Gene RhNADP-LIKE for regulating and controlling flower aging

Abstract

The invention discloses a gene RhNADP-LIKE for regulating and controlling Chinese rose flower aging, and particularly relates to the technical field of molecular biology and horticultural plant physiology. According to the invention, bottle insertion life phenotype data of 358 parts of core germplasm of tetraploid Chinese rose is screened through genome-wide association analysis (GWAS), and the gene RhNADP-LIKE significantly associated with senescence is identified. The gene accelerates the aging process of petals by regulating the accumulation of reactive oxygen species (ROS). After RhNADP-LIKE expression is inhibited by using a virus-induced gene silencing (VIGS) technology, the blooming period of rosa chinensis flowers is prolonged by about 2 days, and the ROS level is remarkably reduced. The invention provides a molecular target for prolonging the vase life of the Chinese rose, can be applied to gene editing breeding or development of an environment-friendly preservative, reduces the dependence of chemical agents, and improves the economic benefit and sustainable development potential of the cut flower industry.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology, bioinformatics and plant physiology, and in particular to a gene RhNADP-LIKE for regulating flower aging. Background Art

[0002] Genome-Wide Association Study (GWAS) is a statistical method that scans genome-wide genetic variation (such as single nucleotide polymorphisms (SNPs)) for significant associations with specific phenotypes (such as diseases and agronomic traits). It is widely used in medicine, botany, and zoology to reveal the genetic basis of complex traits. GWAS has successfully elucidated the genetic basis of complex traits such as fruit quality, disease resistance, and flowering time in horticultural plants. Previous studies have sequenced 336 peach genomes and conducted association studies with 26 agronomic traits, identifying numerous candidate causal variants. A comprehensive walnut genome variation map based on whole-genome resequencing of 815 walnut accessions has revealed 27 genomic loci responsible for 18 important agronomic traits. Pear is a major fruit crop distributed worldwide, but its breeding process is very time-consuming. To facilitate molecular breeding and gene identification, previous researchers have discovered 37 loci associated with eight fruit quality traits and five loci associated with three fruit phenological traits through genome-wide association analysis. However, GWAS studies on roses, a key ornamental crop, were relatively limited. Until 2018, Hibrand et al. published genomic data for diploid roses. Using GWAS, they identified candidate genes, RcKSN, RcAP2, and RcTTG2, on chromosome 3 of 'Old Blush' roses, associated with flowering, petal type, self-incompatibility, and prickle density.

[0003] As an important ornamental flower with significant economic value, roses account for over one-third of the global cut flower industry. Factors such as flower shape, color, and fragrance determine the quality of cut roses, with shape being the most fundamental. Postharvest preservation of cut roses directly affects flower shape, and their aging rate directly impacts their economic value and ecological benefits. Breeding varieties with strong preservation abilities is therefore extremely valuable. Aging is crucial for the growth and development of plant organs and entire plants. In rose production, methods such as spraying preservatives and regulating temperature can delay or slow petal aging, thereby extending the flower's viewing period. Therefore, studying cut rose aging is not only crucial for improving the industry's economic benefits and promoting green agriculture, but also provides a window into the molecular mechanisms of plant aging, providing theoretical support for postharvest biology and stress-resistance breeding for horticultural crops.

[0004] Reactive oxygen species (ROS) are considered to be byproducts of plant aerobic metabolism, such as cellular respiration and photosynthesis. Oxygen (O2), the source of all ROS, is inactive in plants, but ROS are unstable and more chemically active. In plants, ROS exist in two main forms: ionic and molecular. Ionic forms include hydroxyl radicals (OH−) and superoxide anions (O2 − ); molecular states include hydrogen peroxide (H2O2) and singlet oxygen ( 1 O2). ROS have dual roles in the body, depending on their levels. When maintained at low concentrations, ROS typically act as signaling molecules, participating in a wide range of physiological and biochemical reactions, such as signal transduction, immune response, and autophagy, to maintain plant development under both normal conditions and adverse environments. However, when ROS accumulate excessively, high concentrations can cause irreversible oxidative damage to cells, toxic to tissues, and, in severe cases, lead to death.

[0005] ROS are usually synthesized mainly in chloroplasts, mitochondria, and peroxisomes, and are also partially produced in subcellular organelles such as cell walls, plasma membranes, and endoplasmic reticulum. In the petals of most species, few active chloroplasts remain in the fully flowering stage; most are converted into chromatin. Therefore, the main source of ROS production in petals may be the redox systems of peroxisomes, mitochondria, and exoplasms. Mitochondrial synthesis of ROS mainly depends on the electron transport chain (mETC) of the mitochondrial inner membrane. During the electron transfer process, when electrons are not normally transferred to the terminal oxidase, but react directly with oxygen, oxygen is reduced by electrons to produce O2 − , which is the precursor of various ROS. When electron leakage occurs in the respiratory chain, superoxisome catalyzes O2 − A disproportionate reaction occurs to produce OH− and H2O2, which is also the main way for mitochondria to synthesize ROS. In photosynthetic leaves, the photosynthetic reaction pathway in chloroplasts produces more ROS than the mitochondrial pathway.

[0006] The electron transport system exists not only in mitochondria, but also contains NADPH oxidase on the plasma membrane, which can transfer electrons to the oxygen in the exoplasm when electrons leak, thereby catalyzing the production of O2 − O2 −H2O2 is further produced through the catalysis of other enzymes such as spontaneous dismutase. In addition, the cell wall can produce H2O2 when stimulated by external stimuli such as peroxidase. Studies have shown that isocitrate dehydrogenase (IDH) catalyzes isocitrate to produce α-ketoglutarate in the tricarboxylic acid cycle (TCA), reducing NADP+ to NADPH. NAD and NADP in organisms participate in at least 300 different redox reactions. NADH, NAD and NADP are key oxidants in the cytosol. Changes in their content not only cause changes in the redox state of the cell but also cause changes in the cell signal transduction pathway. NAD is mainly involved in glycolysis (EMP) and the tricarboxylic acid cycle (TCA), while NADP is mainly involved in the pentose phosphate pathway (PPP). When plants are under oxidative stress, NADPH plays a very important role in balancing the redox balance of plant cells. NADP and NADPH will both produce O2 during electron transfer. −− and H2O2 promote membrane oxidation. Studies have observed that when NADPH content decreases, the cell's antioxidant mechanism is destroyed, causing gradual cell death or apoptosis.

[0007] NADPH oxidase in plants, also known as respiratory burst oxidase homologue (Rboh), shares a structure with mammals: six conserved transmembrane domains, an NADPH-binding domain, and a FAD-binding domain. In addition, plant Rboh proteins contain additional phosphorylation sites and two EF-hand motifs at the N-terminus. The apoplastic ROS produced by the NADPH oxidase encoded by the Rboh gene plays an increasing role in plant growth and development, such as pollen tube growth, axillary bud growth, seed germination and maturation, and lateral root initiation. In tomato, pathogen-induced ROS accumulation in RbohD directly stimulates autophagosome formation and inhibits cell death.

[0008] Currently, there are few reports on the regulatory mechanisms of rose flower aging through forward genetics. There is a lack of a GWAS-based screening to obtain the gene RhNADP-LIKE related to rose organ aging, and to deeply explore its biological function, aiming to lay the foundation for extending the vase life of roses and analyzing the mechanism of flower aging. Summary of the Invention

[0009] In order to solve the problems of the prior art, the purpose of the present invention is to provide a gene RhNADP-LIKE for regulating flower aging.

[0010] In order to achieve the above object, the present invention adopts the following technical solutions: In a first aspect, the present application provides a gene RhNADP-LIKE for regulating flower aging.

[0011] In a second aspect, the present application provides a protein encoding the RhNADP-LIKE gene that regulates flower aging.

[0012] In a third aspect, the present application provides a specific primer pair for regulating the rose flower aging gene RhNADP-LIKE.

[0013] In a fourth aspect, the present application provides a method for extending the vase life of roses.

[0014] In a fifth aspect, the present application provides a screening method for regulating the flower aging gene RhNADP-LIKE based on genome-wide association analysis.

[0015] In a sixth aspect, the present application provides a VIGS vector for silencing and regulating the flower aging gene RhNADP-LIKE, comprising a specific fragment regulating the flower aging gene RhNADP-LIKE, the nucleotide sequence of the specific fragment being shown in SEQ ID NO:3.

[0016] In a seventh aspect, the present application provides a rose plant obtained by the method.

[0017] In an eighth aspect, the present application provides an application of the flower aging regulating gene RhNADP-LIKE in cultivating rose varieties with extended flowering periods.

[0018] In a ninth aspect, the present application provides an application of the flower aging regulating gene RhNADP-LIKE in the development of a preservative for extending the shelf life of cut roses.

[0019] In a tenth aspect, the present application provides an application of a flower aging regulating gene RhNADP-LIKE in regulating flower aging and vase life in Rosaceae plants, wherein the Rosaceae plants are roses.

[0020] In a first aspect, the present application provides a flower aging regulating gene RhNADP-LIKE. The nucleotide sequence of the flower aging regulating gene RhNADP-LIKE is shown in SEQ ID NO: 1. The flower aging regulating gene RhNADP-LIKE accelerates the aging process of rose flowers by regulating the accumulation of reactive oxygen species ROS.

[0021] In a second aspect, the present application provides a protein encoding the flower aging regulating gene RhNADP-LIKE, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0022] In a third aspect, the present application provides a specific primer pair for regulating the rose flower aging gene RhNADP-LIKE, the primer pair comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer being shown in SEQ ID NO:4, and the nucleotide sequence of the reverse primer being shown in SEQ ID NO:5.

[0023] The fourth aspect of the present application provides a method for extending the vase life of roses by reducing or blocking the expression of the flower aging regulating gene RhNADP-LIKE, reducing the accumulation of reactive oxygen species ROS, and thus delaying the aging of rose flowers.

[0024] Furthermore, reducing or blocking gene expression is achieved through virus-induced gene silencing (VIGS) technology.

[0025] In a fifth aspect, the present application provides a screening method for regulating the flower senescence gene RhNADP-LIKE based on genome-wide association analysis, comprising the following steps: a) Collect vase life phenotypic data of rose germplasm resources; b) performing whole genome resequencing on the rose germplasm resources to obtain SNP sites; c) Genome-wide association studies (GWAS) were performed using mixed linear models (MLM) to screen for SNPs significantly associated with vase life. d) Identify the flower aging regulatory gene RhNADP-LIKE located in the SNP locus region and verify its function in regulating the accumulation of reactive oxygen species (ROS).

[0026] In a sixth aspect, the present application provides a VIGS vector for silencing and regulating the flower aging gene RhNADP-LIKE, comprising a specific fragment regulating the flower aging gene RhNADP-LIKE, the nucleotide sequence of the specific fragment being shown in SEQ ID NO:3.

[0027] A seventh aspect of the present application provides a method for preparing a rose plant with an extended flowering period, comprising the following steps: a) Select tetraploid rose core germplasm resources as starting materials; b) constructing a virus-induced gene silencing (VIGS) vector comprising a RhNADP-LIKE gene-specific fragment, wherein the nucleotide sequence of the specific fragment is shown in SEQ ID NO: 3; c) transforming the VIGS vector from step b) into Agrobacterium GV3101 and mixing it with Agrobacterium carrying the pTRV1 vector at a ratio of 1:1 to obtain an infection solution; d) injecting the rooted rose tissue culture seedlings with the infection solution described in step c), and simultaneously infecting plants with the empty vector pTRV2 as a control; e) incubating the infected plants at a temperature of 21-23°C, a photoperiod of 8 hours dark / 16 hours light, and 60% humidity for 15-20 days to promote gene silencing; f) Screening for plants with significantly reduced RhNADP-LIKE gene expression to obtain rose plants with extended flowering and delayed petal senescence. The rose germplasm resources are 358 core tetraploid rose collections.

[0028] In an eighth aspect, the present application provides an application of the flower aging regulating gene RhNADP-LIKE in cultivating rose varieties with extended flowering periods.

[0029] In a ninth aspect, the present application provides an application of the flower aging regulating gene RhNADP-LIKE in developing a preservative for extending the shelf life of cut roses.

[0030] In a tenth aspect, the present application provides an application of the flower aging regulating gene RhNADP-LIKE in regulating flower aging and vase life in Rosaceae plants, wherein the Rosaceae plants are roses.

[0031] The flower aging regulatory gene RhNADP-LIKE accelerates the aging process of rose flowers by regulating the accumulation of reactive oxygen species (ROS).

[0032] Beneficial effects: The present invention provides a molecular target for extending the vase life of roses, which can be applied to gene editing breeding or the development of environmentally friendly preservatives, reducing dependence on chemical agents and enhancing the economic benefits and sustainable development potential of the cut flower industry.

[0033] Compared with the existing technology, the present invention has the following advantages: (1) Accurate analysis of the aging mechanism of rose flowers: Through genome-wide association analysis (GWAS), the gene RhNADP-LIKE, which is highly correlated with vase life, was identified in roses for the first time, revealing its molecular mechanism of accelerating petal aging by regulating the accumulation of reactive oxygen species (ROS), filling the research gap in the molecular regulatory network of rose petal aging and providing a new direction for subsequent functional gene mining.

[0034] (2) Extending vase life and improving economic benefits: After inhibiting RhNADP-LIKE expression through virus-induced gene silencing (VIGS) technology, the opening period of rose flowers was significantly extended (about 2 days) and the aging process of petals was delayed. This technology can be directly applied to the preservation of rose cut flowers, reducing losses during transportation and storage, and significantly improving the market competitiveness and economic value of the product.

[0035] (3) Reduce dependence on chemical preservatives and promote green agriculture: Traditional preservation methods rely on chemical agents (such as ethylene inhibitors) or physical regulation (low-temperature storage), which are costly and pose environmental risks. This invention reduces ROS levels through targeted gene regulation, providing a theoretical basis for the development of environmentally friendly preservation technologies and promoting the development of green agriculture.

[0036] (4) Promote molecular breeding innovation: After clarifying the regulatory function of RhNADP-LIKE, gene editing (such as CRISPR / Cas9) or molecular marker-assisted selection can be used to quickly cultivate new rose varieties with long flowering periods and good storage resistance, shortening the traditional breeding cycle and improving breeding efficiency.

[0037] (5) Expanding the application potential of other horticultural crops: The ROS regulatory mechanism is conserved in plant aging. The technical route of the present invention (GWAS combined with VIGS verification) can be extended to the research on post-harvest preservation of ornamental flowers such as roses and carnations, as well as fruits and vegetables, and has broad scientific value and industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the embodiments or descriptions of the prior art. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0039] Figure 1 This is the Manhattan plot of the vase life traits of the rose in 2021 of the present invention.

[0040] Figure 2 This is an analysis of the expression characteristics of RhNADP-LIKE in different developmental stages of rose petals of the present invention. S1-S6 are diagrams of different opening levels of roses.

[0041] Figure 3 Figure 2 shows the expression of the RhNADP-LIKE gene in TRV and TRV-RhNADP-LIKE cells of the present invention. The expression of the gene in the TRV control was set to 1, and the internal reference gene was RhUBI. The bar graph represents the mean ± SD, and five biological replicates were tested. Independent sample t-test, *P < 0.05, **P < 0.01.

[0042] Figure 4 This figure shows the effect of silencing RhNADP-LIKE on the opening and petal senescence of roses of the present invention; after the flowers reveal their color, photos are taken and observed regularly every day to record the opening process; TRV: control plant; TRV2-RhNADP-LIKE: silenced RhNADP-LIKE plant; Stage#: opening level.

[0043] Figure 5 This is the VIGS rose flower opening phenotype statistics and the opening time diagram from S2 level to senescence.

[0044] Figure 6 DAB staining (upper) and NBT staining (lower) of the petals of the RhNADP-LIKE silenced plant of the present invention. DETAILED DESCRIPTION

[0045] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0046] In this application, the term "and / or" describes the relationship between associated objects, indicating that three possible relationships exist. For example, A and / or B can represent: A exists alone, A and B exist simultaneously, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0047] In this application, "-at least one" means one or more, and "plurality" means two or more. "-at least one" or similar expressions refer to any combination of these items, including any combination of single or plural items. For example, "-at least one of a, b, or c" or "-at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can each be single or plural.

[0048] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution. Some or all of the steps can be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0049] In a first aspect of an embodiment of the present application, a flower aging regulating gene RhNADP-LIKE is provided. The nucleotide sequence of the flower aging regulating gene RhNADP-LIKE is shown in SEQ ID NO: 1. The flower aging regulating gene RhNADP-LIKE accelerates the aging process of rose flowers by regulating the accumulation of reactive oxygen species ROS.

[0050] In a second aspect, an embodiment of the present application provides a protein encoding the flower aging regulating gene RhNADP-LIKE, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0051] In a third aspect of an embodiment of the present application, a specific primer pair is provided for regulating the rose flower aging gene RhNADP-LIKE, the primer pair comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer being shown in SEQ ID NO:4, and the nucleotide sequence of the reverse primer being shown in SEQ ID NO:5.

[0052] The fourth aspect of the embodiments of the present application provides a method for extending the vase life of roses by reducing or blocking the expression of the flower aging-regulating gene RhNADP-LIKE, thereby reducing the accumulation of reactive oxygen species (ROS), thereby delaying the aging of rose flowers.

[0053] In some embodiments, reducing or blocking gene expression is achieved by virus-induced gene silencing (VIGS).

[0054] A fifth aspect of the present application provides a method for screening the flower senescence regulating gene RhNADP-LIKE based on genome-wide association analysis, comprising the following steps: a) Collect vase life phenotypic data of rose germplasm resources; b) performing whole genome resequencing on the rose germplasm resources to obtain SNP sites; c) Genome-wide association studies (GWAS) were performed using mixed linear models (MLM) to screen for SNPs significantly associated with vase life. d) Identify the flower aging regulatory gene RhNADP-LIKE located in the SNP locus region and verify its function in regulating the accumulation of reactive oxygen species (ROS).

[0055] In a sixth aspect, an embodiment of the present application provides a VIGS vector for silencing and regulating the flower aging gene RhNADP-LIKE, comprising a specific fragment that regulates the flower aging gene RhNADP-LIKE, and the nucleotide sequence of the specific fragment is shown in SEQ ID NO: 3.

[0056] A seventh aspect of the present application provides a method for preparing a rose plant with an extended flowering period, comprising the following steps: a) Select tetraploid rose core germplasm resources as starting materials; b) constructing a virus-induced gene silencing (VIGS) vector comprising a RhNADP-LIKE gene-specific fragment, wherein the nucleotide sequence of the specific fragment is shown in SEQ ID NO: 3; c) transforming the VIGS vector from step b) into Agrobacterium GV3101 and mixing it with Agrobacterium carrying the pTRV1 vector at a ratio of 1:1 to obtain an infection solution; d) injecting the rooted rose tissue culture seedlings with the infection solution described in step c), and simultaneously infecting plants with the empty vector pTRV2 as a control; e) incubating the infected plants at a temperature of 21-23°C, a photoperiod of 8 hours dark / 16 hours light, and 60% humidity for 15-20 days to promote gene silencing; f) Screening for plants with significantly reduced RhNADP-LIKE gene expression to obtain rose plants with extended flowering and delayed petal senescence. The rose germplasm resources are 358 core tetraploid rose collections.

[0057] In an eighth aspect, an embodiment of the present application provides an application of the flower aging regulating gene RhNADP-LIKE in cultivating rose varieties with extended flowering periods.

[0058] A ninth aspect of the embodiments of the present application provides an application of the flower aging regulating gene RhNADP-LIKE in developing a preservative for extending the shelf life of cut roses.

[0059] In a tenth aspect, an embodiment of the present application provides an application of the flower aging regulating gene RhNADP-LIKE in regulating flower aging and vase life in Rosaceae plants, wherein the Rosaceae plants are roses.

[0060] The flower aging regulatory gene RhNADP-LIKE accelerates the aging process of rose flowers by regulating the accumulation of reactive oxygen species (ROS).

[0061] Example 1 The present invention discloses a flower aging regulating gene RhNADP-LIKE, the nucleotide sequence of which is shown in SEQ ID NO: 1. The gene accelerates the aging process of rose flowers by regulating the accumulation of reactive oxygen species (ROS).

[0062] The flower aging regulatory gene RhNADP-LIKE regulates flower aging and vase life in Rosaceae plants, including roses.

[0063] The invention discloses a protein encoding a flower senescence regulating gene RhNADP-LIKE, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.

[0064] Example 2 The invention discloses a method for extending the vase life of roses, which reduces or blocks the expression of the flower aging-regulating gene RhNADP-LIKE, thereby reducing the accumulation of reactive oxygen species (ROS), thereby delaying the aging of rose flowers.

[0065] Reducing or blocking gene expression is achieved through virus-induced gene silencing (VIGS).

[0066] Example 3 The present invention provides a screening method for the flower senescence regulating gene RhNADP-LIKE based on genome-wide association analysis, comprising the following steps: a) collecting vase life phenotypic data of rose germplasm resources; b) performing whole-genome resequencing on the rose germplasm resources to obtain single nucleotide polymorphism (SNP) sites; c) performing genome-wide association analysis (GWAS) using a mixed linear model (MLM) to screen for SNP sites significantly associated with vase life; and d) identifying the flower senescence regulating gene RhNADP-LIKE located in the region of the SNP site and verifying its function in regulating the accumulation of reactive oxygen species (ROS).

[0067] Materials and Methods Plant material and treatment 1,358 tetraploid rose germplasm resources, all planted in greenhouses.

[0068] 2. Subculture of 'Samantha' rose (Rosa hybrida 'Samantha') seedlings: Insert a 'Samantha' rose stem segment approximately 2-3 cm long with at least one axillary bud into a propagation and subculture medium. When the seedling reaches approximately 10-12 cm in height, transfer it to a rooting medium. When the seedling develops roots approximately 3-5 cm long, remove it from the tissue culture flask and gently rinse the medium around the plant's roots with water. Maintain humidity to prevent rapid drying. Plant the seedling with a mature root system in a nutrient pot containing a 2:1 mixture of nutrient soil and vermiculite. Cover with a transparent, heat-insulating, and moisture-retaining dome for 15-20 days to allow the seedlings to harden. After removing the dome, maintain an 8 / 16 hour dark / light cycle, with an air humidity of approximately 60% and a temperature of 21-23°C.

[0069] Phenotypic data analysis Phenotypic characteristics of rose varieties from different sources were statistically analyzed. Microsoft Excel 2007 was used to organize and analyze the data, calculating the mean, standard deviation, coefficient of variation, kurtosis, and skewness for each trait. The coefficient of variation is the ratio of the standard deviation of the raw data to the mean. The rose core collection was then graded using the mean and standard deviation as the basis for grading. This was used to calculate the distribution frequency Pi of each trait at each level (Yin Shihua et al., 2021). The Shannon-Weaver index of genetic diversity was then used to assess the genetic diversity of each trait. The Shannon-Weaver index of genetic diversity is proportional to the diversity of a trait; a higher index indicates a higher diversity of that trait.

[0070] H'= ∑Pi ln Pi Where Pi is the distribution frequency of the i-th level, and ln is the natural logarithm.

[0071] In this paper, descriptive statistics and diversity analysis were performed on the vase aging phenotypes of 358 tetraploid rose germplasm resources.

[0072] Genome-wide association analysis The laboratory has completed the resequencing of 358 core rose germplasms and compared the data with two sets of haplotype genomes. The data were screened according to the criteria of minor allele frequency (MAF) less than 0.05 and genotype missing rate more than 10%. A total of 27,206,170 high-quality SNP sites were screened out, which will be used for subsequent GWAS analysis.

[0073] This study used mixed linear model analysis (MLM) in gemma software for genome-wide association analysis. First, using PLINK software (https: / / www.cog-genomics.org / plink2), the VCF file containing the variant sites generated by population variation testing was converted into a bed file. This conversion of the variant site information facilitates subsequent analysis. The previously generated vase aging phenotypic data was then organized into a fam format file, followed by kinship analysis. Finally, the MLM model was used to analyze the association between the variant site and the target trait. The calculation formula is: Y = Xβ + Zu + e phenotypic value, where X is the fixed-effect design matrix, Z is the random-effect design matrix, β is the estimated fixed-effect coefficient, u is the random-effect coefficient, and e is the error term.

[0074] Virus-induced gene silencing (VIGS) To construct a VIGS silencing vector, a RhNADP-LIKE specific fragment (approximately 400 bp) was constructed into the pTRV2 vector and then transformed into Agrobacterium tumefaciens GV3101. This was mixed with Agrobacterium carrying pTRV1 at a 1:1 ratio by volume and used to infect rose tissue culture seedlings that had been rooting for two weeks. Plants infected with the empty pTRV2 vector served as controls. After one month of growth, RNA was extracted from young leaves to assess silencing efficiency. The flower opening cycle of the RhNADP-LIKE transiently transformed strains was further observed.

[0075] Fluorescence quantitative PCR analysis Total RNA was extracted from rose petals using the hot borate method, following laboratory protocols. First-strand cDNA was synthesized using 1 μg of total RNA as a template using the HiScript IIQ RT SuperMix for qPCR (Cat. R123-01, Vazyme) Reverse Transcription Kit. qRT-PCR reactions (20 μL volume containing 1 μL of cDNA template) were performed using the StepOne Real-Time PCR System (Applied Biosystems) and the KAPA SYBRFAST Universal qRT-PCR Kit (Kapa Biosystems).

[0076] Results and Analysis Genome-wide association analysis to screen candidate genes for organ senescence in roses This experiment primarily tested vase senescence in 358 tetraploid rose germplasm resources, counting the number of days from the second-level flower opening to the onset of senescence phenotypes. Most roses showed senescence durations of 5-6 days, while a few lasted for more than 10 days.

[0077] The resequencing data of 358 tetraploid rose germplasm resources and the haploid genomes pre-assembled by two laboratories were used to identify 27,206,170 SNP sites. These sites were used to conduct genome-wide association analysis using the MLM model using GEMMA software. For the phenotype of vase time, the GWAS analysis results are as follows: Figure 1 As shown in the Manhattan plot, only one site, Chr2B:82316215, located in the promoter of the SMT2B602100 gene, showed a C-to-A mutation. Within the GWAS association interval, the gene SMT2B602100, which is highly associated with rose vase lifespan, is RhNADP-LIKE. It is a key coenzyme involved in cellular energy metabolism and redox reactions. NADP-LIKE promotes the accumulation of reactive oxygen species (ROS), affecting the blooming time of roses.

[0078] In a third aspect of an embodiment of the present application, a specific primer pair is provided for regulating the rose flower aging gene RhNADP-LIKE, the primer pair comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer being shown in SEQ ID NO:4, and the nucleotide sequence of the reverse primer being shown in SEQ ID NO:5.

[0079] Forward primer: 5′-SEQ ID NO:4-3′; GCTCTTTGGGCCTCATGACT Reverse primer: 5′-SEQ ID NO:5-3′; GCATGCAGCCTCCAACTTTC The primer pair specifically amplifies the coding region CDS or regulatory region of the RhNADP-LIKE gene and is used for detecting, silencing or quantifying the expression of the gene.

[0080] The primers and RhNADP-LIKE gene sequences used are shown in Table 1.

[0081] Table 1

[0082] Example 4 The present invention provides a VIGS vector for silencing and regulating the flower senescence gene RhNADP-LIKE, comprising a specific fragment regulating the flower senescence gene RhNADP-LIKE, wherein the nucleotide sequence of the specific fragment is shown in SEQ ID NO: 3.

[0083] Example 5 The present invention provides a method for preparing a rose plant with an extended flowering period, comprising the following steps: a) Select tetraploid rose core germplasm resources as starting materials; b) constructing a virus-induced gene silencing (VIGS) vector comprising a RhNADP-LIKE gene-specific fragment, wherein the nucleotide sequence of the specific fragment is shown in SEQ ID NO: 3; c) transforming the VIGS vector from step b) into Agrobacterium GV3101 and mixing it with Agrobacterium carrying the pTRV1 vector at a ratio of 1:1 to obtain an infection solution; d) injecting the rooted rose tissue culture seedlings with the infection solution described in step c), and simultaneously infecting plants with the empty vector pTRV2 as a control; e) incubating the infected plants at a temperature of 21-23°C, a photoperiod of 8 hours dark / 16 hours light, and 60% humidity for 15-20 days to promote gene silencing; f) Screening for plants with significantly reduced RhNADP-LIKE gene expression to obtain rose plants with extended flowering and delayed petal senescence. The rose germplasm resources are 358 core tetraploid rose collections.

[0084] Example 6 The invention discloses an application of a flower senescence regulating gene RhNADP-LIKE in cultivating rose varieties with extended flowering period.

[0085] Example 7 The invention discloses an application of a flower senescence regulating gene RhNADP-LIKE in developing a preservative for extending the shelf life of cut roses.

[0086] Example 8 The invention discloses an application of a flower aging regulating gene RhNADP-LIKE in regulating flower aging and vase life in Rosaceae plants, wherein the Rosaceae plants are roses.

[0087] Test Example 1 Analysis of RhNADP-LIKE gene expression at different blooming stages of roses To analyze the spatiotemporal expression specificity of the RhNADP-LIKE gene, qRT-PCR was used to detect the expression levels of the RhNADP-LIKE gene in petals of grades 0, 1, 2, 3, 4, 5, and 6 during the opening process of rose 'Samantha'. The results showed that the expression level of the RhNADP-LIKE gene was high in grade 0, reached the highest level in grade 1 flowers, and gradually decreased as the flowers opened ( Figure 2 The significant decrease of RhNADP-LIKE during petal senescence suggests that it may be involved in regulating the senescence of rose petals.

[0088] Test Example 2 Effects of RhNADP-LIKE silencing on the flowering period of roses NADP is mainly involved in the energy metabolism and redox reaction of cells. It is a key coenzyme. NADP-LIKE can promote the accumulation of reactive oxygen species (ROS). Considering that RhNADP-LIKE was screened out in the aging phenotype of rose agronomic traits in GWAS analysis, we speculate that it may be involved in regulating the opening duration of roses and the aging process of petals. In order to further explore the specific function of RhNADP-LIKE in the flowering and aging process of roses, the TRV2-RhNADP-LIKE vector was constructed, and the 'Samantha' tissue culture seedlings were used as materials to transiently silence the RhNADP-LIKE gene in roses using VIGS technology. The outermost petals were collected at the 5th-level flowering period for subsequent RNA extraction to test the gene silencing efficiency and conduct reliability analysis. The results showed that the expression of RhNADP-LIKE in the silenced plants was significantly reduced ( Figure 3 ), indicating that the RhNADP-LIKE gene silencing effect is sufficient to support subsequent conclusions.

[0089] Fifteen silenced and control lines were selected, and their phenotypes were observed and the flowering process was recorded. The opening time of rose flowers from S2 (flowers are teardrop-shaped and sepals are fully open) to S6 (petals wilt or fall off) was observed and recorded continuously. The results showed that compared with the TRV control, silencing RhNADP-LIKE can prolong the entire flowering period of roses and delay flower senescence ( Figure 4 , Figure 5 ).

[0090] Test Example 3 Effect of silencing the RhNADP-LIKE gene on ROS levels ROS is considered to be the earliest signal that affects the natural aging of organs. The present invention detected the ROS levels in TRV control plants and TRV2-RhNADP-LIKE silenced plants. The petals of TSA-treated plants were chemically stained with NBT and DAB to detect the O2- and H2O2 contents, respectively. After DAB staining, the more H2O2 accumulated, the darker the brown color; after NBT staining, the more O2- accumulated, the darker the blue color. The results showed that compared with the TRV control, the DAB and NBT staining intensities of the petals of the RhNADP-LIKE silenced plants were lighter (Figure 6), indicating that the RhNADP-LIKE silenced plants contained lower O2 − and H2O2 levels.

[0091] Roses are important cut flower varieties with high economic value, but they have a short vase life and are prone to aging, which directly affects sales and consumer experience. Therefore, studying their aging mechanisms and extending their shelf life has always been a hot topic in the field of post-harvest rose research. Reverse genetics studies have shown that rose petal aging is regulated by the plant hormones auxin and ethylene. However, the mechanism of rose aging process analyzed by forward genetics GWAS is still unclear. This study identified a gene highly correlated with rose vase life through genome-wide association analysis, NADP-LIKE ( Figure 1 ), indicating that NADP-LIKE may be involved in the aging process of roses and play an important role in the vase life. In order to further explore whether NADP-LIKE is involved in regulating petal aging, a virus-induced gene silencing experiment found that compared with TRV control plants, RhNADP-LIKE silenced plants showed a prolonged flower opening cycle and flowering period. After silencing RhNADP-LIKE, the time for petals to open from S2 to S6 was significantly prolonged, about 2 days. In addition, the DAB and NBT staining intensities of the petals of the RhNADP-LIKE silenced plants were lighter (Figure 6), indicating that the RhNADP-LIKE silenced plants contain lower O2 − and H2O2 levels.

[0092] In summary, transient silencing of NADP-LIKE in the present invention prolongs the opening cycle and flowering period of rose flowers. RhNADP-LIKE affects rose flower senescence by regulating ROS levels. In other words, RhNADP-LIKE may affect petal senescence by regulating ROS accumulation. The primers used in the experiment and the NADP-LIKE gene sequence are shown in Table 1.

[0093] The basic principles, main features and advantages of the present invention are shown and described above. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and improvements may be made to the present invention without departing from the spirit and scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims, the description and their equivalents.

Claims

1. A gene that regulates flower aging RhNADP-LIKE , characterized in that: The gene regulating flower senescence RhNADP- LIKE The nucleotide sequence is shown in SEQ ID NO:

1.

2. The flower aging regulating gene according to claim 1 RhNADP-LIKE The encoded protein has an amino acid sequence as shown in SEQ ID NO:

2.

3. A gene for regulating rose flower senescence according to claim 1 RhNADP-LIKE The specific primer pair is characterized by: The primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

5.

4. A method for extending the vase life of Chinese roses, characterized by: By reducing or blocking the gene regulating flower aging according to claim 1 RhNADP-LIKE expression, reducing the accumulation of reactive oxygen species (ROS), thereby delaying the aging of rose flowers.

5. A gene regulating flower aging according to claim 1 based on genome-wide association analysis RhNADP-LIKE The screening method is characterized in that The steps include: a) Collect vase life phenotypic data of rose germplasm resources; b) performing whole genome resequencing on the rose germplasm resources to obtain SNP sites; c) Perform genome-wide association studies (GWAS) using mixed linear models (MLM) to screen for SNPs significantly associated with vase life. d) Identifying genes regulating flower aging located in the region of the SNP site RhNADP-LIKE , and verified its function of regulating the accumulation of reactive oxygen species (ROS).

6. A method for silencing the flower aging regulating gene according to claim 1 RhNADP-LIKE The VIGS vector is characterized by: Contains the gene regulating flower aging RhNADP-LIKE A specific fragment, the nucleotide sequence of which is shown in SEQ ID NO:

3.

7. A method for preparing rose plants with extended flowering period, characterized in that The steps include: a) Select tetraploid rose core germplasm resources as starting materials; b) constructing a virus-induced gene silencing (VIGS) vector comprising a RhNADP-LIKE gene-specific fragment, wherein the nucleotide sequence of the specific fragment is shown in SEQ ID NO: 3; c) transforming the VIGS vector from step b) into Agrobacterium GV3101 and mixing it with Agrobacterium carrying the pTRV1 vector in a ratio of 1:1 by volume to obtain an infection solution; d) injecting the rooted rose tissue culture seedlings with the infection solution described in step c), and simultaneously infecting plants with the empty vector pTRV2 as a control; e) incubating the infected plants at a temperature of 21-23°C, a photoperiod of 8 hours dark / 16 hours light, and 60% humidity for 15-20 days to promote gene silencing; f) Screening plants with significantly reduced RhNADP-LIKE gene expression to obtain rose plants with extended flowering period and delayed petal senescence.

8. The flower senescence regulating gene according to claim 1 RhNADP-LIKE Application in breeding rose varieties with extended flowering period.

9. The flower senescence regulating gene according to claim 1 RhNADP-LIKE Application in the development of preservatives for extending the shelf life of cut roses.

10. The flower senescence regulating gene according to claim 1 RhNADP-LIKE Application of the invention in regulating flower aging and vase life in Rosaceae plants, characterized by: The Rosaceae plant is a rose.

Images