Detection primer and probe for amylooosperm whipstock and application of detection primer and probe for amylooosperm whipstock

Abstract

The invention belongs to the technical field of microbiological detection, and particularly relates to a primer and a probe for detecting amylooosperm whipstock and application of the primer and the probe. In allusion to the SSSUrRNA gene of the amylooosperms, the invention designs the real-time fluorescent quantitative PCR detection primer and probe based on the probe method, the detection sensitivity of the real-time fluorescent quantitative PCR detection primer and probe to the target gene is 6.60 copies / reaction, and the real-time fluorescent quantitative PCR detection primer and probe have the advantages of rapid detection and strong specificity, and can be used for the detection and quantitative analysis of the amylooosperms of non-disease diagnosis and treatment purposes.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial detection, and particularly relates to detection primers and probes for eyespot starchy egg whipworm and applications thereof. Background Art

[0002] Eyespot starch egg Whippleworm ( Amyloodiniumocellatum Since it was first reported in 1931, it has become one of the important parasitic pathogens that seriously endanger marine aquaculture fish. It can infect fish including leopard gill bass ( Plectropomus leopardus )、Pearl Gentian Grouper( Epinephelus fuscoguttatus♀× E.lanceolatus♂ )、Big yellow croaker( Larimichthys crocea )、Spotted rock snapper( Oplegnathus punctatus ), Oval Pomfret ( Trachinotusovatus )、Redfin pufferfish( Takifugu rubripes ),turbot( Scophthalmus maximus ) and yellow croaker ( Nibea albiflora ) etc. Early and accurate diagnosis of the pathogen is crucial for effective prevention and control. Current detection methods for Trichuris tachyphyllus have the following technical drawbacks: Enzyme-linked immunosorbent assay (ELISA) and conventional PCR based on immunological detection techniques suffer from long detection times and low sensitivity; reported detection methods based on loop-mediated isothermal amplification (LAMP) cannot achieve quantitative analysis of the pathogen; and dye-based quantitative PCR based on SYBR Green I is limited in its ability to indiscriminately bind to various nucleic acids in the assay (such as primer dimers, single-stranded secondary structures, or nonspecific amplification products), thereby affecting the specificity of the test results and the accuracy of the pathogen's quantitative analysis.

[0003] Based on the probe-based quantitative PCR method, the 5' and 3' ends of the probe are labeled with a fluorescent reporter and quencher group, respectively, which can provide more specific and sensitive results in detection than the dye method. The Taqman-MGB probe is a new type of probe. Compared with the TaqMan probe, its 3' end adds a minor groove binder (MGB) that can insert into the minor groove of DNA. By increasing the probe Tm value, the specificity of the detection results is effectively enhanced; the 3' end is labeled with a non-fluorescent quencher (NFQ) that can effectively quench the signal generated by the fluorescent reporter group at the 5' end, thereby reducing the fluorescent background signal and further improving the sensitivity of the detection. In view of the serious harm caused by the eyespot starch egg whipworm to the marine fish farming industry and the industry's urgent need for sensitive, specific and rapid diagnosis of this pathogen, the present invention provides for the first time the pathogen detection primers and probes based on the Taqman-MGB probe and their application methods. Summary of the Invention

[0004] The invention aims to provide primers and probes for detecting eyespot starchy egg whipworms, and also provides application methods of the primers and probes.

[0005] The detection primers and probes for eyespot starchy egg whipworm of the present invention include three sets of fluorescent quantitative PCR detection primers and probes, the nucleotide sequences of which are as follows: Nucleotide sequences of the first set of primers and probes: 1) Primer 1: Ao _SSU_F: 5'-GGTGATTCATGATAACCGTACGAA-3', as shown in SEQ ID NO: 1; 2) Primer 2: Ao _SSU_R: 5′-TCGGAAGCTGATAGGTCAGAAAC-3′, as shown in SEQ ID NO: 2; 3) Probe: Ao _SSU_Probe: 5′-CGCATGATCTCAATCG-3′, as shown in SEQ ID NO: 3; The nucleotide sequences of the second set of primers and probes are: 1) Primer 1: Ao _SSU_F: 5′-TCGACGGAAGGGTTGTGTTTA-3′, as shown in SEQ ID NO: 4; 2) Primer 2: Ao _SSU_R: 5'-GCGATTCGTACGGTTATCATGA-3', as shown in SEQ ID NO: 5; 3) Probe: Ao _SSU_Probe: 5'-CAACCCAAGTCCTCG-3', as shown in SEQ ID NO: 6; The nucleotide sequences of the third set of primers and probes are: 1) Primer 1: Ao _SSU_F: 5'-GCTTCCGACGGTAGGGTATTG-3', as shown in SEQ ID NO: 7; 2) Primer 2: Ao _SSU_R: 5'-AGGCTGCCTCTCCGGAAT-3', as shown in SEQ ID NO: 8; 3) Probe: Ao _SSU_Probe: 5'-TGGCACTGACGGGTAA-3', as shown in SEQ ID NO: 9.

[0006] The primers and probe are designed based on the conserved nucleotide sequence of the small subunit ribosomal rRNA (SSUrRNA) gene of Trichuris fasciatus, and the nucleotide sequence is: TCGACGGAAGGGTTGTGTTTATTAGTTACAGAACCAACCCAAGTCCTCGGACTTGGTCCTTTGGTGATTCATGATAACCGTACGAATCGCATGATCTCAATCGGCGATAGATCATTCAAGTTTCTGACCTATCAGCTTCCGACGGTAGGGTATTGGCCTACCGTGGCACTGACGGGTAACGGAGAATTAGGGTTCGATTCCGGAGAGGCAGCCT, as shown in SEQ ID NO: 10.

[0007] The primers and probes for detecting eyespot starchy eggs Whipworm can be used for the detection and quantitative analysis of eyespot starchy eggs Whipworm for non-disease diagnosis and treatment purposes, including for preparing detection reagents or kit products.

[0008] When performing fluorescent quantitative PCR, primers and probes can be used simultaneously, or only primers can be used. When using a probe, the 5' and 3' ends of the probe are labeled with a fluorescent reporter and a fluorescent quencher, respectively. Preferably, the probe is a Taqman-MGB probe, modified with 6-carboxyfluorescein (6-FAM) at the 5' end and MGB (minor groove binder)-NFQ (nonfluorescent quencher) at the 3' end. When using only primers without a probe, a chimeric fluorescent dye must also be added to the detection system.

[0009] The final concentrations of the primers and probes in the detection system are 0.1-0.8 μmol / L and 0.1-0.5 μmol / L, respectively, preferably 0.1 μmol / L and 0.2 μmol / L.

[0010] The reaction program of fluorescence quantitative PCR is as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s; 58-63°C (preferably 60°C) for 30-34 s, for 40 cycles.

[0011] Test Result Interpretation and Analysis: In the absence of contamination in the negative control, positive samples will exhibit an amplification curve in fluorescent quantitative PCR using a probe; in fluorescent quantitative PCR without a probe, positive samples will exhibit an amplification curve and a single-peak melting curve. For pathogen quantitative analysis, the pathogen load in a sample can be calculated based on the quantitative analysis standard curve (the linear relationship between the logarithmic value (x) of the target gene copy number in the recombinant plasmid standard and its corresponding threshold cycle number (Ct value) (y)) and the Ct value of the test sample.

[0012] In particular, in the fluorescent quantitative PCR detection based on Taqman-MGB probe, the linear expression of the first set of primers and probes is y=-3.155x+40.68.

[0013] Compared with the prior art, the present invention has the following beneficial effects: High detection sensitivity: The detection sensitivity of 6.60 copies / reaction for the target gene is superior to other reported detection methods, and can be used for early diagnosis and early warning of starchy egg whipworms in marine fish eyes; Rapid and quantitative detection: The reaction can be completed within 1 hour and can provide accurate analysis results of the pathogen load in the fish; High detection specificity: There is no cross-reaction with other pathogens of various other fishery aquaculture organisms in the test. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 , Taqman-MGB fluorescence quantitative PCR amplification curve of eyespot starch egg Whipple disease; Figure 2 , Taqman-MGB fluorescence quantitative PCR standard curve of eyespot starch egg Whipple worm; Figure 3 , amplification curves of sensitivity evaluation of Taqman-MGB fluorescence quantitative PCR of eyespot starch egg whipworm using tissue nucleic acid as template; Figure 4 , gel electrophoresis diagram of sensitivity evaluation of conventional PCR for eyespot starch egg whipworm using tissue nucleic acid as template; Figure 5 , amplification curve of the fluorescent quantitative specific detection of eyespot starch egg whipworm TaqMan-MGB probe. DETAILED DESCRIPTION

[0014] To further illustrate the method and effects of the present invention, the present invention is further described below with reference to the following examples. Unless otherwise specified, the drugs and materials used in the following examples are commercially available.

[0015] Example 1: Design of primers and probes for detection of eyespot starchy eggs of Trichuris trichuris Based on the sequencing and sequence alignment analysis results of the SSUrRNA gene of the collected eyespot starch egg whipworm, three sets of fluorescence quantitative PCR detection primers and probes were designed. The nucleotide sequences are as follows: Nucleotide sequences of the first set of primers and probes: 1) Primer 1: Ao _SSU_F:5'-GGTGATTCATGATAACCGTACGAA-3', 2) Primer 2: Ao _SSU_R:5'-TCGGAAGCTGATAGGTCAGAAAC-3', 3) Probe: Ao _SSU_Probe: 5'-CGCATGATCTCAATCG-3'; The nucleotide sequences of the second set of primers and probes are: 1) Primer 1: Ao _SSU_F: 5'-TCGACGGAAGGGTTGTGTTTA-3', 2) Primer 2: Ao _SSU_R: 5'-GCGATTCGTACGGTTATCATGA-3', 3) Probe: Ao _SSU_Probe:5'-CAACCCAAGTCCTCG-3'; The nucleotide sequences of the third set of primers and probes are: 1) Primer 1: Ao _SSU_F:5'-GCTTCCGACGGTAGGGTATTG-3', 2) Primer 2: Ao _SSU_R:5'-AGGCTGCCTCTCCGGAAT-3', 3) Probe: Ao _SSU_Probe:5'-TGGCACTGACGGGTAA-3'.

[0016] In particular, taking the first set of Taqman-MGB fluorescent quantitative PCR detection primers and probes as an example, further description is given of their application in the detection of eyespot starchy eggs of Trichuris trichuris.

[0017] Example 2: Construction of Eyespot Starch Egg Whipworm Fluorescence Quantitative PCR Recombinant Plasmid Standard Design of standard primers based on the SSUrRNA gene of Trichuris spp. Ao _F (5'-ATGTTCCAGCATAAACTTCT-3', as shown in SEQ ID NO: 11) and Ao _R (5'-TTCTTGTCACTACCTCCCT-3', as shown in SEQ ID NO: 12). The PCR system was 10 μmol / L Ao _F and Ao _R 0.5 μL each, Premix Taq ™ Ex Taq ™ Version 2.0) (TaKaRa, Dalian) 12.5 μL, template 1 μL, and sterile water 10.5 μL. The PCR program was 95°C for 5 minutes, followed by 35 cycles of 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 30 seconds, followed by an extension at 72°C for 8 minutes. The resulting 429 bp PCR product was gel-purified and ligated into the pMD18-T vector (TaKaRa, Dalian) to obtain the recombinant plasmid standard pMD18_ Ao , and transformed into Escherichia coli ( Escherichia coli ) in DH5α competent cells. The concentration of the target gene was calculated by measuring the concentration of the extracted nucleic acid from the standard.

[0018] Example 3: Optimization of primers and probes for detecting eyespot starchy eggs in fluorescent quantitative PCR Take the application of the first set of primers and probes of the present invention as an example.

[0019] Quantitative detection reagents used ProTag HS premixed probe qPCR kit (Hunan Aikerui Bioengineering Co., Ltd.). Optimization of primers and probes in the detection system: Primers in the system Ao _SSU_F / Ao The final concentrations of _SSU_R were 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, and 0.8 μmol / L, respectively. Ao The final concentrations of _SSU_Probe were 0.1, 0.2, 0.3, 0.4, and 0.5 μmol / L, respectively. Pro Taq10 μL of HS Probe Premix (2×) and 1 μL of DNA template were added, and the mixture was made up to 20 μL with ddH2O. Reaction temperature optimization was performed at 58, 59, 60, 61, 62, and 63°C. Detection was performed in an Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific, USA). The initial amplification protocol consisted of 40 cycles of pre-denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, and reaction at 60°C for 30 s. Based on analysis of factors such as Ct values, increase in fluorescence intensity (ΔRn), and reagent costs, the optimal final concentrations of primers and probes were determined to be 0.1 μmol / L and 0.2 μmol / L, respectively, with a detection temperature of 60°C. This optimized result was used in subsequent assays.

[0020] Example 4: Standard curve, detection sensitivity and repeatability evaluation of fluorescent quantitative PCR method (1) Standard curve and detection sensitivity The recombinant plasmid standard product pMD18_ obtained in Example 2 Ao The nucleic acid DNA was diluted 10-fold using EASY Dilution (Takara, Dalian) to 6.60 × 10 0 -6.60×10 9 The quantitative detection results using this as a template showed that the detection sensitivity was 6.60 copies / reaction. Figure 1 , where 1-10: templates are 6.60×10 9 , 6.60×10 8 , 6.60×10 7 , 6.60×10 6 , 6.60×10 5 , 6.60×10 4 , 6.60×10 3 , 6.60×10 2 , 6.60×10 1 and 6.60×10 0 copies / μL of pMD18_ Ao , 11: negative control, 12: blank control; the linear expression of the logarithm of the target gene copy number (x) and the Ct value (y) is y=-3.155x+40.68, R 2 =0.997, E=107.495%( Figure 2 ).

[0021] The detection sensitivity of the present invention was compared with that of the conventional PCR method. The template used was 10-fold serial dilution of the DNA of the gill tissue of large yellow croaker positive for eyespot starch egg whipworm, with the concentrations of 189 ng / μL, 18.9 ng / μL, 1.89 ng / μL, 189 pg / μL and 18.9 pg / μL, respectively. The conventional PCR method was based on the method described by Levy et al. (Levy MG, Poore MF, Colorni A, Noga EJ, Vandersea MW, Litaker RW. A highly specific PCR assay for detecting the fishectoparasite Amyloodinium ocellatum .Dis Aquat Organ. 2007, 73(3):219-26.) and Picón-Camacho et al. (Picón-Camacho SM, Thompson WP, Blaylock RB, Lotz JM. Development of arapid assay to detect the dinoflagellate Amyloodinium ocellatum The conventional PCR method used was loop-mediated isothermal amplification (LAMP). Vet Parasitol. 2013, 196 (3-4): 265-71. The detection primer F was GACCTTGCCCGAGAGGG, as shown in SEQ ID NO: 13, and the primer R was GTGTTAAGATTCACCACACTTTCC, as shown in SEQ ID NO: 14. The amplification program was 94°C for 5 min, [94°C for 30 s, 58°C for 30 s, 72°C for 30 s] × 35, and 72°C for 5 min. PCR was performed using 2× Accurate Taq premix reagent (Hunan Aikerui Biotechnology Co., Ltd.). Figure 3 and Figure 4 In the sensitivity test shown, 1-5: templates are positive nucleic acids of 189ng / μL, 18.9ng / μL, 1.89ng / μL, 189pg / μL and 18.9pg / μL respectively, 6: negative control, 7: blank control. The quantitative PCR method of the first set of detection primers and probes of the present invention can detect all the samples in the above five gradients ( Figure 3 ), the minimum detection concentration of conventional PCR method is 18.9ng / μL tissue DNA ( Figure 4 ), that is to say, the detection sensitivity of the present invention is 1000 times higher than that of the conventional PCR method.

[0022] (2) Repeatability evaluation The recombinant plasmid standard pMD18_ was diluted in 10-fold gradient Ao (Concentration is 6.60×10 0 -6.60×10 9 The repeatability of the Taqman-MGB fluorescent quantitative PCR detection method based on the first set of primers and probes of the present invention was evaluated using 1000 copies / μL of PCR products as a template, with three replicates for each gradient. The intra-assay and inter-assay coefficients of variation ranged from 0.05% to 1.95% and 0.64% to 2.33%, respectively (Table 1), indicating that the Taqman-MGB fluorescent quantitative PCR detection method based on the first set of primers and probes of the present invention can provide stable and reliable quantitative detection and analysis results.

[0023] Table 1 Repeatability test results of Taqman-MGB fluorescence quantitative PCR for Trichuris tachyphylli

[0024] Example 5: Evaluation of detection specificity of fluorescent quantitative PCR method The pathogens used in the test are shown in Table 2. The nucleic acid of the gill tissue of yellow croaker positive for eyespot starch egg whipworm was used as a template as a positive control, the nucleic acid of the gill tissue of healthy yellow croaker was used as a template as a negative control, and ddH2O was used as a template as a blank control. The specificity of the Taqman-MGB fluorescence quantitative PCR detection method based on the first set of primers and probes of the present invention was tested, and the test was repeated three times. The test results are shown in FIG. Figure 5 The pathogen nucleic acids corresponding to the amplification curve numbers in the figure are shown in Table 2, 18: negative control, 19: blank control. The results show that the detection primers and probes of the present invention have no cross-reactions with other pathogens in the detection, and can provide specific detection results of eyespot starch egg whipworm.

[0025] Table 2 Pathogens used in specific detection

[0026] Example 6: Clinical sample detection application The Taqman-MGB fluorescent quantitative PCR detection method with the first set of primers and probes of the present invention and the conventional PCR method described in Example 4 were used to detect 36 clinical samples of diseased large yellow croaker tissues (Table 3). The positive detection rate of the conventional PCR method was 33.3%, while the positive detection rate of the fluorescent quantitative PCR detection method of the present invention was 91.7%. The pathogen load of each tissue was between 1.80×10 1 -9.02×10 4 This result also shows that the detection sensitivity of the present invention for clinical samples is significantly higher than that of the conventional PCR method, and can provide the results of pathogen quantitative analysis.

[0027] Table 3 Comparison of fluorescent quantitative PCR and conventional PCR detection of clinical samples of Trichuris tachyphylla

Claims

1. A primer and probe for detecting eyespot starch egg whipworm, characterized in that: It includes 3 sets of fluorescent quantitative PCR detection primers and probes, whose nucleotide sequences are as follows: Nucleotide sequences of the first set of primers and probes: 1) Primer 1: Ao _SSU_F: 5'-GGTGATTCATGATAACCGTACGAA-3', 2) Primer 2: Ao _SSU_R: 5’-TCGGAAGCTGATAGGTCAGAAAC-3’, 3) Probe: Ao _SSU_Probe: 5'-CGCATGATCTCAATCG-3'; The nucleotide sequences of the second set of primers and probes are: 1) Primer 1: Ao _SSU_F: 5’-TCGACGGAAGGGTTGTGTTTA-3’, 2) Primer 2: Ao _SSU_R: 5'-GCGATTCGTACGGTTATCATGA-3', 3) Probe: Ao _SSU_Probe:5'-CAACCCAAGTCCTCG-3'; The nucleotide sequences of the third set of primers and probes are: 1) Primer 1: Ao _SSU_F: 5'-GCTTCCGACGGTAGGGTATTG-3', 2) Primer 2: Ao _SSU_R:5'-AGGCTGCCTCTCCGGAAT-3', 3) Probe: Ao _SSU_Probe:5'-TGGCACTGACGGGTAA-3'.

2. Use of the primers and probes for detecting eyespot starchy eggs of Trichuris trichuris according to claim 1 in the detection and quantitative analysis of eyespot starchy eggs of Trichuris trichuris for non-disease diagnosis and treatment purposes.

3. The use according to claim 2, characterized in that: When performing the assay, primers and probes are used together or primers alone are used.

4. The use according to claim 2, wherein: The 5' end of the probe is modified with a fluorescent reporter group 6-FAM, and the 3' end is modified with a fluorescent quencher group MGB-NFQ.

5. The use according to claim 2, characterized in that: The final concentrations of primers and probes in the detection system are 0.1-0.8 μmol / L and 0.1-0.5 μmol / L, respectively.

6. The use according to claim 2, characterized in that: Including products used to prepare detection reagents or test kits.

Images