilt disease. Among them, Bacillus is the most commonly used and most studied genus in biological control. It has characteristics such as rapid reproduction and is effective against a wide range of fungal pathogens. However, currently, there is insufficient research on biological control methods that can effectively control seabuckthorn wilt disease, and resources for effectively using biological control to combat this disease remain limited. Summary of the Invention

[0005] In order to solve the above problems, the present invention provides a biocontrol bacterium Z9 for preventing and treating sea buckthorn wilt disease and its application.

[0006] A biocontrol bacterium, the biocontrol bacterium is Paenibacillus polymyxa Z9, which was deposited in the General Microbiology Center of China Culture Collection Administration on May 22, 2025, with the deposit number CGMCC NO.34639, and is classified as Paenibacillus polymyxa .

[0007] A biocontrol agent is obtained by inoculating the biocontrol bacteria according to claim 1 into a bacterial culture medium and fermenting the culture medium.

[0008] The preparation method of the biocontrol agent comprises the following steps: inoculating the seed liquid of Paenibacillus polymyxa Z9 into LB liquid culture medium at an inoculum volume fraction of 1% to 3%, culturing the culture medium at 25°C to 30°C for 20h to 30h for fermentation, and diluting the fermentation liquid 100 times to obtain the biocontrol agent.

[0009] Application of the biocontrol bacteria or the biocontrol agent in preventing and controlling plant diseases.

[0010] Preferably, the plant disease is sea buckthorn wilt.

[0011] Application of the biocontrol bacteria or the biocontrol agent in inhibiting plant pathogens.

[0012] Preferably, it is characterized in that the pathogen is at least one of sea buckthorn wilt pathogen, tobacco black shank pathogen, corn leaf spot pathogen, aphanidermatum and cucumber-specific Fusarium oxysporum pathogen.

[0013] A method for preventing and controlling seabuckthorn wilt disease comprises applying the biocontrol agent to the roots of root plants to prevent and control the seabuckthorn wilt disease.

[0014] Preferably, the seabuckthorn wilt is caused by infection by Fusarium sporotrichioides.

[0015] Compared with the prior art, the present invention is beneficial in that: The present invention has developed a biocontrol strain, Paenibacillus polymyxa Z9, which is safe for humans and animals and has good application prospects, enriching biological control resources. The use of biocontrol agents to control diseases reduces the use of chemical agents in production, while improving the ecological environment and reducing the residues of chemical agents in agricultural products. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the morphological identification of Paenibacillus polymyxa PQ8366281 in the present invention.

[0017] Figure 2 This is the phylogenetic tree of Paenibacillus polymyxa PQ8366281 in the present invention.

[0018] Figure 3 The figure shows the inhibitory effect of the bacterial solution of Paenibacillus polymyxa PQ8366281 of the present invention on the growth of Fusarium sporogons, wherein A is a blank control and B is Z9 (i.e., Paenibacillus polymyxa PQ8366281).

[0019] Figure 4 The inhibitory effects of Paenibacillus polymyxa PQ8366281 on the growth of different fungi in the present invention, wherein a, b, c, d, and e respectively represent the inhibitory effects of Paenibacillus polymyxa PQ8366281 on the growth of seabuckthorn wilt pathogen ( Fusarium proliferated ), tobacco black shank pathogen ( Phytophthora parasitica var. Nicotiana ), corn leaf spot pathogen ( Bipolaris maydis ), Pythium aphanidermatum ( Pythium ), Fusarium oxysporum cucumber pathogen ( Fusarium oxysporum f. sp. cucumber ) growth inhibition.

[0020] Figure 5 The volatile products of Paenibacillus polymyxa PQ8366281 of the present invention inhibit the growth of different fungi, wherein a, b, c, d, and e represent the inhibitory effects of Paenibacillus polymyxa PQ8366281 on the growth of sea buckthorn wilt pathogen ( Fusarium proliferatum ), tobacco black shank pathogen ( Phytophthora parasitica var. Nicotiana ), corn leaf spot pathogen ( Bipolaris maydis ), Pythium aphanidermatum ( Pythium ), Fusarium oxysporum cucumber pathogen ( Fusarium oxysporum f. sp. cucumber ).

[0021] Figure 6 This is the assay for the extracellular enzyme activity produced by Paenibacillus polymyxa PQ8366281 (Z9) of the present invention, A: protease; B: chitinase; C: cellulase; D: amylase; E: Tween 60. DETAILED DESCRIPTION

[0022] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.

[0023] The LB solid medium consists of: 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride (NaCL), adjusted to pH 7.0, and 1 L of water.

[0024] The LB liquid medium consists of: 20 g agar, 10 g tryptone, 5 g yeast extract, 10 g sodium chloride (NaCL), pH adjusted to 7.0, and 1 L water.

[0025] 1. Isolation and identification of strains The bacteria were isolated from healthy soil near the diseased area. The specific method was as follows: 3 g of soil was mixed with 50 mL of sterile water under sterile conditions, and the mixture was shaken in an oscillating box. After 30 minutes, the soil samples were taken out and diluted into 10 -2 ~10 -4Four gradients were used to obtain a soil suspension. It should be noted that 1g to 5g of soil can be mixed aseptically with 50mL of sterile water. 60μL of the soil suspension was evenly spread onto LB solid medium. Each gradient was repeated three times. The suspension was dried in a clean bench and inverted in a 25°C incubator. Single colonies were picked with a sterile toothpick and transferred to new LB solid medium. Initial screening was performed using the plate standoff method using Fusarium sporogons as the target bacteria. One strain, PQ8366281, showed antagonistic activity against Fusarium sporogons and was identified as a potential biocontrol agent. PQ8366281 is abbreviated as Z9.

[0026] Based on the morphological, physiological and biochemical characteristics and 16S sequence analysis of Bacillus, it was finally identified as Paenibacillus polymyxa ( Paenibacillus polymyxa The identification results are as follows:

[0027] 1. Morphological characteristics of colonies The strain grows on LB medium, and the colonies are white, moist, smooth, and sticky, indicating that it is a Gram-positive bacterium (see Figure 1 ).

[0028] 2. Physiological and biochemical characteristics The physiological and biochemical characteristics of Paenibacillus polymyxa PQ8366281 are shown in Table 1.

[0029] Table 1 Physiological and biochemical characteristics of Paenibacillus polymyxa PQ8366281 Note: +, positive reaction; -, negative reaction.

[0030] 3. Colony molecular identification Methods: DNA was extracted and PCR amplified using universal primers 27F (5'AGAGTTTGATCCTGGCTCAG3', SEQ ID NO. 2) and 1492R (5'GGTTACCTTGTTACGACTT3', SEQ ID NO. 3). The PCR system (50 μL) was as follows: 10 pmol of primer, 0.2 mM dNTPs, 1.5 mM MgCl2, 2.5 U Taq DNA polymerase (TaKaRa), 1× PCR buffer (TaKaRa), and 25 ng of genomic DNA template. PCR reaction conditions were: 94°C denaturation for 5 min, 95°C denaturation for 30 s, 58°C annealing for 45 s, and 72°C extension for 90 s. After 30 cycles, a full extension at 72°C for 10 min was performed. PCR products were separated and purified by 1% agarose gel electrophoresis and analyzed on an ABI 3730 DNA sequencer (Sangon Biotechnology Co., Ltd.).

[0031]

[0032] The sequencing results were analyzed by MEGA7.0 software (see Figure 2 The phylogenetic tree was constructed using the neighborjoining method, with the bootstrap replication number set to 1000. Combined with the morphological characteristics, the bacterium PQ8366281 was identified as Paenibacillus polymyxa ( Paenibacillus polymyxa ), recorded as Paenibacillus polymyxa Z9.

[0033] 2. Antibacterial Activity Determination 1. Pathogen selection The pathogens include Fusarium spp. Fusarium proliferatum ), Fusarium sporeans ( Fusarium sporotrichoid ), tobacco black shank pathogen ( Phytophthora parasitica var. Nicotiana ), corn leaf spot pathogen ( Bipolaris maydis ), Pythium aphanidermatum ( Pythium ), Fusarium oxysporum cucumber pathogen ( Fusarium oxysporum f. sp. cucumber ). All are provided and preserved by Shenyang Agricultural University.

[0034] 2. Antibacterial experiment A 5 mm diameter cake of the pathogenic fungus Fusarium sporotrichioides was placed at the center of a blank PDA culture medium. Paenibacillus polymyxa Z9 was then streaked 2 cm above and below the cake. A blank LB culture medium with streaked patches was used as a control. Incubate at 28°C for 5 days. The diameter of the Fusarium sporotrichioides growth was measured and the inhibition rate was calculated. Each treatment was repeated three times, and the average value was calculated.

[0035] Pathogenic fungus inhibition rate = [(control pathogen growth diameter - treated pathogen growth diameter) / control pathogen growth diameter] × 100%.

[0036] Results: As Figure 3 As shown, Paenibacillus polymyxa Z9 is effective against Fusarium sporotrichioides ( F.sporotrichioides ) has a significant inhibitory effect, with an inhibition rate of 63.72%.

[0037] 3. Inhibitory effect of Paenibacillus polymyxa Z9 bacterial solution on pathogens A fungal cake with a diameter of 5 mm was inoculated in the center of the PDA plate, and a line of Z9 fermentation stock solution was streaked 2 cm above / below the cake as the treatment group, and a streaked blank LB was used as the control group.

[0038] Preparation method of Z9 fermentation liquid: pick a single colony of the original strain Z9 obtained by separation and screening from the plate with a toothpick, inoculate it into a 50mL centrifuge tube containing 25mL of LB liquid culture medium for liquid fermentation, and prepare the seed liquid, that is, shake and culture it at 28℃, 200r / min constant temperature shaker for 24h to obtain Z9 seed liquid. Further purify and culture, inoculate the obtained Z9 seed liquid into a 250mL conical flask containing 100mL of LB liquid culture medium at an inoculum volume fraction of 2%, and continue to culture it at 28℃, 200r / min constant temperature shaker for 24h to obtain Z9 fermentation liquid. The biocontrol agent is obtained after dilution 100 times, and the OD 600 About 0.3.

[0039] Results: As Figure 4 As shown in the figure, Paenibacillus polymyxa Z9 has a significant inhibitory effect on the growth of various pathogenic fungi, especially on Fusarium spp. F. proliferatum ), tobacco black shank pathogen ( P. parasitica var. Nicotiana ), corn leaf spot pathogen ( B.maydis ), Pythium aphanidermatum ( Pythium ), Fusarium oxysporum cucumber pathogen ( F.oxysporum f. sp cucumber ) reached 74.55%, 68.93%, 73.97%, 70.97% and 71.29% respectively, with obvious antibacterial effects.

[0040] 4. Inhibitory effect of volatile substances from Paenibacillus polymyxa Z9 on pathogens The preparation method of Z9 fermentation broth is the same as above.

[0041] 100 μL of Paenibacillus polymyxa Z9 fermentation broth was spread on an LB plate. A PDA plate inoculated with the fungus and the LB plate coated with the fermentation broth were sealed together to form the treatment group. A blank LB plate was spread on the plate and sealed to form the control group. Incubate at 28°C. After 5 days, the diameter of the pathogen growth in each treatment was measured and the inhibition rate was calculated. Each treatment was repeated three times, and the average value was taken. The inhibition rate of the pathogen was calculated.

[0042] Results: As Figure 5 As shown, the volatile substances produced by Paenibacillus polymyxa Z9 have an effect on Fusarium spp. F. proliferatum ), tobacco black shank pathogen ( P. parasitica var. Nicotiana ), corn leaf spot pathogen ( B.maydis ), Pythium aphanidermatum ( Pythium ), Fusarium oxysporum cucumber pathogen ( F.oxysporum f. sp . cucumber ) had an inhibition rate of 39.63%-49.23%, among which the inhibition rate against Pythium aphanidermatum ( Pythium ) had the best inhibitory effect, reaching 49.23%, and had the best inhibitory effect on tobacco black leg pathogen ( P. parasitica var. Nicotiana ) had the worst inhibitory effect, only 39.63%.

[0043] 3. Preparation of biocontrol agents (1) The preserved Paenibacillus polymyxa Z9 was cultured on LB solid medium to activate the strain and obtain an activated strain; (2) The activated strain was inoculated into LB liquid culture medium and cultured in a constant temperature shaker at 28°C and 200 rpm for 24 h to obtain seed liquid.

[0044] (3) To further purify the culture, the obtained Z9 seed liquid was inoculated into a new LB liquid culture medium at a 2% inoculation rate, and the culture was carried out at 28°C, 200 r / min constant temperature shaker for 24 h for fermentation. The obtained fermentation liquid was diluted 100 times to obtain the biocontrol agent (OD600 of about 0.3).

[0045] 4. Extracellular enzyme activity assay Experiment: Prepare Z9 fermentation broth as above. Pipette 10 μL of Paenibacillus polymyxa Z9 fermentation broth onto the sterile filter paper in the center of the protease, chitinase, cellulase, amylase, and lipase assay plates. Incubate at 28°C for 3 days and observe for the presence of clear zones around the colonies.

[0046] Results: As Figure 6 As shown, a transparent circle appeared in the center of the protease, cellulase, amylase and lipase detection plate of Paenibacillus polymyxa Z9, indicating that strain Z9 can produce protease, cellulase, amylase and lipase, but cannot produce chitinase.

[0047] 5. Evaluation of the disease control efficacy of biocontrol agents In a 2023 potted plant efficacy trial, sea buckthorn seedlings were soaked in a biocontrol agent for three days. These seedlings were then planted in sterile nutrient soil pots (2 kg) and 200 ml of the biocontrol agent was added to each pot. Two days later, lateral roots of the sea buckthorn plants were damaged by inserting a cutting knife into the soil around the potting soil. Each pot was then inoculated with 50 ml of a spore suspension of Fusarium spp. and watered regularly. A total of 12 sea buckthorn plants were cultivated, with two plants per pot. Twelve weeks later, the plants were used to evaluate the biocontrol agent's potential. A control group of sea buckthorn plants was soaked in clean water for three days. The pots were then irrigated with 200 ml of sterile water. Two days later, lateral roots of the sea buckthorn plants were damaged by inserting a cutting knife into the soil around the potting soil. Each pot was then inoculated with 50 ml of a spore suspension of Fusarium spp. and watered regularly. Twelve weeks after treatment, the disease index of the control and biocontrol agent-treated plants was measured to assess the severity of wilt.

[0048] In a 2024 plot control efficacy trial, sea buckthorn seedlings were soaked in a biocontrol agent for three days. On May 15, 2024, the soaked seedlings were planted at a sea buckthorn cultivation base in Qingyang City, Gansu Province, where sea buckthorn wilt, caused by Fusarium sporotrichioides, has been reported for several consecutive years. The plots, measuring 20 m x 20 m and replicated three times, were irrigated with approximately 500 ml of the biocontrol agent per plant. Applications were made twice during the growing season, with a 30-day interval. The plots were regularly watered using drip irrigation. On September 15, disease indexes were measured within the plots and in comparison with the control group. The efficacy of the biocontrol agent was calculated to evaluate the biocontrol potential. The control group, measuring 20 m x 20 m and replicated three times, was soaked in clean water for three days. Each plant was then irrigated with approximately 500 ml of water at its roots and watered regularly. Disease indexes were measured using a five-point sampling method within each plot, with 25 to 35 sea buckthorn plants tested. The biological control effects of potted plants and small plots for two consecutive years were 66.1% and 67.8% respectively, both above 65%, and the effects were stable.

[0049] Table 2 Classification of seabuckthorn wilt disease Disease index (DI) = 100 × ∑ (number of diseased leaves at each level × representative value of each level) / (total number of leaves surveyed × highest representative value) Table 3 Disease index and control effect of biocontrol bacteria in potted plants against sea buckthorn wilt in 2023 Table 4 Disease index and control effect of sea buckthorn wilt in biocontrol plots in 2024 It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.

[0050] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0051] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A biocontrol bacterium, characterized in that: The biocontrol bacterium is Paenibacillus polymyxa Z9, which was deposited in the General Microbiology Center of China Culture Collection Administration on May 22, 2025, with the deposit number CGMCC NO.34639, and is classified as Paenibacillus polymyxa .

2. A biocontrol agent, characterized in that The biocontrol bacteria according to claim 1 is inoculated into a bacterial culture medium and fermented to obtain the product.

3. The method for preparing the biocontrol agent according to claim 2, wherein The seed liquid of Paenibacillus polymyxa Z9 is inoculated into a bacterial culture medium at an inoculum volume fraction of 1% to 3%, cultured at 25° C. to 30° C. for 20 h to 30 h for fermentation, and the biocontrol agent is obtained by diluting the fermentation liquid 100 times.

4. Use of the biocontrol bacterium according to claim 1 or the biocontrol agent according to claim 2 in preventing and controlling plant diseases.

5. The use according to claim 4, characterized in that The plant disease is seabuckthorn wilt.

6. Use of the biocontrol bacterium according to claim 1 or the biocontrol agent according to claim 2 in inhibiting plant pathogens.

7. The use according to claim 6, characterized in that The pathogen is at least one of sea buckthorn wilt pathogen, tobacco black shank pathogen, corn leaf spot pathogen, cucurbitacin Pythium and cucumber-specific Fusarium oxysporum pathogen.

8. A method for preventing and treating seabuckthorn wilt, characterized in that: The biocontrol agent according to claim 2 is used for irrigating the roots of root plants to prevent and control sea buckthorn wilt disease.

9. The method according to claim 8, characterized in that The seabuckthorn wilt disease is caused by infection by Fusarium sporotrichioides.

Images