Application of strigolactone GR24 or induced protein CsJIP-like thereof in improving cold resistance of tea trees

Abstract

The invention relates to the technical field of plant stress resistance regulation and control and the field of plant genetic engineering, in particular to application of strigolactones GR24 or induced protein CsJIP-like thereof in improving cold resistance of tea trees, a strigolactones GR24 solution is sprayed to the tea trees, the relative conductivity of the tea trees and the content of malondialdehyde, hydrogen peroxide and superoxide anions can be reduced, and the cold resistance of the tea trees can be improved. The activity of superoxide dismutase, peroxidase, catalase and ascorbic acid peroxidase in the tea trees is improved, the oxidative stress of the tea trees is relieved, the integrity of cell membranes is protected, cell osmotic equilibrium is maintained, and dehydration damage caused by low temperature is avoided; screening a cold-resistant gene CsJIP-like responding to GR24, and verifying that the cold-resistant gene CsJIP-like has a cold-resistant function by utilizing instantaneous overexpression and instantaneous silencing of tea tree leaves; the GR24 is high in chemical stability, small in application amount, environmentally friendly and beneficial to promoting the genetic improvement process of cold resistance of the tea trees.

Description

Technical Field

[0001] The present invention relates to the technical field of plant stress resistance regulation and the field of plant genetic engineering, and in particular to an application of strigolactone GR24 or its induced protein CsJIP-like in improving the cold resistance of tea plants. Background Art

[0002] tea tree( Camellia sinensis Tea (L.) O. Kuntze is an important economic crop in my country. Low temperatures are one of the main abiotic stresses affecting tea yield and distribution. Low temperatures can cause frost damage to tea plants, manifesting as damage to leaves, branches, and even roots. This impacts physiological metabolic processes such as photosynthesis and respiration, leading to reduced enzyme activity and increased levels of reactive oxygen species. In severe cases, it can even cause tea plant death, becoming a key environmental factor restricting the development of the tea industry.

[0003] Currently, a variety of technologies are being applied to help tea trees withstand cold weather. Agricultural measures include improving tea trees' cold tolerance through appropriate fertilization and increased use of phosphorus and potassium fertilizers; timely pruning to remove frozen branches and promote new shoot germination; and mulching for insulation, such as using straw or plastic film to cover the base of tea trees or the ground to reduce root damage caused by low temperatures. Physical protection measures include building windbreaks and using smoke to prevent frost, which improve the microclimate in tea gardens and mitigate the effects of low temperatures. Biotechnology is being used to select and breed cold-resistant tea varieties, cultivating varieties with strong cold tolerance through hybrid breeding and other methods. While effective, agricultural measures and physical protection methods require significant manpower, material, and financial resources. For example, mulching for insulation requires timely laying and recycling of mulch, which is labor-intensive; and smoke to prevent frost can cause some environmental pollution and is difficult to implement in large-scale tea gardens. Regarding variety selection, traditional hybrid breeding processes have long cycles and low efficiency, making it difficult to quickly meet the demand for cold-resistant varieties in production. Summary of the Invention

[0004] In view of the shortcomings of the above-mentioned prior art, the present invention aims to provide an application of strigolactone GR24 or its induced protein CsJIP-like in improving the cold resistance of tea plants. On the one hand, exogenous spraying of GR24 can solve the problems of large workload and complicated procedures in the cold resistance of tea plants; on the other hand, CsJIP-like The gene can be used as a new molecular marker for cold-resistant breeding of tea trees, and the cold-resistant ability of tea trees can also be improved through gene overexpression technology.

[0005] The technical solution of the present invention is: The invention relates to the use of strigolactone GR24 or its induced protein CsJIP-like in improving the cold resistance of tea plants. The structural formula thereof is shown in Formula I, and the amino acid sequence of the induced protein CsJIP-like is shown in SEQ ID No. 2.

[0006] Furthermore, the strigolactone GR24 reduces REL, MDA, H2O2 and O2 ·－ The content of glutathione can improve the activity of SOD, POD, CAT and APX enzymes.

[0007] A method for improving the cold resistance of tea trees comprises spraying the strigolactone GR24 solution on the tea trees or increasing the expression of the induced protein CsJIP-like.

[0008] Furthermore, the spraying time is before 4°C low temperature stress, and the concentration of the strigolactone GR24 solution is 0.05~1.5 μmol·L -1 .

[0009] Furthermore, the concentration of the strigolactone GR24 solution is 0.5 μmol·L -1 .

[0010] The application of the CsJIP-like gene in improving the cold resistance of tea plants, the nucleotide sequence of the CsJIP-like gene is shown in SEQ ID No. 1.

[0011] A vector for improving the cold resistance of tea plants, comprising the CsJIP-like gene.

[0012] An engineered bacterium for improving the cold resistance of tea plants, comprising the above-mentioned vector.

[0013] Application of the inducible protein CsJIP-like, the CsJIP-like gene, the vector, or the engineered bacteria in preparing an agent for improving the cold resistance of tea plants.

[0014] Compared with the prior art, the present invention has the following beneficial effects: The synthetic strigolactone analog GR24 is chemically stable and exhibits long-lasting effects under field conditions. As a plant-derived signaling molecule derivative, it significantly activates cold-resistance pathways at extremely low concentrations (micromolar), reducing application costs and avoiding the risk of residual effects from traditional chemical cold-resistance agents, such as ethephon.

[0015] At the same time, the present invention screened and cloned a gene that responds to both low temperature and GR24 signals. CsJIP-like gene, and verified that this gene is directly involved in the cold resistance process of tea trees, which provides new ideas for the cold resistance mechanism of tea trees and also provides new genetic resources for the design and breeding of cold-resistant molecules of tea trees. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1The figures show the effects of exogenous spraying of different concentrations of strigolactone GR24 on the physiological indicators of tea plants under low temperature stress; A is the effect on relative electrical conductivity (REL); B is the effect on malondialdehyde (MDA) content; C is the effect on proline (PRO) content.

[0017] Figure 2 The effects of exogenous spraying of strigolactone GR24 and melatonin MT on the physiological parameters of tea plants under low temperature stress; A is the effect of relative electrical conductivity (REL); B is the effect of malondialdehyde (MDA) content; C is the effect of hydrogen peroxide (H2O2) content; D is the effect of superoxide anion (O2 .- ) content; E is the effect on superoxide dismutase (SOD) activity; F is the effect on peroxidase (POD) activity; G is the effect on catalase (CAT) activity; H is the effect on ascorbic acid peroxidase (APX) activity.

[0018] Figure 3 for CsJIP-like Analysis of gene expression patterns and tissue specificity in different spraying treatments.

[0019] Figure 4 Transient overexpression in tea leaves CsJIP-like Analysis of cold resistance.

[0020] Figure 5 The tea leaves are momentarily silent CsJIP-like Analysis of cold resistance. DETAILED DESCRIPTION

[0021] The present invention will be further described in detail below with reference to specific embodiments.

[0022] It should be noted that these embodiments are only used to illustrate the present invention, rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention fall within the scope of protection claimed by the present invention.

[0023] The tea variety used in the following examples was Shuchazao, with a seedling size of about 20 cm in height, purchased from Anhui Niansheng Agriculture Co., Ltd. The hormone and index detection kits used in the examples were: Strigolactone GR24 (CAS No. 76974-79-3, Beijing Solarbio Technology Co., Ltd., molecular formula C 17 H 14 O5, molecular weight 298.29 g / mol, structural formula as shown in Formula I); melatonin MT (CAS No. 73-31-4, Shanghai Sangon Biotechnology Co., Ltd.); MDA and PRO content detection kits (Suzhou Geruisi Biotechnology Co., Ltd.); SOD, POD, CAT and APX enzyme activity detection kits and H2O2 and O2 ·－Content detection kit (Beijing Solarbio Technology Co., Ltd.).

[0024]

[0025] Formula I The pSESY-Blunt vector used in the following examples is a universal cloning vector and is commercially available; the pBTEX-HA overexpression vector is a vector preserved in the research group; the Escherichia coli strain DH-5α and the Agrobacterium tumefaciens GV3101 (pSoup-p19) strain are commonly used strains and are commercially available.

[0026] The enzymes and molecular biology kits used in the following examples were: TB Green Premix Ex Taq II quantitative enzyme (Tli RNaseH Plus) (Takara, Beijing, China), 5* PrimeScript™ RT Master Mix reverse transcriptase (Takara, Beijing, China), 2* PHanta® Max Master Mix (Dye Plus) high-fidelity enzyme (Vazyme, Nanjing, China), QuickCut KpnI digester and QuickCut StuI digester (Takara, Beijing, China); SteafyPurePlantRNAExtractionKit (Accurate Biology, Changsha, China), FastPureGelDNAExtractionMiniKit (Vazyme, Nanjing, China), and FastPurePlasmidMiniKit (Vazyme, Nanjing, China).

[0027] Example 1 The screening test for the optimal spraying concentration of strigolactone GR24 includes the following steps: Prepare 5 GR24 solutions with different concentrations: 0.05, 0.1, 0.5, 1.0, and 1.5 μmol·L -1 The experiment consisted of a 22°C control group and a 4°C low-temperature experimental group. Twenty tea seedlings of uniform growth and good growth were sprayed in each treatment. The control group was sprayed with distilled water, while the experimental groups were sprayed with equal amounts of distilled water and five different concentrations of GR24 solution. The entire seedling was sprayed until the solution dripped from the leaf margins. After spraying, the seedlings were moved to a 22°C or 4°C incubator, respectively. Relative conductivity (REL), malondialdehyde (MDA), and proline (PRO) were measured two days after treatment. Three biological replicates and six to nine technical replicates were used for each test.

[0028] from Figure 1It can be seen that compared with 4℃, the REL and MDA contents of tea seedlings after spraying GR24 decreased, and the PRO content increased, indicating that spraying GR24 before low temperature stress can improve the cold resistance of tea plants. -1 The three indicators of the treatment group showed good performance, while the effects of the three indicators after treatment with other concentrations of GR24 were unstable. Therefore, 0.5 μmol·L -1 This is the optimal spraying concentration for tea trees to resist cold.

[0029] Example 2 The comparative test on the cold resistance of tea trees after spraying GR24 and MT includes the following steps: The tea varieties, spraying degrees and treatment conditions used in this experiment were the same as those in Example 1. The experiment set up a 22℃ control group and a 4℃ experimental group. The control group was sprayed with distilled water, and the experimental groups were sprayed with the same amount of distilled water and 0.5 μmol·L -1 GR24, 100 μmol·L -1 After treatment, relative conductivity (REL), malondialdehyde (MDA), hydrogen peroxide (H2O2) and superoxide anion (O2 ·－ ) content, superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX) activities. The experiment also included three biological replicates and six to nine technical replicates.

[0030] Figure 2 The results showed that compared with the 4℃ treatment group, the REL, MDA, H2O2 and O2 ·－ The contents of the tea trees in the GR24 group were significantly reduced, while the activities of SOD, POD, CAT and APX enzymes were significantly increased. ·－ The contents of GR24 in tea plants were significantly lower than those in the MT group, while the activities of SOD, POD, CAT and APX were significantly higher than those in the MT group, indicating that the cold resistance of GR24 is better than that of MT. The above results show that foliar spraying of GR24 can increase the activities of SOD, POD, CAT and APX in tea plants, reduce the oxidative stress of tea plants and protect the integrity of cell membranes; at the same time, it can reduce the levels of REL, MDA and H2O2, O2 ·－ The content of MT maintains the cell osmotic balance and improves the cold resistance of tea trees. The cold resistance effect is more significant than spraying MT.

[0031] Example 3 A novel cold-resistance gene responsive to GR24 was screened and cloned from tea plants CsJIP-like ( Jasmonate- Induced Protein-like) gene, and verifying its cold-resistance function through transient overexpression experiments and antisense oligonucleotide experiments, including the following steps: 1. CsJIP-like Bioinformatics analysis First download it from the TPIA website CsJIP-like The protein sequence of the gene (SEQ ID No. 2, shown in Table 1) was imported into the Expasy website (https: / / web.expasy.org / protparam / ) to calculate various physical and chemical parameters of the gene. The protein was found to be hydrophilic, with a CDS of 525 bp, 174 amino acids, a molecular weight of 19001.79 Da, and an isoelectric point of 5.08 pI.

[0032] Table 1 Sequence Listing CsJIP-like Sequence SEQ ID No.1 ATGAATACTGTACCCGAAGCTCAGAATAAGGAAGAGTGTGACCCTGATGTCAGCACGCTTGTAAAGATTCACAATGAAACTGGGGCCACTATAACATATTTTACCAAACATGATTTTTCTGGGAAATTAGATAAACAGAGCACATATCCAGCCAAAATAGAAAATGGCGAGTCCGATGTGTTTGAACATAAGGGAACTAGTGGAGAGAATACTGGATCGTGTGGAGCTGTTGTGTATTCGGTCAAAAACAAGGATGGGAAAGCCGGTCATTGGATGCTGTCTTGGTCCAACCCAACCAATGAGGACAATAAGGTCTTTACTGAGATTATTGGACCGGGTCACTATAAGCCAAACTCCAACGACCCTATTTGGGATCGTGTCCATGAAGAGTTGAGCAAGTCTGGCACCACCAGTGCATCTGAATGGAATGGTTGCGAGTCATCTATGACATCTATTCCTAGTAATGATATGAAAAACCGCGTAGATGTGGATGCAACAGTGACACTAGCCACAGCCAAGGCCTAA SEQ ID No.2 MNTVPEAQNKEECDPDVSTLVKIHNETGATITYFTKHDFSGKLDKQSTYPAKIENGESDVFEHKGTSGENTGSCGAVVYSVKNKDGKAGHWMLSWSNPTNEDNKVFTEIIGPGHYKPNSNDPIWDRVHEELSKSGTTSASEWNGCESSMTSIPSNDMKNRVDVDATVTLATAKA SEQ ID No.3CsJIP-like-qRT -F GGTCATTGGATGCTGTCTTGG SEQ ID No.4CsJIP-like-qRT-R GGGTCGTTGGAGTTTGGCTTA SEQ ID No.5 CsJIP-like-ORF-F ATGAATACTGTACCCGAAGCTC SEQ ID No.6 CsJIP-like-ORF-R TTAGGCCTTGGCTGTGGCTAG SEQ ID No.7 CsJIP-like-pBTEX-F ATTTGGAGAGGACAGGGTACCATGAATACTGTACCCGAAGCTC SEQ ID No.8 CsJIP-like-pBTEX-R AACGTCGTATGGGTAAGGCCTGGCCTTGGCTGTGGCTAG SEQ ID No.9 CsJIP-like-AS-1 TTTACAAGCGTGCTGACATC SEQ IDNo.10 CsJIP-like-AS-2 CTTTACAAGCGTGCTGACAT SEQ IDNo.11 CsJIP-like-AS-3 TATGTTATAGTGGCCCCAGT SEQ IDNo.12 CsJIP-like-S GGCGGCTAACGCTTCGA

[0033] 2. CsJIP-like Expression pattern analysis and tissue specificity analysis Samples of different expression and tissue types were placed in a mortar and ground into powder using liquid nitrogen. Total RNA from tea plants was extracted using the SteafyPurePlant RNA Extraction Kit. Purity and concentration were then tested. Qualified RNA was reverse transcribed using 5* PrimeScript™ RT Master Mix Reverse Transcriptase to generate cDNA. Download the RNA from the TPIA website (https: / / tpia.teaplants.cn / index.html). CsJIP-like The nucleotide sequence of the cDNA was determined (SEQ ID No. 1), and qRT-PCR primers (SEQ ID No. 3 & SEQ ID No. 4) were designed using snapgene software. qRT-PCR detection was then performed using cDNA as a template.

[0034] Figure 3 Middle A shows that after low temperature treatment CsJIP-like The relative expression of the gene increased by 1.45 times, indicating that CsJIP-like The gene expression level in the GR24 and MT treatment groups increased significantly, indicating that CsJIP-like It positively responded to GR24 and MT, and the expression level in response to GR24 was higher. Figure 3 Middle B shows, CsJIP-like The gene is highly expressed in mature and old leaves such as three-leaf, four-leaf, and five-leaf, and the expression level is about 10 to 20 times higher than that in tissues such as buds and young leaves.

[0035] 3. Transient Overexpression in Tea Leaves CsJIP-like Improve the cold resistance of tea trees After designing ORF-PCR primers (SEQ ID No.5 & SEQ ID No.6) using snapgene software, the PCR products were prepared according to the instructions of 2*PHanta® Max Master Mix (Dye Plus). CsJIP-like Gene PCR amplification. After amplification, perform agarose gel electrophoresis, excise the correct band, recover the product, and ligate it into the pSESY-Blunt vector. Initially screen positive colonies using kanamycin (Kan) medium. Select a single colony for streaking, expand it, and perform colony PCR verification. Positive colonies with the correct band are selected for sequencing. Plasmids from the correct single strain are extracted using the FastPure® Plasmid Mini Kit and stored at -20°C.

[0036] Design homology arm primers, primers are shown in SEQ ID No.7 and SEQ ID No.8, and construct transient transformation by homologous recombination method CsJIP-like -pBTEX vector (restriction site is KpnI and StuI ) and transformed into Agrobacterium GV3101 (pSoup-p19) for propagation and colony PCR verification and stored in a -80°C ultra-low temperature freezer.

[0037] Select tea seedlings with uniform growth for transgenic testing. Use a syringe to inject the infection solution into the 4th to 5th leaves of the tea plant, and then place it in a 22℃ incubator for 2 days. After 2 days, place the positive plants in a 0℃ incubator for 12 hours, take samples and test CsJIP- like Relative gene expression, MDA, H2O2 and O2 ·－ Each treatment group was set up with 3 biological replicates and 6 to 9 technical replicates.

[0038] Figure 4 It showed that after 2 days of bacterial infection, CsJIP-like The expression of REL, MDA content, H2O2 content and O2 ·－ The contents decreased significantly, indicating that overexpression CsJIP-like The gene can improve the cold resistance of tea trees by reducing ROS and alleviating cell membrane damage.

[0039] 4. Tea tree leaves are silent CsJIP-like Improve the cold resistance of tea trees Designed using the Sfold website (https: / / sfold.wadsworth.org / cgi-bin / index.pl) CsJIP-like Antisense oligodeoxynucleotide (asODN) of the gene was selected and Blast alignment of the asODN was performed on the TPIA website. AsODNs with high specificity and no special structural regions were selected as transient silencing primers. Universal primers were used for the sense nucleotide sequence (sODN). The specific primers are shown in SEQ ID No. 9 to SEQ ID No. 12.

[0040] The test was conducted by selecting tea seedlings with consistent growth. The three antisense oligonucleotide primers were diluted to 10 μM, and then mixed in a ratio of 1:1:1. The primers were then injected into the 4th and 5th leaves of the tea plants, and then placed in a 22°C incubator for 24 hours. After 24 hours, the positive plants were placed in a 0°C incubator for 12 hours, and samples were taken and tested. CsJIP- like Relative gene expression, MDA, H2O2 and O2 ·－ Each treatment group was set up with 3 biological replicates and 6 to 9 technical replicates.

[0041] Figure 5 Display, after 24 hours of silence CsJIP-like Compared with 0℃ sODN, the MDA content, H2O2 content and O2 ·－ The contents increased significantly, indicating that CsJIP-like The tea tree accumulates more ROS and the cell membrane damage increases, which indicates that CsJIP-like Genes can improve the cold resistance of tea trees.

[0042] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes can be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A use of strigolactone GR24 or its induced protein CsJIP-like in improving the cold resistance of tea plants, wherein the amino acid sequence of the induced protein CsJIP-like is shown in SEQ ID No.

2.

2. The use according to claim 1, characterized in that The strigolactone GR24 reduces REL, MDA, H2O2 and O2 ·－ The content of glutathione can improve the activity of SOD, POD, CAT and APX enzymes.

3. A method for improving the cold resistance of tea plants, characterized in that: Spraying the strigolactone GR24 solution according to claim 1 on tea trees or increasing the expression of the induced protein CsJIP-like.

4. The method for improving the cold resistance of tea plants according to claim 3, wherein: The spraying time is before 4°C low temperature stress, and the concentration of the strigolactone GR24 solution is 0.05-1.5 μmol·L -1 .

5. The method for improving the cold resistance of tea plants according to claim 4, wherein: The concentration of the strigolactone GR24 solution is 0.5 μmol·L -1 .

6. Application of CsJIP-like gene in improving cold resistance of tea plant, characterized in that: The nucleotide sequence of the CsJIP-like gene is shown in SEQ ID No.

1.

7. A carrier for improving the cold resistance of tea plants, characterized in that The method comprises the CsJIP-like gene described in claim 6.

8. An engineered bacterium for improving the cold resistance of tea plants, characterized in that: Comprising the vector of claim 7.

9. Use of the inducible protein CsJIP-like according to claim 1, the CsJIP-like gene according to claim 6, the vector according to claim 7, or the engineered bacteria according to claim 8 in the preparation of an agent for improving the cold resistance of tea plants.

Images