A genetically engineered bacterium that produces high levels of L-alanine, its construction method, and its applications.
By dynamically regulating the TCA cycle and glycolysis process, and utilizing an oxygen-sensitive promoter and heterologous alanine dehydrogenase, the problem of carbon metabolism imbalance in the synthesis of L-alanine by microbial fermentation has been solved, achieving efficient L-alanine production suitable for the pharmaceutical, food additive, and green chemical industries.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-01
- Publication Date
- 2026-07-17
AI Technical Summary
In the existing technology for synthesizing L-alanine by microbial fermentation, the oxidative phosphorylation module affects the glycolysis pathway, leading to an imbalance in carbon metabolism, accumulation of byproducts, insufficient synergy between production intensity and cell physiological state, and difficulty in achieving dynamic balance of metabolic flux.
By using an oxygen-sensitive self-inducible promoter to dynamically regulate the TCA cycle and glycolysis process, and by knocking out key genes in the byproduct pathway and integrating heterologous alanine dehydrogenase or its mutants, a genetically engineered strain that produces high levels of L-alanine was constructed. The metabolic flux was then regulated by oxygen factors under different oxygen conditions.
It improved the yield and conversion rate of L-alanine, achieving efficient L-alanine production. The fermenter production reached 151 g/L with a conversion rate of over 95%, showing promising prospects for industrial application.
Smart Images

Figure CN120738089B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of genetic engineering, specifically to a genetically engineered bacterium that produces high levels of L-alanine, its construction method, and its application. In particular, it relates to a genetically engineered bacterium that produces high levels of L-alanine by dynamically regulating the TCA cycle and glycolysis process using an oxygen-sensitive self-inducible promoter, thereby directing the central carbon metabolism to the L-alanine synthesis pathway, its construction method, and its application. Background Technology
[0002] L-Alanine, an important amino acid, is widely used in pharmaceuticals, food additives, daily chemicals, and green chemicals (such as methylglycine diacetic acid, MGDA). In recent years, with the surge in demand for environmentally friendly chelating agents and amino acid surfactants, the global market demand for L-alanine has continued to grow. It is predicted that its compound annual growth rate will remain between 12% and 22%. However, traditional chemical synthesis methods pose environmental pollution problems, and while enzymatic and fermentation methods are gradually becoming mainstream, further optimization is still needed to improve yield, conversion rate, and process economics.
[0003] Currently, microbial fermentation mainly achieves efficient L-alanine synthesis through genetic engineering of strains such as *Escherichia coli* and *Corynebacterium glutamicum*. For example, metabolic engineering involves knocking out genes related to the synthesis of byproducts (such as acetic acid, lactic acid, and succinic acid) and introducing exogenous alanine dehydrogenase genes (alaD) to enhance the L-alanine synthesis pathway (CN 117736948). Analysis of the metabolic pathway reveals that under aerobic conditions, the TCA cycle is active, and cell growth is vigorous, but carbon flux is easily diverted to biomass synthesis, competing with L-alanine production. While limited or anaerobic conditions can promote the conversion of pyruvate to L-alanine, they inhibit cell growth, prolong the fermentation cycle, and the accumulation of byproducts such as succinic acid is difficult to avoid. In addition, the oxidative phosphorylation module affects the synthesis of ATP, which in turn affects the activity of multiple regulatory enzymes in the EMP pathway of glycolysis. Excessive ATP accumulation will inhibit carbon metabolism in the EMP pathway, thereby reducing the supply of pyruvate (Tb. C, Zhou S, Kt. S, et al. Engineering the metabolism of Escherichia coli W3110 for the conversion of sugar toredox-neutral and oxidized products: Homoacetate production [J]. Proceedings of the National Academy of Sciences of the United States of America, 2003, 100(3): 825-832.). Existing technologies mostly use static metabolic modification, resulting in insufficient synergy between production intensity and the physiological state of the bacteria, making it difficult to achieve dynamic balance of metabolic flux (Shen Tong, Xu Qingyang, et al. Effect of ppc gene knockout on L-tryptophan fermentation in Escherichia coli [J]. Biotechnology Communications, 2013, 24(6): 4.).
[0004] FNR and ArcA transcription factors exhibit different morphologies under different oxygen conditions. In aerobic environments, oxygen binds to FNR and ArcA, rendering them inactive. However, in anaerobic environments, they can bind to specific sequences in promoters, thereby regulating the transcription and expression of downstream genes (Jiang Fengwei. Study on the regulatory mechanism of global regulatory factors ArcA and FNR on the virulence of pathogenic Escherichia coli [D]. Nanjing Agricultural University, 2018.). Utilizing the characteristics of FNR and ArcA can achieve a dynamic balance of metabolic flux, which is beneficial for the allocation of metabolic flux in glucose metabolism pathways, the TCA cycle, and the L-alanine pathway.
[0005] Therefore, it is of great significance to construct an engineered strain that can dynamically regulate the metabolic network using oxygen factors and produce high levels of L-alanine. Summary of the Invention
[0006] To address the aforementioned problems, this invention provides a method for constructing a high-yield L-alanine synthesis pathway in Escherichia coli by dynamically regulating oxygen factors, thereby strengthening the synthetic pathway, reducing byproduct accumulation, and increasing L-alanine production. The dynamic regulation of oxygen factors is based on the changes in oxygen concentration during the aerobic and anaerobic fermentation stages. It utilizes an oxygen-sensitive self-inducible promoter to dynamically regulate the TCA cycle and glycolysis process, causing the central carbon metabolism to flow towards the L-alanine synthesis pathway.
[0007] To solve the above problems, the technical solution adopted in this application is:
[0008] The present invention describes a genetically engineered bacterium that produces high levels of L-alanine, using Escherichia coli as the starting strain and expressing heterologous alanine dehydrogenase (alaD) or an alanine dehydrogenase mutant.
[0009] As a preferred embodiment of this application, the alanine racemase gene dadX is knocked out in the *Escherichia coli*, and a heterologous coding sequence for alanine dehydrogenase or a mutant alanine dehydrogenase is integrated and expressed at the knockout site.
[0010] As a preferred embodiment of this application, the heterologous alanine dehydrogenase is selected from at least one of the following:
[0011] (a) The source is Bacillus subtilis, whose amino acid sequence is shown in SEQ ID NO:1 and whose nucleotide sequence is shown in SEQ ID NO:6;
[0012] (b) The source is Lysinibacillus, whose amino acid sequence is shown in SEQ ID NO:2 and whose nucleotide sequence is shown in SEQ ID NO:7;
[0013] (c) Derived from Geobacillus stearothermophilus, whose amino acid sequence is shown in SEQ ID NO:3 and whose nucleotide sequence is shown in SEQ ID NO:8;
[0014] (d) Derived from Bacillus pumilus, whose amino acid sequence is shown in SEQ ID NO:4 and whose nucleotide sequence is shown in SEQ ID NO:9;
[0015] (e) The source is *Rummeliibacillus*, whose amino acid sequence is shown in SEQ ID NO:5 and whose nucleotide sequence is shown in SEQ ID NO:10.
[0016] As a preferred embodiment of this application, the heterologous alanine dehydrogenase has ≥80% identity with any of the amino acid sequences shown in SEQ ID NO:1~5 or any of the nucleotide sequences shown in SEQ ID NO:6~10 and retains alanine dehydrogenase activity.
[0017] As a preferred embodiment of this application, the alanine dehydrogenase is derived from Bacillus lysine, and its amino acid sequence is shown in SEQ ID NO:2, and its nucleotide sequence is shown in SEQ ID NO:7.
[0018] As a preferred embodiment of this application, the alanine dehydrogenase variant is obtained by single or multiple mutations at positions 18, 75, 77, 78, 140, 198, 266, 351, and 352 of the amino acid sequence shown in SEQ ID NO:2, wherein the mutations include at least one of the following mutation sites:
[0019] (1) The 18th amino acid is replaced by alanine, isoleucine and leucine;
[0020] (2) The 75th amino acid is replaced by alanine and lysine;
[0021] (3) The 77th amino acid is replaced by alanine and leucine;
[0022] (4) The 78th amino acid is replaced by proline and serine instead of alanine;
[0023] (5) The 140th amino acid is replaced by serine instead of alanine;
[0024] (6) The 198th amino acid is replaced by alanine, valine, and isoleucine;
[0025] (7) The amino acid at position 266 is replaced by alanine and valine;
[0026] (8) The amino acid at position 351 is replaced by alanine and valine;
[0027] (9) The amino acid at position 352 is replaced by alanine and phenylalanine.
[0028] As a preferred embodiment of this application, the alanine dehydrogenase variant is obtained by simultaneously mutating positions 18, 75, 78, and 266 of the amino acid sequence shown in SEQ ID NO:2, and has the amino acid sequence shown in SEQ ID NO:11; and / or is a protein encoded by the nucleotide sequence shown in SEQ ID NO:12.
[0029] As a preferred embodiment of this application, one or more key genes of the byproduct pathway are knocked out or weakened in the *Escherichia coli*, and a heterologous coding sequence of alanine dehydrogenase or an alanine dehydrogenase mutant is integrated and expressed at one or more knockout sites.
[0030] As a preferred embodiment of this application, the key genes for the byproduct pathway include, but are not limited to, one or more of the following: lactate dehydrogenase gene ldhA, pyruvate formate lyase gene pflB, alcohol dehydrogenase gene adhE, acetate kinase gene ackA, acetyltransferase gene pta, pyruvate oxidase gene poxB, and alanine racemic enzyme gene dadX.
[0031] This invention also provides a method for constructing a genetically engineered bacterium that produces high levels of L-alanine, characterized by comprising:
[0032] Using Escherichia coli as the starting strain, the endogenous alanine racemase gene dadX was knocked out;
[0033] The knockout site integrates and expresses the coding sequence of a heterologous alanine dehydrogenase or an alanine dehydrogenase mutant;
[0034] Single or multiple copies of alanine dehydrogenase or alanine dehydrogenase mutants are expressed.
[0035] As a preferred embodiment of this application, unless otherwise specified, CRISPR-Cas9 gene editing technology is used to knock out key genes in the byproduct pathway of Escherichia coli genome.
[0036] As a preferred embodiment of this application, the construction method further includes:
[0037] Knock out or weaken at least one of the key genes in the byproduct pathway of L-alanine synthesis in the Escherichia coli genome; the key genes in the byproduct pathway include, but are not limited to, one or more of lactate dehydrogenase ldhA, pyruvate formate lyase pflB, alcohol dehydrogenase adhE, acetate kinase ackA, acetyltransferase pta, and pyruvate oxidase poxB.
[0038] The coding sequence of a heterologous alanine dehydrogenase or an alanine dehydrogenase mutant is integrated into one or more knockout sites.
[0039] As a preferred embodiment of this application, the construction method further includes integrating an oxygen-sensitive self-inducible promoter system for dynamically regulating the TCA cycle and glycolysis process to direct central carbon metabolism toward the L-alanine synthesis pathway; wherein, the oxygen-sensitive self-inducible promoter system comprises:
[0040] Oxygen-sensitive self-inducible promoter Pomp: contains the nucleic acid sequence shown in SEQ ID NO:13, and is used to dynamically drive the expression of phosphoenolpyruvate carboxylase ppc;
[0041] Oxygen-sensitive self-inducible promoter mutant Pomp*: Contains the nucleic acid sequence shown in SEQ ID NO:14, for dynamically driving the expression of phosphoenolpyruvate carboxylase (ppc); and / or
[0042] The oxygen factor-sensitive self-inducible promoter PgltA contains the nucleic acid sequence shown in SEQ ID NO:15 and is used to dynamically drive the expression of ATP synthase (ATPase).
[0043] This application introduces an oxygen-sensitive self-inducible promoter to dynamically regulate the TCA cycle and glycolysis process, increasing the supply of the key precursor pyruvate and improving L-alanine production. The key enzyme element regulating the TCA cycle is phosphoenolpyruvate carboxylase, whose expression is dynamically inhibited by the oxygen-sensitive self-inducible promoter. Similarly, the key enzyme element regulating oxidative phosphorylation in glycolysis is ATP synthase, whose expression is dynamically inhibited by the oxygen-sensitive self-inducible promoter.
[0044] The genetically engineered bacterium that produces high levels of L-alanine described in this invention is deposited at the China Center for Type Culture Collection (CCTCC) on May 14, 2025, under the accession number CCTCC NO: M20251052, at Wuhan University, Wuhan, China.
[0045] The present invention also provides a genetically engineered bacterium that produces high levels of L-alanine, or the application of the genetically engineered bacterium constructed by the construction method in the production of L-alanine.
[0046] As a preferred embodiment of this application, the application includes at least one of the following:
[0047] L-alanine was produced by shake flask fermentation, with a yield of ≥15 g / L after 12 h of fermentation.
[0048] L-alanine was produced by fermentation in a fermenter, with a yield of ≥150 g / L after 48 h of fermentation.
[0049] The present invention also provides a method for producing L-alanine by fermentation, comprising:
[0050] Step 1) Seed culture: Genetically engineered bacteria that produce high levels of L-alanine are inoculated into LB liquid medium and cultured overnight with shaking at 37 ℃ and 200 rpm to obtain seed culture;
[0051] Step 2) Fermentation culture: Inoculate the seed liquid into fermentation medium one or fermentation medium two at a volume ratio of 1~10% (v / v), control the fermentation conditions, and carry out L-alanine fermentation culture to obtain fermentation broth.
[0052] In the fermentation production of L-alanine, this invention employs multiple fermentation cultures, with an inoculum size of 1-10% (v / v) for each fermentation culture.
[0053] As a preferred embodiment of this application, the LB liquid culture medium consists of: 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride.
[0054] As a preferred embodiment of this application, the fermentation medium consists of: 25 g / L glucose, 15 g / L corn steep liquor powder, 2 g / L potassium dihydrogen phosphate, 10 g / L ammonium sulfate, 1.5 g / L magnesium sulfate, and 2 g / L trace elements.
[0055] Alternatively, the fermentation medium can be composed of two components: 5% glucose, 0.5% magnesium sulfate, 3% corn steep liquor powder, 2% yeast extract, 0.2% potassium dihydrogen phosphate, and 0.2% trace elements.
[0056] As a preferred embodiment of this application, the fermentation conditions used in the fermentation medium are as follows: aerobic culture at 37 ℃ and 200 rpm for 2 h, followed by sealing the culture flask, adjusting the pH to 7.0 with ammonia water every 2 h, and then anaerobic fermentation at 37 ℃ and 200 rpm for 12 h.
[0057] As a preferred embodiment of this application, the fermentation conditions used when using fermentation medium two are as follows: cultured at 37 ℃, 200 rpm, and an aeration rate of 1 vvm for 8 h, followed by the addition of 60% (mass fraction) glucose solution, and then anaerobic fermentation with the aeration turned off for 48 h.
[0058] As a preferred embodiment of this application, when the genetically engineered bacteria have not integrated the oxygen-sensitive self-inducible promoter system, fermentation medium one is selected, and the fermentation conditions are: aerobic culture at 37 ℃ and 200 rpm for 2 h, then the culture flask is sealed, and the pH is adjusted to 7.0 with ammonia water every 2 h, and anaerobic fermentation is carried out at 37 ℃ and 200 rpm for 12 h; the yield after 12 h of fermentation is greater than or equal to 15 g / L;
[0059] When the genetically engineered bacteria integrate the oxygen-sensitive self-inducible promoter system, and fermentation medium II is selected, the fermentation conditions are as follows: culture at 37 ℃, 200 rpm, and an aeration rate of 1 vvm for 8 h, add 60% glucose solution, shut off aeration for anaerobic fermentation, and the yield after 48 h of fermentation is greater than or equal to 150 g / L.
[0060] Compared with the prior art, the beneficial effects of this application are:
[0061] 1. This patent breaks through the bottleneck of existing static metabolic modification by using a strategy of dynamically regulating metabolic pathways through oxygen factor-sensitive promoters, providing an efficient solution for the industrial production of L-alanine, and opening up new pathways for the biomanufacturing of other amino acids and high-value-added chemicals.
[0062] 2. This application constructs a recombinant *E. coli* strain capable of producing L-alanine from glucose by screening for sources of L-alanine dehydrogenase and overexpressing the screened L-alanine dehydrogenase gene in *E. coli*. Based on this, by knocking out genes related to byproducts, multiple copies of L-alanine dehydrogenase are integrated. Furthermore, an oxygen-sensitive self-inducible promoter is used to dynamically regulate the TCA cycle and glycolysis process, directing central carbon metabolism towards the L-alanine synthesis pathway. All of these methods can further increase L-alanine production.
[0063] 3. Using the genetically engineered bacteria provided in this application to produce L-alanine in a fermenter, the yield is greater than 151 g / L and the conversion rate is greater than 95%, which has good prospects for industrial application. Attached Figure Description
[0064] Figure 1 This is a schematic diagram of the modified L-alanine metabolic pathway in Escherichia coli.
[0065] Figure 2 A schematic diagram of the expression cassette for inserting a heterologous alanine dehydrogenase into the Escherichia coli genome.
[0066] Figure 3 The shake-flask yields of alanine dehydrogenases from different sources are shown in one embodiment of this application.
[0067] Figure 4 This refers to the yield in a 5 L fermenter of a genetically engineered bacterium with multiple copies of alanine dehydrogenase in one embodiment of this application.
[0068] Figure 5 This is a schematic diagram of an oxygen factor-sensitive self-inducible promoter in one embodiment of this application.
[0069] Figure 6 This is a fermentation process curve of a high-yield L-alanine engineered bacterium in one embodiment of this application. Detailed Implementation
[0070] The following specific examples illustrate the implementation of this application. Those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this specification. This application can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of this application.
[0071] It should be noted that the process equipment or apparatus not specifically mentioned in the following embodiments are all conventional equipment or apparatus in the art.
[0072] Furthermore, it should be understood that the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, does not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, unless otherwise stated. It should also be understood that the combined connection relationship between one or more devices / apparatus mentioned in this invention does not preclude the existence of other devices / apparatus before or after the combined devices / apparatus, or the insertion of other devices / apparatus between these explicitly mentioned devices / apparatus, unless otherwise stated. Moreover, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or limiting the scope of the invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the invention.
[0073] Furthermore, the technical solution of the invention is illustrated below through specific examples. It should be understood that, to ensure the uniformity of the experiments, the sodium sulfadiazine, activated carbon, pharmaceutical process water, and acetic acid used in each example all come from the same batch. Moreover, it should be specifically noted that the numbering of each method step is not only a convenient tool for identifying each method step, but also restricts the order of the examples, with the aim of verifying the feasibility of continuous recycling in actual production processes.
[0074] Unless otherwise specified, this application employs CRISPR-Cas9 gene editing technology to knock out key genes in the aforementioned byproduct pathway. The CRISPR-Cas9 gene editing technology is described in Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genomeediting [J]. Metabolic Engineering, 2015, 31:13-21.
[0075] In this application, the PCR reaction system consists of: 25 μL 2×PhantaMax Buffer, 1 μL dNTP, 1 μL PhantaMax DNA polymerase, 1 μL (10 μM) each of forward and reverse primers, 1 μL genomic template, and sterile water added to a total volume of 50 μL.
[0076] PCR program: 98 °C pre-denaturation for 5 min, 98 °C denaturation for 30 s, 56 °C annealing (annealing temperature varies with primer design temperature) for 30 s, 72 °C extension for 1.5 min (30 s extension for 1000 bp), for a total of 30 cycles; 72 °C extension for 5 min, 25 °C to terminate the program for 1 s.
[0077] In this application, the method for determining L-alanine is as follows: The chromatographic column is an Alltima 5μm Amino 4.6 mm*250 mm*5μm. The mobile phase is 0.5 mol / L potassium dihydrogen phosphate buffer: acetonitrile = 290:710, the flow rate is 1 mL / min, the injection volume is 10 μL, the UV detection wavelength is 205 nm, and the column temperature is 30 ℃.
[0078] In this application, the method for detecting organic acids is as follows: the chromatographic column is an Aminex HPX-87H 300mm*7.8mm*9μm column; the mobile phase is 5 mmol / L sulfuric acid solution; the flow rate is 0.6 ml / min; the injection volume is 10 μL; the column temperature is 60℃; and the detection wavelength is 210 nm.
[0079] Unless otherwise specified, the sugar-acid conversion rate (%) in this application = L-alanine production (g) / amount of glucose consumed (g) * 100%.
[0080] The LB liquid medium consists of: 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride.
[0081] One group of fermentation medium consisted of: 25 g / L glucose, 15 g / L corn steep liquor powder, 2 g / L potassium dihydrogen phosphate, 10 g / L ammonium sulfate, 1.5 g / L magnesium sulfate, and 2 g / L trace elements.
[0082] The fermentation medium consists of two components: 5% glucose, 0.5% magnesium sulfate, 3% corn steep liquor powder, 2% yeast extract, 0.2% potassium dihydrogen phosphate, and 0.2% trace elements.
[0083] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where conditions are not specified, reference should be made to the guidelines given in this application, or to experimental manuals or conventional conditions in the art, or to the conditions recommended by the manufacturer, or to experimental methods known in the art.
[0084] Example 1: Knockout of alanine racemic enzyme and screening of heterologous wild-type alanine dehydrogenase
[0085] 1. Knock out the alanine racemase dadX in the E. coli genome and simultaneously integrate and express a heterologous wild-type alanine dehydrogenase;
[0086] The amino acid sequences of alanine dehydrogenases from Bacillus subtilis, Lysinibacillus, Geobacillus stearothermophilus, Bacillus pumilus, and Rummeliibacillus were searched and downloaded from the NCBI database as shown in SEQ ID NO:1~5, and the nucleotide sequences as shown in SEQ ID NO:6~10, respectively.
[0087] In this embodiment, the primers used for constructing the N20 sequence of the PAM site in sgRNA, the upstream and downstream homologous arms of Donor DNA, the alanine dehydrogenase expression cassette, and plasmid linearization are shown in Table 1.
[0088] Table 1 Primers used in Example 1
[0089] Primer Sequence 5'-3' sg(dadX)-N20-F GTCCTAGGTATAATACTAGTGAAAGGACCGATCCTGATGCGTTTTAGAGCTAGAAATAG sg-N20-R ACTAGTATTATACCTAGGACTGAGCTAGCTG L-pTarget-F TCGAGTTCATGTGCAGCTCC L-pTarget-R GTAGGGATAACAGGGTAATAGATCTAAGC dadX-U-F TATTACCCTGTTATCCCTACATCCGCTGAAAGGCTACTCG dadX-U-R CGAAAGGGCCTCGTGATACGCTCGTTTCCTTAGCTGTGTGCG dadX-D-F CTCTCCTGAGTAGGACAAATACAGTGGGATGAATCGGTTGG dadX-D-R GGAGCTGCACATGAACTCGACACGCCGTCCACTAAAACAG alaD-F CGTATCACGAGGCCCTTTCG
[0090] Gene fragments were obtained through gene synthesis, and the Ptet promoter (nucleotide sequence as shown in SEQ ID NO:16) and the rrn T1 terminator (nucleotide sequence as shown in SEQ ID NO:17) were added upstream and downstream, respectively, to form a complete alanine dehydrogenase expression cassette.
[0091] The pTarget-sgRNA vector fragment, alanine dehydrogenase expression cassette, and upstream and downstream homologous arm fragments of Donor DNA were amplified by PCR reaction. The pTarget-sgRNA vector fragment, alanine dehydrogenase expression cassette, and upstream and downstream homologous arm fragments of Donor DNA were ligated using a one-step cloning ligase to obtain the gene editing tool plasmid pTarget-sgRNA(dadX)-Donor-alaD.
[0092] Gene editing tool plasmids were transformed into E. coli hosts containing pCas9. The alanine racemase gene dadX was knocked out using the CRISPR-Cas system, and a heterologous alanine dehydrogenase coding sequence was integrated to obtain the recombinant strain E. coli ΔdadX::Ptet-alaD. Bs (E.coli alaD1), E.coli ΔdadX::Ptet-alaD Lb (E.colialaD2), E.coli ΔdadX::Ptet-alaD Gs (E.coli alaD3), E.coli ΔdadX::Ptet-alaD Bp (E.coli alaD4), E.coli ΔdadX::Ptet-alaD Rb (E.coli alaD5).
[0093] 2. Screening for heterologous wild-type alanine dehydrogenase by shake-flask fermentation
[0094] Single colonies were picked from the plate and inoculated into 10 mL of LB liquid medium. The culture was incubated overnight at 37 °C and 200 rpm with shaking. A 2% inoculum was then transferred to 100 mL of fermentation medium. The culture was aerobically incubated at 37 °C and 200 rpm for 2 h, then the culture flask was sealed. The pH was adjusted to 7.0 with ammonia every 2 h. Anaerobic fermentation was then carried out at 37 °C and 200 rpm for 12 h, and the alanine yield was determined.
[0095] The results of shake-flask fermentation showed that the alanine dehydrogenase alaD from Bacillus lysinicus... Lb The strain E. coliala D2, after fermentation for 12 h, produced 10.8 g / L of L-alanine, demonstrating superior conversion ability compared to other alaD strains (see [link to article]). ).
[0096] Example 2 Expression and screening of alanine dehydrogenase mutants
[0097] 1. Construction of alanine dehydrogenase mutant:
[0098] Using molecular biology software for alaD Lb By docking the model with the pyruvate substrate, amino acids near the active pocket were selected, and alaD was analyzed and designed. LbThe mutants include 19 variants: M18A, M18I, M18L, E75A, E75K, V77A, V77L, A78P, A78S, A140S, L198A, L198V, L198I, I266A, I266V, T351A, T351V, Y352A, and Y352F. (The last part, "alaD," appears to be an unrelated fragment and is omitted from the translation.) Lb The sequence was ligated into the pET28a expression plasmid (Beijing Qingke Biotechnology Co., Ltd.), and the primers in Table 2 were used to perform PCR on pET28a-alaD. Lb After site-directed mutagenesis, the recombinant strain was obtained by digestion with DpnI and recovery using a DNA purification kit, and then transformed into Escherichia coli BL21 by heat shock. The correctness of the mutation site was verified by sequencing.
[0099] Table 2 Primers used in Example 2
[0100] GTTATTGATGCTAGTCCAGAACGTCTACGTC L-L198V-F GTTATTGATGTCAGTCCAGAACGTCTACGTC L-L198I-F GTTATTGATATTAGTCCAGAACGTCTACGTC L-L198-R ATCAATAACTGTTACGTCTGCTCCCA L-I266A-F GTTGTGGATGCCGCGATTGACCAAGG L-I266V-F GTTGTGGATGTGGCGATTGACCAAGG L-I266-R ATCCACAACAACAGAACCTGGTTG L-T351A-F GGGCATATTGCATATAAAGCGGTAGCAG L-T351V-F GGGCATATTGTATATAAAGCGGTAGCAG L-T351-R AATATGCCCCTCTAATGCATTCACAC L-Y352A-F GCATATTACTGCAAAAGCGGTAGCAGAAGC L-Y352F-F GCATATTACTTTTAAAGCGGTAGCAGAAGC L-Y352-R AGTAATATGCCCCTCTAATGCATTC
[0101] 2. alaD Lb Expression and screening of mutants
[0102] Single colonies were picked and inoculated into test tubes containing LB liquid medium containing Kan resistance (Kan concentration 50 μg / mL), and cultured overnight at 37 ℃ with shaking at 180 rpm. The activated seed culture was inoculated at a rate of 2% (v / v) into fresh LB liquid medium containing Kan resistance, and cultured at 37 ℃ with shaking at 180 rpm until the OD reached 0.6–0.8. 0.1 mM IPTG was added to the final concentration, and the culture was cultured at 28 ℃ with shaking at 180 rpm for 16 h. The culture was centrifuged at 4 ℃ and 8000 rpm for 10 min to collect the cells. The cells were resuspended in 0.1 M KPB (K₂HPO₄·3H₂O 13.92 g / L, KH₂PO₄ 5.62 g / L) buffer and sonicated using an ultrasonic cell disruptor (power: 45%, disrupt for 2 s, pause for 4 s) until the solution was clear. The cell disruption solution was then centrifuged at 8000 rpm. Centrifuge at low temperature for 10 min, and the resulting supernatant is the crude enzyme solution; the protein concentration of the crude enzyme solution is detected using a BCA kit (Jiangsu Kaiji Biotechnology Co., Ltd.).
[0103] Using pyruvate as a substrate, the activity of alanine dehydrogenase was determined by detecting the decrease in absorbance of NADH at 340 nm within 1 min. The assay system consisted of Tris-HCl buffer (100 mM, pH 9.0), 0.13 mM NADH, 5 mM pyruvate, 200 mM NH4Cl, and a crude enzyme working concentration of 2 g / L, with a total volume of 200 µL. Lb The relative activity results of the mutants are shown in Table 3. The results show that, relative to the wild type, the relative activities of the L-alanine dehydrogenase mutants M18L, E75A, A78S, L198I and I266V are 170.8%, 166.6%, 261.4%, 124.2% and 130.6%, respectively.
[0104] 3. alaD Lb Investigation of superposition of mutation sites and evaluation of yield of alanine dehydrogenase mutants
[0105] Using the primers in Table 2, pET28a-alaD Lb(M18L) Build alaD for templates Lb The superimposed mutants were transformed and sequenced to obtain the correct mutant gene sequence. After induction of expression and fragmentation, the decrease in absorbance of NADH at 340 nm within 1 min was measured in a 96-well plate to determine the activity of alanine dehydrogenase to the substrate. The results are shown in Table 3. Lb Mutant M18L / E75A / A78S / I266V (alaD) M The relative activity of the wild type was 428.4%.
[0106] Using gene editing tools to alaD M Integrating into E. coli ΔdadX, the recombinant strain E. coli ΔdadX::Ptet-alaD was obtained. M (E.coli alaD) M Shake-flask testing showed that the L-alanine yield was 13.4 g / L after 12 h of fermentation, which was 24.1% higher than that of E. coli alaD2.
[0107] Table 3 Relative activity of mutants
[0108]
[0109] Example 3 Construction of a high-yield L-alanine-producing strain with multiple copies of alanine dehydrogenase
[0110] To further increase alanine throughput and reduce byproduct accumulation, CRISPR-Cas9 gene editing technology was used to knock out genes related to the heteroacid pathway in *E. coli*, including lactate dehydrogenase ldhA, pyruvate-formate lyase pflB, alcohol dehydrogenase adhE, acetate kinase ackA, acetyltransferase pta, pyruvate oxidase poxB, and alanine racemic enzyme dadX. Simultaneously, alanine dehydrogenases from different sources were integrated into the genomic sites of one or more knocked-out genes to construct a high-L-alanine-producing recombinant *E. coli*: ΔadhEΔpta-ackAΔpoxBΔpflBΔldhAΔdadX::Ptet-alaD M (E.coliA-LB1), E.coli ΔadhEΔpta-ackAΔpoxBΔpflBΔldhA::Ptet-alaD M / ΔdadX::Ptet-alaD M (E.coli A-LB2), E.coli ΔadhEΔpta-ackAΔpoxB / ΔpflB::Ptet-alaD M / ΔldhA::Ptet-alaD M / ΔdadX::Ptet-alaD M (E.coli A-LB3), E.coli ΔadhEΔpta-ackAΔpoxB::Ptet-alaD M / ΔpflB::Ptet-alaD M / ΔldhA::Ptet-alaD M / ΔdadX::Ptet-alaD M (E.coli A-LB4) and E.coli ΔadhEΔpta-ackA::Ptet-alaD M / ΔpoxB::Ptet-alaD M / ΔpflB::Ptet-alaD M / ΔldhA::Ptet-alaD M / ΔdadX::Ptet-alaD M (E. coli A-LB5). In this embodiment, the primers used for constructing the N20 sequence of the PAM site in sgRNA, the upstream and downstream homologous arms of Donor DNA, the alanine dehydrogenase expression cassette, and plasmid linearization are shown in Table 4.
[0111] Table 4 Primers used in Example 3
[0112] Primer Sequence 5'-3' sg(adhE)-N20-F GTCCTAGGTATAATACTAGTGGACGCCGCGAAGATCATGTGTTTTAGAGCTAGAAATAG sg(pta-ackA)-N20-F GTCCTAGGTATAATACTAGTAGAAAGTGACGGATTTAACGGTTTTAGAGCTAGAAATAG sg(poxB)-N20-F GTCCTAGGTATAATACTAGTGACAGAGCCAGAACGTCAGGGTTTTAGAGCTAGAAATAG sg(pflB)-N20-F GTCCTAGGTATAATACTAGTAGAATGGTCATGTTCGGTTCGTTTTAGAGCTAGAAATAG sg(ldhA)-N20-F GTCCTAGGTATAATACTAGTCAATAACGTCGACCTTGACGGTTTTAGAGCTAGAAATAG adhE-U-F CTATTACCCTGTTATCCCTACTGCAGGCCGTGCCAGTC adhE-U-R TCAGTAGCGCTGTCTGGCAAC adhE-D-F TTGCCAGACAGCGCTACTGACATCTGCTCGAATACGAGAGTATAGT adhE-D-R GGAGCTGCACATGAACTCGAGGTCTGAATCACGGTTAGCTCC poxB-U-F TATTACCCTGTTATCCCTACCCCGGCTCCGTATATGGATT poxB-U-R CGAAAGGGCCTCGTGATACGGGCGATATAAGCTGCAACCG poxB-D-F AATGTGGATGAATTAATCCAATAAAAAGGGTGGCATTTCCCGTC poxB-D-R GGAGCTGCACATGAACTCGAGCTTCTTTCAGGTATTCCCGCG poxB-U-R1 GACGGGAAATGCCACCCTTTGGCGATATAAGCTGCAACCG poxB-D-F1 AAAGGGTGGCATTTCCCGTC pta-ackA-U-F TATTACCCTGTTATCCCTACGACAAAGACCGGGGCAAGG pta-ackA-U-R AGCTGCGGATGATGACGAGAAGAACTACCGCAGTTCAGAACC pta-ackA-D-F TCTCGTCATCATCCGCAGCT pta-ackA-D-R GGAGCTGCACATGAACTCGACCTGAGGTTAATCCTTCAAACGGG pta-ackA-U-R1 CGAAAGGGCCTCGTGATACGAGAACTACCGCAGTTCAGAACC pta-ackA-D-F1 CTCTCCTGAGTAGGACAAATTCTCGTCATCATCCGCAGCT pflB-U-F TATTACCCTGTTATCCCTACAGTATATGACCGCAAATGGTCAATG pflB-U-R ACACCTACCTTCTTAAGTGGATTT pflB-D-F AAATCCACTTAAGAAGGTAGGTGTCAGTACGTTTCAACTCGCTGA pflB-D-R GGAGCTGCACATGAACTCGACGCCGGAAGCGTTCATAAAG pflB-U-R1 CGAAAGGGCCTCGTGATACGACACCTACCTTCTTAAGTGGATTT pflB-D-F1 CTCTCCTGAGTAGGACAAATCAGTACGTTTCAACTCGCTGAC ldhA-U-F TATTACCCTGTTATCCCTACACAAGCAGAATCAAGTTCTACCG ldhA-U-R AGACTTTCTCCAGTGATGTTGAATCAC ldhA-D-F GTGATTCAACATCACTGGAGAAAGTCTTGCTGCGCATTCTGAAAG ldhA-D-R GGAGCTGCACATGAACTCGACCAGATTGCTTAAGTTTTGCAGCG ldhA-U-R1 CGAAAGGGCCTCGTGATACGAGACTTTCTCCAGTGATGTTGAATC ldhA-D-F1 CTCTCCTGAGTAGGACAAATTGCTGCGCATTCTGAAAGG
[0113] The results of shake-flask fermentation showed that the yield of E. coli A-LB1 was 15.3 g / L, compared to E. coli alaD. M The content of lactic acid, formic acid and acetic acid decreased significantly by 1.9 g / L (see Table 5), indicating that knocking out heteroacids helps to increase the yield of alanine.
[0114] Table 5 Results of shake-flask fermentation
[0115] Strain Yield g / L Lactic acid g / L Succinic acid g / L Acetic acid g / L Formic acid g / L <![CDATA[E.coli alaD M ]]> 13.4 1.04 1.37 1.72 0.83 E.coli A-LB1 15.3 0.33 1.48 0.51 0
[0116] Results from a 5 L fermenter showed that the average yield of three batches of E. coli A-LB4 was 133.3 g / L, an increase of 13.1 g compared to E. coli A-LB1 (see...). Figure 4 This shows that multiple copies of integrated alanine dehydrogenase are beneficial for increasing alanine production.
[0117] Example 4: Dynamic regulation of the TCA cycle by oxygen factor to reduce the accumulation of succinic acid byproduct.
[0118] 1. Construction of recombinant Escherichia coli strains with oxygen-sensitive promoters dynamically regulating the TCA cycle
[0119] Promoter genes and Donor DNA fragments were obtained through PCR amplification or gene synthesis. The linearized pTarget-sgRNA vector, upstream and downstream homologous arms of the Donor DNA, and promoter genes were ligated using a one-step cloning ligase to obtain tool plasmids for gene editing: pTarget-sgRNA(Pppc)-Donor-Pomp, pTarget-sgRNA(Pppc)-Donor-Pomp*, and pTarget-sgRNA(ppc)-Donor. Table 6 shows the N20 sequence of the PAM site in the sgRNA, the upstream and downstream homologous arms of the Donor DNA, the alanine dehydrogenase expression cassette, and the primers used for plasmid linearization. The tool plasmids were transformed into E. coli hosts containing pCas9. Using the CRISPR-Cas system, the promoter of the phosphoenolpyruvate carboxylase gene ppc was replaced or ppc was knocked out to obtain recombinant strains E. coli A-LB4 Pomp-ppc, E. coli A-LB4 Pomp*-ppc, and E. coli A-LB4 Δppc.
[0120] Table 6 Primers used in Example 4
[0121] Primer Sequence 5’-3’ sg(Pppc)-N20-F GTCCTAGGTATAATACTAGTTCAGCAAACGAATAAATAGCGTTTTAGAGCTAGAAATAG sg(ppc)-N20-F GTCCTAGGTATAATACTAGTGAACAACTGGAAGAGAACCTGTTTTAGAGCTAGAAATAG sg-N20-R ACTAGTATTATACCTAGGACTGAGCTAGCTG Pppc-U-F TATTACCCTGTTATCCCTACCAGCGATATCTTTGTTATCGAGCTG Pppc-U-R ATGAACGAACAATATTCCGCATTGC Pomp-F GCGGAATATTGTTCGTTCATATCCGCTCCGTCGTTATGG Pomp-R TATTTAAAAATTGATTTAAATCACATTAACCAGGATTCTCAATG Pppc-D-F TTAAAAAATCGCCCCAAGTAACACC Pppc-D-R GGAGCTGCACATGAACTCGAGTTGGGGCCTGGCTCAATTA Pppc-U-F1 TATTACCCTGTTATCCCTACGTTGGGTGAGCCGTGAGGA Pppc-U-R1 TCACGTTTTTATAACCATGCAAAGCCCGAGCATATTCGCG Pomp*-F ATGGTTATAAAAACGTGACGAATATACCCT Pomp*-R CGCAGCATTTGACGTCACCG Pppc-D-F1 TTTAAATCAATTTTTAAATACGCTTTAAATAAGCGTAACTTATGGAAATG Pppc-D-R1 GGAGCTGCACATGAACTCGAGGCTCATCAACCTGATGAATATCTG ppc-U-F TTACCCTGTTATCCCTACGGTAATTCACCATTTTTGCTGGCAT ppc-U-R ACGCAATGCGGAATATTGTTCG ppc-D-F CAATATTCCGCATTGCGTCGTAATACCGGCTAATCTTCCTCTT ppc-D-R AGCTGCACATGAACTCGACATCACAAACAGAACGCTCTGC
[0122] 2.5 L fermentation study investigated the effect of dynamic regulation of oxygen factor on TCA cycle to reduce the byproduct succinic acid.
[0123] Seed culture preparation: The inoculum was inoculated from a glycerol tube into 10 mL LB medium and cultured overnight at 37 °C and 200 rpm. A 1% inoculum was then transferred to 100 mL shake flasks of fermentation medium II and cultured for 8 h. A 5% inoculum was then transferred to 3 L of fermentation medium II in a 5 L fermenter and cultured for 8 h at 37 °C, 200 rpm, and 1 vvm aeration. A 60% (w / v) glucose solution was added, and the aeration was stopped for anaerobic fermentation for 48 h. The yields of alanine and organic acids were then measured.
[0124] Results from a 5 L fermenter showed that the yield of E. coli A-LB4 Pomp*-ppc was 143.5 g / L, which was 10.2 g / L higher than that of E. coli A-LB4 (see Table 7). Compared with E. coli A-LB4, the Δppc biomass increased by 37.2%, and the byproduct succinic acid decreased by 85.8%.
[0125] Table 7 Results of 5 L fermentation
[0126] Strain Yield g / L Succinic acid g / L <![CDATA[OD 600 ]]> Conversion rate E.coli A-LB4 Pomp-ppc 141.5 2 20.2 94.6% E.coli A-LB4 Pomp*-ppc 143.5 1.6 21.4 95.2% E.coli A-LB4 Δppc 80.6 1.5 15.6 95.5% E.coli A-LB4 133.3 11.3 20.5 88.9%
[0127] Example 5: Dynamic Regulation of Oxidative Phosphorylation Module by Oxygen Factors Enhances L-Alanine Synthesis
[0128] The promoter gene and Donor DNA fragment were obtained by PCR amplification. The linearized pTarget-sgRNA vector, the upstream and downstream homologous arms of the Donor DNA, and the promoter gene were ligated using a one-step cloning ligase to obtain the tool plasmid pTarget-sgRNA(Patp)-Donor-PgltA for gene editing. Table 8 shows the N20 sequence of the PAM site in the sgRNA, the upstream and downstream homologous arms of the Donor DNA, the alanine dehydrogenase expression cassette, and the primers used for plasmid linearization in this embodiment. The tool plasmid was transformed into an E. coli host containing pCas9, and the promoter of the ATP synthase gene cluster atp was replaced using the CRISPR-Cas system to obtain the recombinant strain E. coli A-LB4 Pomp*-ppc / PgltA-atp.
[0129] Table 8 Primers used in Example 5
[0130] Primer Sequence 5’-3’ sg(Patp)-N20-F GTCCTAGGTATAATACTAGTAAAGTCGCAATTGTATGCACGTTTTAGAGCTAGAAATAG sg-N20-R ACTAGTATTATACCTAGGACTGAGCTAGCTG Patp-U-F TATTACCCTGTTATCCCTACACCATCTTCCTGGTGAGCAAG Patp-U-R TTTATTTACTTGGCAAATGATGCCTTTGC PgltA-F TCATTTGCCAAGTAAATAAAGAACAGTGATCCAGGTCACG PgltA-R CTCACGAGCGACACAGACATTTAAGGTCTCCTTAGCGCCTTATTG Patp-D-F ATGTCTGTGTCGCTCGTGAG Patp-D-R GGAGCTGCACATGAACTCGAGGTGGCTGGGGGGTTTTG
[0131] The inoculum was inoculated into 400 mL LB medium from glycerol tubes and cultured overnight at 37 °C and 200 rpm. 1% inoculum was transferred to fermentation medium II in a 3 L seed tank, and 5% inoculum was transferred to 28 L fermentation medium II in a 50 L fermenter. The culture was carried out at 37 °C and 200 rpm with an aeration rate of 1 vvm for 8 h. 60% (w / w) glucose solution was added, and the aeration was turned off for anaerobic fermentation for 48 h. The yield of alanine was then measured. After fermentation in a 50 L fermenter for 48 h, the average yield of three batches of E. coli A-LB4 Pomp*-ppc / PgltA-atp (HYSW01) strain was 151.3 g / L (HYSW25F1 - 148.1 g / L, HYSW25F2 - 154.4 g / L, HYSW25F3 - 151.5 g / L), with an average sugar-acid conversion rate of 95.2%. The fermentation progress curve of batch HYSW25F3 is shown below (…). Figure 6 ).
[0132] In summary, this invention optimizes the L-alanine synthesis pathway in *E. coli* through a multi-stage genetic engineering strategy. First, the alanine racemase gene dadX was knocked out, and alanine dehydrogenase (alaD) expression from different sources was integrated. A dominant alaD strain from *Bacillus lysinensis* was screened, achieving a shake-flask yield of 10.8 g / L. Through design and screening, the alaD mutant M18L / E75A / A78S / I266V was obtained, exhibiting 4.3 times the activity of the wild type. Furthermore, six byproduct-related genes, including lactate dehydrogenase (ldhA), were knocked out, constructing a multi-copy alaD integrated strain. In a 5 L fermenter, the yield of *E. coli* A-LB6 was increased to 133.3 g / L. Through a dynamic regulation strategy, the oxygen-sensitive promoter Pomp* was used to replace the phosphoenolpyruvate carboxylase promoter, reducing succinic acid byproducts by 85.8%, and achieving a yield of 143.5 g / L after 48 hours of aerobic and anaerobic fermentation. Finally, by regulating the promoter of the ATP synthase gene cluster atp, an L-alanine yield of 151.3 g / L was achieved in a 50 L fermenter, with a sugar-acid conversion rate of 95.2%. The results indicate that multi-gene knockout combined with dynamic metabolic regulation can effectively enhance alanine biosynthesis and provide a highly efficient engineered strain for industrial production.
[0133] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A genetically engineered bacterium that produces high levels of L-alanine, characterized in that: Using Escherichia coli as the starting strain, (a) the alanine racemase gene was knocked out. dadX (b) knocking out or weakening one or more key genes in the byproduct pathway of L-alanine synthesis, and / or (c) expressing a heterologous alanine dehydrogenase mutant after integrating an oxygen-sensitive self-inducible promoter system; wherein the alanine dehydrogenase mutant is obtained by single or multiple mutations at positions 18, 75, 78, 198, and 266 of the alanine dehydrogenase shown in SEQ ID NO:2, wherein the mutation includes one of the following mutation sites: (1) The 18th amino acid is replaced by methionine with alanine, isoleucine or leucine; (2) The 75th amino acid is replaced by alanine; (3) The 78th amino acid is replaced by proline or serine instead of alanine; (4) The 198th amino acid is replaced by isoleucine instead of leucine; (5) The amino acid at position 266 is replaced by valine; (6) The 18th amino acid is replaced by leucine and the 75th amino acid is replaced by alanine; (7) The 18th amino acid is replaced by leucine, the 75th amino acid is replaced by alanine, and the 78th amino acid is replaced by serine. (8) The 18th amino acid is replaced by leucine, the 75th amino acid is replaced by alanine, the 78th amino acid is replaced by serine, and the 266th amino acid is replaced by valine.
2. The genetically engineered bacterium producing high levels of L-alanine according to claim 1, characterized in that, The heterologous alanine dehydrogenase is derived from Bacillus lysine, and its amino acid sequence is shown in SEQ ID NO:2, and its nucleotide sequence is shown in SEQ ID NO:
7.
3. The genetically engineered bacterium producing high levels of L-alanine according to claim 1, characterized in that, The alanine dehydrogenase mutant was obtained by simultaneously mutating positions 18, 75, 78, and 266 of the alanine dehydrogenase shown in SEQ ID NO:2, and is a protein with the amino acid sequence shown in SEQ ID NO:11; or a protein encoded by the nucleotides shown in SEQ ID NO:
12.
4. A method for constructing a genetically engineered bacterium that produces high levels of L-alanine, characterized in that, include: Using Escherichia coli as the starting strain, the endogenous alanine racemase gene was knocked out. dadX ; The gene encoding the heterologous alanine dehydrogenase mutant described in claim 1 is integrated and expressed at the knockout site; The heterologous alanine dehydrogenase mutant of claim 1 can be expressed in single or multiple copies.
5. The construction method according to claim 4, characterized in that, Also includes: Knockout or attenuation of at least one key gene in the byproduct pathway of L-alanine synthesis in the *E. coli* genome; said key gene in the byproduct pathway includes lactate dehydrogenase gene. ldhA Pyruvate formate lyase pflB Ethanol dehydrogenase gene adhE Acetylkinase gene ackA Acetyltransferase gene pta and pyruvate oxidase gene poxB One or more of the following; The gene encoding a heterologous alanine dehydrogenase mutant is integrated and expressed at one or more knockout sites.
6. The construction method according to claim 4, characterized in that, It also includes an integrated oxygen-sensitive self-inducible promoter system for dynamically regulating the TCA cycle and glycolysis to direct central carbon metabolism toward the L-alanine synthesis pathway; wherein, the oxygen-sensitive self-inducible promoter system includes: The nucleic acid sequence is shown in SEQ ID NO:13, which is an oxygen-sensitive self-inducible promoter P. omp This is used to dynamically drive the expression of phosphoenolpyruvate carboxylase. The nucleic acid sequence is shown in SEQ ID NO:14, representing the oxygen-sensitive self-inducible promoter mutant P. omp* Used to dynamically drive the expression of phosphoenolpyruvate carboxylase; and / or The nucleic acid sequence is shown in SEQ ID NO:15, which is an oxygen factor-sensitive self-inducible promoter P. gltA It is used to dynamically drive the expression of ATP synthase.
7. The use of the genetically engineered bacteria according to any one of claims 1 to 3 in the production of L-alanine.
8. A method for producing L-alanine, characterized in that, include: Step 1) Seed culture: The genetically engineered bacteria described in any one of claims 1 to 3 are inoculated into LB liquid medium and cultured overnight with shaking at 37°C and 200 rpm to obtain seed culture; Step 2) Fermentation Culture: Inoculate the seed culture into either fermentation medium one or fermentation medium two at a volume ratio of 1-10%. Control the fermentation conditions and carry out L-alanine fermentation culture to obtain the fermentation broth. When using fermentation medium one, the fermentation conditions are: aerobic culture at 37 ℃ and 200 rpm for 2 h, then seal the culture flask, adjust the pH to 7.0 with ammonia every 2 h, and anaerobic ferment at 37 ℃ and 200 rpm for 12 h. The yield after 12 h of fermentation should be greater than or equal to 15 g / L. Fermentation medium one consists of: glucose 25 g / L, corn steep liquor powder 15 g / L, potassium dihydrogen phosphate 2 g / L, ammonium sulfate 10 g / L, magnesium sulfate 1.5 g / L, and trace elements 2 g / L. When using fermentation medium two, the fermentation conditions are: culture at 37 ℃ and 200 rpm with an aeration rate of 1 vvm for 8 h, add 60% glucose solution, close the aeration and anaerobic fermentation, and ferment for 40 h. The yield after h is greater than or equal to 150 g / L; the fermentation medium consists of two components: glucose 5%, magnesium sulfate 0.5%, corn steep liquor powder 3%, yeast extract 2%, potassium dihydrogen phosphate 0.2%, and trace elements 0.2%.
Citation Information
Patent Citations
Genetically engineered bacterium for producing L-alanine, construction method of genetically engineered bacterium and application of genetically engineered bacterium in production of L-alanine
CN118773108A