ITR-Rep gene complex

Abstract

Provided is a plasmid DNA or a DNA / cationic substance complex containing Rep and ITR, said plasmid DNA or DNA / cationic substance complex having high productivity of an AAV vector. If explained in detail, in one embodiment of the present application, the present application provides a nucleic acid or the like comprising a Rep gene derived from an adeno-associated virus (AAV) of a first serotype and an inverted terminal repeat (ITR) sequence having a [delta] G value in the range of-65 to-95 kcal / mol, said sequence being derived from an AAV of a second serotype different from the first serotype.

Description

Technical Field

[0001] The present application provides a plasmid DNA or DNA / cationic substance complex containing Rep and ITR with high productivity of an AAV vector. Background Art

[0002] During AAV vector production, the ITRs interact with the Rep protein, encapsidating the DNA. With the recent expansion of the number of diseases for which AAV vectors are used and the increasing cost of production, there is a need for technologies that can increase AAV vector production. Summary of the Invention Means of solving the problem

[0003] The present inventors have discovered a specific combination of ITR and Rep that increases AAV vector productivity, other than ITR2 / Rep2. Therefore, the present application provides a plasmid DNA or DNA / cationic substance complex containing a combination of Rep and ITR that increases AAV vector productivity.

[0004] Therefore, the present application provides the following. (Item 1) A nucleic acid comprising a Rep gene derived from a first serotype of adeno-associated virus (AAV) and an inverted terminal repeat (ITR) sequence of a second serotype of AAV different from the first serotype and having a ΔG value in the range of -65 to -95 kcal / mol. (Item 2) According to the nucleic acid described in the above item, the Rep gene is derived from AAV serotype 2, and the ITR sequence has a ΔG value in the range of -75 to -95 kcal / mol. (Item 3) The nucleic acid according to any one of the above items, wherein the ITR sequence has a ΔG value in the range of -80 to -88 kcal / mol. (Item 4) The nucleic acid according to any one of the above items, wherein the ITR sequence is derived from AAV serotype 1, 6 or 7. (Item 4A) The nucleic acid according to any one of the above items, wherein the Rep gene is selected from the group consisting of Rep1 / 6, Rep2, Rep3 / 4, Rep12, Rep5, Rep8, Rep7 / 9, and Rep10 / 11. (Item 4B) The nucleic acid according to any one of the above items, wherein the Rep gene is a gene encoding an amino acid sequence having 90% or greater identity with at least one of Rep3, Rep1, or Rep7. (Item 5) The nucleic acid according to any one of the above items, wherein the Rep gene is derived from AAV serotype 1, 2, 5, 7, or 10, and the ITR sequence has a ΔG value in the range of -75 to -95 kcal / mol. (Item 6) The nucleic acid according to any one of the above items, wherein the ITR sequence has a ΔG value in the range of -80 to -90 kcal / mol. (Item 7) The nucleic acid according to any one of the above items, wherein the ITR sequence is derived from any one of AAV serotypes 1 to 7. (Item 8) The nucleic acid according to any one of the above items, further comprising a Cap gene derived from AAV. (Item 9) The nucleic acid according to any one of the above items, further comprising a Cap gene derived from any one of AAV serotypes 1 to 10. (Item 10) The nucleic acid according to any one of the above items comprises the Rep gene, the ITR sequence, and the AAV-derived Cap gene on the same nucleic acid molecule or nucleic acid double strand. (Item 11) The nucleic acid according to any one of the above items, further comprising an adenovirus (AdV)-derived helper gene. (Item 12) The nucleic acid according to any one of the above items, wherein the combination of the Rep gene and the ITR sequence has the ability to produce a viral vector with a titer [GC / mL] twice or more compared to the combination of the Rep gene and ITR-5 when measured by qPCR targeting a CMV promoter or EGFP. (Item 13) The nucleic acid according to any one of the above items, which is a plasmid. (Item 14) The nucleic acid according to any one of the above items, which forms a complex with a cationic substance. (Item 15) The nucleic acid according to any one of the above items, wherein the cationic substance includes a polymer or a liposome. (Item 16) A composition for producing a viral vector, comprising the nucleic acid according to any one of the above items. (Item 17) A method for synthesizing the nucleic acid according to any one of the above items, comprising the step of combining a nucleic acid comprising the Rep gene and a nucleic acid comprising the ITR. (Item 18) A method for producing a viral vector, comprising the steps of introducing the nucleic acid described in any one of the above items or the composition described in any one of the above items into a producer cell and forming the viral vector in the producer cell. (Item 19) According to the method of any one of the above items, at least a portion of the nucleic acid is assembled into the chromosome of the producer cell. (Item 20) A production cell or viral vector produced by the method described in any one of the above items.

[0005] In this application, it is intended that in addition to the combinations explicitly stated, one or more of the above features may be further combined and provided. Further embodiments and advantages of this application will be understood by those skilled in the art by reading the following detailed description as needed. Effects of the Invention

[0006] The present application provides a plasmid DNA or DNA / cationic substance complex containing a combination of Rep and ITR with high productivity of an AAV vector. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] [ Figure 1 ] Figure 1 Schematic representation of constructs showing 56 patterns of 8 ITRs and 7 Reps. [ Figure 2 ] Figure 2 express Figure 1 The results of qPCR and HPLC assays were performed on the constructs. [ Figure 3 ] Figure 3 Schematic diagram showing constructs of 14 patterns of 7 ITRs, 1 Rep, and 2 Caps. [ Figure 4 ] Figure 4 express Figure 3 The results of qPCR and HPLC assays were performed on the constructs. [ Figure 5 ] Figure 5 Graph showing ΔG of 5'ITR and 3'ITR. DETAILED DESCRIPTION

[0008] The present application is described below while showing the best mode. Throughout this specification, as long as no special mention is made, expressions in the singular should be understood as including the concept of their plural form. Therefore, as long as no special mention is made, articles in the singular (such as "a", "an", "the", etc. in the case of English) should be understood as including the concept of their plural form. In addition, as long as no special mention is made, the terms used in this specification should be understood as being used in the meaning commonly used in the field. Therefore, as long as no other definition is made, all technical terms and scientific and technical terms used in this specification have the same meaning as commonly understood by those skilled in the art in the field to which this application belongs. In the event of a conflict, this specification (including definitions) takes precedence.

[0009] Definitions of terms particularly used in this specification and / or basic technical contents are described below as appropriate.

[0010] In this specification, "polynucleotide" and "nucleic acid" are used synonymously and refer to polymers of nucleotides of any length. In this specification, unless otherwise specified, "nucleic acid" refers to both a single nucleic acid molecule and multiple nucleic acid molecules, as well as single-stranded nucleic acids and double-stranded nucleic acids. In this specification, unless otherwise specified, descriptions of nucleic acids comprising multiple elements include embodiments in which multiple elements are present on the same nucleic acid molecule and embodiments in which multiple elements are present on different nucleic acid molecules, as well as embodiments in which multiple elements are present on the same double-stranded nucleic acid complex and embodiments in which multiple elements are present on different double-stranded nucleic acid complexes. Examples of nucleic acids include DNA, RNA, cDNA, mRNA, rRNA, tRNA, microRNA (miRNA), and lncRNA. In addition, the term also includes "polynucleotide derivatives." "Polynucleotide derivatives" refers to polynucleotides containing nucleotide derivatives or internucleotide bonds that differ from the usual ones. "Nucleotide derivatives" refer to nucleotides having a structure different from that of typical nucleotides used in natural DNA or RNA. Examples include locked nucleic acids (LNA), ethylene nucleic acids such as 2'-O,4'-C-ethylene bridged nucleic acids (ENA), other bridged nucleic acids (BNA), hexitol nucleic acids (HNA), amide-bridged nucleic acids (AmNA), morpholino nucleic acids, tricyclic DNA (tcDNA), polyether nucleic acids (e.g., see U.S. Patent No. 5,908,845), and cyclohexene nucleic acids (CeNA). Examples of internucleotide bonds that differ from typical ones include internucleotide bonds in which a phosphodiester bond is replaced by a phosphorothioate bond, internucleotide bonds in which a phosphodiester bond is replaced by an N3'-P5' phosphoramidate bond, and internucleotide bonds in which a ribose sugar and phosphodiester bond is replaced by a peptide nucleic acid bond.

[0011] Unless otherwise indicated, a specific nucleic acid sequence refers to the sequence specified, including conservatively modified versions thereof (e.g., degenerate codon substitutions) and complementary sequences. Specifically, degenerate codon substitutions can be achieved by creating a sequence in which the third position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues. For example, among the modifications based on specific wild-type sequences such as adenovirus serotypes 1 to 52 and adeno-associated virus serotypes 1 to 12, in addition to well-known modifications (such as rh10, DJ, DJ / 8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.), nucleic acids containing sequences having a sequence identity of at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% to the original sequence are also included.

[0012] In this specification, "gene" refers to a nucleic acid portion that realizes a certain biological function. Examples of such biological functions include: encoding a polypeptide or protein, encoding a protein non-coding functional RNA (rRNA, tRNA, microRNA (miRNA), lncRNA, etc.), regulating the production of a polypeptide, protein, or protein non-coding functional RNA, specifically binding to a specific protein, and regulating the cutting or replication of nucleic acids. Therefore, in the gene in this specification, in addition to the nucleic acid portion encoding a protein or protein non-coding functional RNA, it also includes transcriptional and translational regulatory sequences such as promoters, terminators, enhancers, insulators, silencers, replication origins, internal ribosome entry sites, and the nucleic acid portion required for packaging viral particles. In this specification, "gene product" refers to the mRNA transcribed from a gene, the polypeptide, protein, or protein non-coding functional RNA encoded by the gene. In this specification, "gene expression" refers to the production of a gene product. In particular, viral genes often encode multiple proteins of different lengths in a single nucleic acid region. In this specification, a gene is said to be expressed when at least one protein that can be produced by a gene is produced.

[0013] In this specification, "adeno-associated virus" (AAV) refers to a linear single-stranded DNA virus of the genus Dependovirus of the family Parvoviridae, with a virus particle diameter of 20 to 26 nm. Adenoviral elements are generally required for the proliferation of AAV. There is a T-shaped hairpin structure called ITR (inverted terminal repeat) at both ends of the AAV genome. The ITR portion is the starting point of replication and plays the role of a primer. In addition, the ITR is also required for the packaging of virus particles and the assembly of the host cell's chromosomal DNA. In the left half of the genome, there is a rep gene encoding non-structural proteins, i.e., regulatory proteins (Rep78, Rep68, Rep52, Rep40) responsible for replication and transcription, and in the right half of the genome, there is a cap gene encoding three capsid proteins of structural proteins (VP1, VP2, VP3). The life cycle of AAV is divided into latent infection and lytic infection. The former is a case of single infection, which is characterized by being assembled into the AAVS1 region (19q13.3-qter) of the long arm of chromosome 19 of the host cell. This assembly is performed by non-homologous recombination, with the participation of Rep. It is reported that Rep78 / Rep68 are bound to the base sequence (GAGC repeat sequence) that is common in the AAVS1 region and the Rep binding region of the ITR. Therefore, when wild-type AAV infects target cells, Rep binds to the ITR and AAVS1 of AAV, and is believed to produce a site-specific assembly of chromosome 19 of the AAV genome through Rep. In the case of simultaneous infection with a helper virus such as adenovirus, when cells latently infected with AAV are further repeatedly infected with the helper virus, AAV replication occurs, and a large amount of virus is released due to cell destruction (lytic infection).

[0014] AAV has been reported to have serotypes 1 to 12 based on differences in its capsid. In addition, rh10, DJ, DJ / 8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, and Anc80 have also been reported. The AAV-derived constructs of the present application can also be prepared using an appropriate AAV serotype depending on the target tissue. For example, the relationship between (serotype): (target tissue) can be selected as follows: (AAV1): (muscle, liver, trachea, nerve cells), (AAV2): (muscle, liver, nerve cells), (AAV3): (muscle, liver, nerve cells), (AAV4): (muscle, ventricular epithelial cells), (AAV5): (muscle, liver, nerve cells, glial cells, trachea), (AAV6): (muscle, liver, trachea, nerve cells), (AAV7): (muscle, liver), (AAV8): (muscle, liver), (AAV9): (muscle, liver, trachea). Examples of AAV capsids include wild-type capsids, capsids with targeted mutations (AAV2i8, AAV2.5, AAV-TT, AAV9.HR, etc.), capsids with random mutations (AAV-PHP.B, etc.), and capsids designed in silico (Anc80, etc.). In one embodiment, the AAV-derived constructs of the present application may also include these modified capsids, and the AAV-derived construct plasmids of the present application may also be constructed to encode these modified capsids. In this specification, when a nucleic acid sequence is described as being derived from a specific serotype, it is contemplated that the nucleic acid sequence may encode a wild-type capsid or a capsid modified as described above based on the wild-type capsid.

[0015] In this specification, "derived from a virus" with respect to a nucleic acid means that the nucleic acid has a high homology or identity with a nucleic acid present in the virus, and the nucleic acid need not be obtained from the virus, nor need it be prepared using nucleic acid obtained from the virus. For example, if a nucleic acid or its translation product contains a sequence that has a high identity (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with a nucleic acid present in a virus or its translation product, the nucleic acid can be derived from the virus.

[0016] In this specification, "Rep" refers to the Rep gene or part thereof or a modified form thereof possessed by adeno-associated virus (AAV). The Rep of wild-type AAV encodes regulatory proteins (Rep78, Rep68, Rep52, Rep40) that are responsible for replication and transcription. The Rep of the present application can encode a protein with equivalent functions to at least one of Rep78, Rep68, Rep52 and Rep40. For AAV, serotypes 1 to 12 have been reported based on the difference in the capsid. In addition, serotypes of rh10, DJ, DJ / 8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, and Anc80 have been reported. The Rep of the present application can be derived from the Rep of any serotype of AAV. The Rep or its gene product (protein, etc.) of the present application may contain a sequence (base sequence or amino acid sequence) that has a high identity (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity, etc.) with respect to the Rep or its gene product (protein, etc.) of any serotype of AAV.

[0017] In this specification, "repetitive sequence" or "tandem repeat" (nucleic acid sequence) refers to a general term for sequences in which the same sequence appears repeatedly (especially several times or more) in the nucleic acid sequence of an organism's genome. Any repetitive sequence used in the field can be used in this application. Typically, a repetitive promoter sequence is used.

[0018] In this specification, "terminal repeat sequence" refers to a general term for sequences present at the end among sequences in which the same sequence appears repeatedly (especially several times or more) in the nucleic acid sequence of the biological genome. As terminal repeat sequences, although terminal inverted repeat sequences (ITR) or long terminal repeat sequences (LTR) can be cited, they are not limited to these. The terminal repeat sequence can utilize a sequence derived from serotypes 1 to 52 of adenovirus or serotypes 1 to 12 of adeno-associated virus or their modified forms (rh10, DJ, DJ / 8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.). As a terminal repeat sequence, it can be natural or artificially introduced with mutations. The terminal repeat sequence of "artificially introduced with mutations" can be made by, for example, introducing appropriate mutations into the sequence of a natural terminal repeat sequence described in a known document.

[0019] In this specification, "helper gene" refers to any gene that increases the amount of AAV produced in producer cells. For example, pAAV-ZsGreen (TAKARA: 6231) and pRC1 (TAKARA: 6672) were introduced into HEK293 cells (ATCC: CRL-1573), and cells into which the candidate gene was introduced and cells into which the candidate gene was not introduced were further prepared. These cells were cultured in DMEM (Thermo Fisher: 11965) (2% FBS (Termo Fisher: 10270), 1% penicillin-streptomycin mixed solution (NACALAI TESQUE: 09367-34)) medium in an incubator at 37°C and 5% CO2. After 3 days, 5 μL of nuclease-free water (Promega: P1193), 1 μL of 10× reaction buffer (supplemented with MgCl2) (Thermo Fisher: ED0521), 2 μL of DNaseI (Thermo Fisher) were added to the recovered 2 μL of supernatant. Fisher: ED0521), reacted at 37°C in a block incubator for 30 minutes, then added 90 μL of ribozyme-free water (0.001% Pluronic (registered trademark) F-68 (100X) (Thermo Fisher: 24040032), 5 mM EDTA (TAKARA: T9191)), and reacted at 95°C in a block incubator for 10 minutes. To 2 μL of a solution prepared by diluting the resulting solution 100-fold with ribozyme-free water (0.001% Pluronic (registered trademark) F-68 (100X)), 2 μL of ribozyme-free water, 5 μL of PowerUp (registered trademark) SYBR (registered trademark) Green Master Mix (Thermo Fisher: A25780), 0.5 μL of 10 μM qPCR was performed using a QuantStudio 3 Real-Time PCR System (Thermo Fisher: QS3-96F) with a CMV-F primer (CATCAATGGGCGTGGATAGC: SEQ ID NO: 1) and 0.5 μL of a 10 μM CMV-R primer (GGAGTTGTTACGACATTTTGGAAA: SEQ ID NO: 2) at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, 55°C for 5 seconds, and 72°C for 30 seconds. When measuring the amount of AAV particles, if the amount of AAV particles in cells transfected with the candidate gene is increased by at least 50% compared to cells not transfected with the candidate gene, the candidate gene can be identified as a helper gene. Typically, the helper gene can be selected from adenovirus E1A, E1B, E2A, VA, E4, or portions or modifications thereof.To date, 52 antigenic types (serotypes) of human adenovirus have been identified. The auxiliary gene of the present application can be derived from the auxiliary gene of an adenovirus of any antigenic type. The auxiliary gene of the present application or its gene product (protein, etc.) may contain a sequence (base sequence or amino acid sequence) having high identity (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity, etc.) relative to the auxiliary gene or its gene product (protein, etc.) of any serotype of adenovirus.

[0020] In this specification, "regulation of Rep gene expression" refers to any operation that increases or decreases the amount of a Rep gene product (e.g., a Rep gene transcript). For example, in the same cells, the same culture medium, or the same isolation space (well, culture dish, etc.), at different time points (e.g., 6 hours, 12 hours, 24 hours, or 72 hours), if the amount of the Rep gene product or the ratio of the amount of the Rep gene product relative to the Rep gene changes by at least 30%, then the expression of the Rep gene is regulated.

[0021] In this specification, “regulation of the expression of auxiliary genes” refers to any operation that increases or decreases the amount of auxiliary gene products (such as gene transcripts). For example, in the same cells, the same culture medium or the same isolation space (well, culture dish, etc.), at different time points (for example, 6 hours, 12 hours, 24 hours or 72 hours away), when the amount of auxiliary gene products or the amount ratio of auxiliary gene products relative to auxiliary genes changes by at least 30%, the expression of the auxiliary gene is regulated. The process of regulating the expression of auxiliary genes may include giving a stimulus (drug, light, etc.) corresponding to a stimulus-responsive promoter connected to the auxiliary gene in an operable manner.

[0022] In this specification, the "expression regulation system" for a certain gene refers to a substance or a part of a substance or a combination of these that can cause the start or stop of transcription and / or translation of the gene under specific conditions, or the decomposition of the nucleic acid containing the gene or its gene product. For example, as an expression regulation system, there can be mentioned: a combination of a stimulus (drug, light, etc.) and a promoter responsive to the stimulus (regulation of gene transcription), a combination of Cre protein and Cre protein responsive nucleic acid region (LoxP) (regulation of gene transcription), CRISPR-Cas9 system (decomposition of nucleic acid containing gene), siRNA or shRNA (decomposition of gene product), ubiquitin ligase (decomposition of gene product), etc. When the expression regulation system comprises nucleic acid substances such as promoters and nucleic acid regions with specific functions, it can be referred to as a nucleic acid element of the expression regulation system. When cells, cultures or isolated spaces contain nucleic acid elements for an expression regulation system of an auxiliary gene, it is considered that the expression of the auxiliary gene can be regulated. Typically, the expression regulation system can be switched to start and / or stop by adding a substance that does not naturally exist in the target cell to the target cell.

[0023] In this manual, 2 genes are cis and refer to the presence of these genes on the nucleic acid molecule of identical nucleic acid molecule or complementary chain (when being double-stranded nucleic acid). In addition, in this manual, 2 genes are trans and refer to certain cells (in certain organism), and these genes are not present on the nucleic acid molecule of identical nucleic acid molecule or complementary chain (when being double-stranded nucleic acid). For example, the gene present in the genome and the gene on the nucleic acid imported with the construct derived from virus can be trans. As required, whether 2 genes are trans can be judged under the state that 2 genes are present in the time point of cell (for example nucleic acid is imported into cell) simultaneously.

[0024] When the number of genes is mentioned in this specification, one gene refers to a gene that is usually present (with the highest frequency or a probability of 50% or more) in a form having a continuous sequence on the genome of a certain organism. For example, two exons encoding a certain protein can be two genes. For example, when a promoter sequence and a sequence encoding a protein form a continuous sequence, the nucleic acid portion containing the promoter sequence and the sequence encoding the protein can be one gene. For example, when a protein that becomes functional by being cut is encoded by a continuous sequence on the genome, the protein can be encoded by one gene. When referring to a gene from the functional perspective, the nucleic acid sequence does not need to be a continuous sequence. For example, multiple exons encoding a certain protein are collectively referred to as the gene of the protein.

[0025] As used herein, "deleted" gene means that the nucleic acid does not contain the gene or contains the gene modified so as not to exert the normal function of the gene (eg, the function of producing a functional protein).

[0026] As used herein, "operably linked" means that the expression (operation) of a desired sequence is controlled by a transcriptional or translational regulatory sequence (e.g., a promoter, enhancer, etc.) or a translational regulatory sequence. To operably link a promoter to a gene, the promoter is typically positioned immediately upstream of the gene, but does not necessarily need to be positioned adjacent to the gene.

[0027] As used herein, "plasmid" refers to a circular DNA that exists separately from chromosomes in cells or exists separately from chromosomes when introduced into cells.

[0028] As used herein, a "cationic substance" refers to a substance that is positively charged when added to neutral water, and is typically provided in a complex with a nucleic acid (plasmid, etc.).

[0029] In this specification, a "viral-derived construct" refers to a nucleic acid construct that at least partially has a structure derived from a virus, or a construct containing a protein produced therefrom. Examples of viral-derived constructs include viral vectors, virus-like particles (VLPs), oncolytic viruses (including viruses modified to proliferate only in cancer cells), and viral replicons (self-replicating viral genomes that lack the ability to produce viral particles).

[0030] As used herein, "viral vector" refers to a construct that has at least a partial structure derived from a virus and can introduce nucleic acid into target cells. Typically, a viral vector is in the form of a virus particle containing viral structural proteins and a nucleic acid containing a heterologous gene.

[0031] When used in this specification, "production cell" refers to a cell that can produce a desired viral-derived construct, and can be a cell in which the genes required for producing a viral-derived construct are expressed from a chromosome or an introduced plasmid. By introducing a plasmid into a production cell, a desired viral-derived construct can be produced. For example, in the case of an AAV viral vector, E1A and E1B are required for its production, but since HEK293 contains these, these can be removed from the helper plasmid. In other cells, as long as they are modified to have such functional auxiliary factors, they can function as production cells.

[0032] In this specification, "animal cells" refer to cells obtained from animals (human, mouse, rat, monkey, dog, etc.) or cells obtained by modifying cells obtained from animals.

[0033] As used herein, "host cell" refers to a cell (including the progeny of such a cell) into which a foreign nucleic acid, protein, virus, or virus-derived construct has been introduced.

[0034] Throughout this specification, the terms "protein," "polypeptide," and "peptide" are used synonymously to refer to polymers of amino acids of any length. These polymers may be linear, branched, or cyclic. The amino acids may be natural, non-natural, or modified. Furthermore, the term encompasses natural or artificially modified polymers. Examples of such modifications include disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification (e.g., conjugation with a labeling component).

[0035] When used in this specification, "transcriptional translation regulatory sequence" is a general term for promoter sequence, polyadenylation signal, transcription termination sequence, upstream regulatory domain, replication origin, enhancer, IRES, etc., which can collaborate to replicate, transcribe and translate the coding sequence in the recipient cell. As long as the selected coding sequence can be replicated, transcribed and translated in a suitable host cell, it is not necessary for all of these transcriptional translation regulatory sequences to exist. Those skilled in the art can easily identify regulatory nucleic acid sequences from public information. Further, those skilled in the art can, for example, identify transcriptional translation regulatory sequences that can be applicable to the purpose of use in vivo, ex vivo or in vitro.

[0036] As used herein, "promoter" refers to a segment of a nucleic acid sequence that regulates the transcription of an operably linked nucleic acid sequence. A promoter includes specific sequences sufficient for RNA polymerase recognition, binding, and initiation of transcription. A promoter may also include sequences that regulate RNA polymerase recognition, binding, or initiation of transcription.

[0037] As used herein, an "enhancer" refers to a fragment of a nucleic acid sequence that has the function of increasing the expression efficiency of a target gene.

[0038] As used herein, "silencer" refers to a fragment of a nucleic acid sequence that has a function of reducing the expression efficiency of a target gene, contrary to that of an enhancer.

[0039] As used herein, the term "insulator" refers to a fragment of a nucleic acid sequence that has a cis-regulatory function to regulate the expression of a gene located at a remote position in a DNA sequence.

[0040] As used herein, the term "terminator" refers to a fragment of a nucleic acid sequence located downstream of a protein-encoding region and involved in the termination of transcription when a nucleic acid is transcribed into mRNA.

[0041] As used herein, "origin of replication" refers to a nucleic acid sequence fragment where the DNA double helix is ​​partially unwound and replication is initiated by binding of a protein that recognizes its nucleic acid sequence (eg, initiator DnaA protein) or synthesis of RNA.

[0042] As used herein, an internal ribosome entry site ("IRES") refers to a nucleic acid fragment that promotes the entry or retention of ribosomes when a downstream nucleic acid sequence is translated.

[0043] In this specification, the "homology" of nucleic acid refers to the degree of identity of two or more nucleic acid sequences to each other, and generally having "homology" means that the degree of identity or similarity is higher. Therefore, the higher the homology of two nucleic acids, the higher the identity or similarity of these sequences. "Similarity" is a numerical value that, in addition to identity, also includes similar bases in the calculation, wherein similar bases refer to a part of the same situation in a mixed base (e.g., R=A+G, M=A+C, W=A+T, S=C+G, Y=C+T, K=G+T, H=A+T+C, B=G+T+C, D=G+A+T, V=A+C+G, N=A+C+G+T). Whether two nucleic acids have homology can be investigated by directly comparing the sequences or by hybridization under stringent conditions. When two nucleic acid sequences are directly compared, the genes are said to be homologous when the nucleic acid sequences are typically at least 50% identical, preferably at least 70% identical, and more preferably at least 80%, 90%, 95%, 96%, 97%, 98% or 99% identical.

[0044] Amino acids can be referred to in this specification by any of their commonly known three-letter symbols or the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides can also be referred to by commonly known single-letter codes. In this specification, BLAST, a tool for sequence analysis, can be used to calculate the similarity, identity and homology of amino acid sequences and base sequences using default parameters. The search for identity can be carried out, for example, using NCBI's BLAST 2.10.1+ (issued on June 18, 2020). The value of identity in this specification refers to the value when sequence alignment is performed under default conditions using the above-mentioned BLAST. However, by changing the parameters, when a higher value occurs, the highest value is set to the value of identity. When evaluating identity in multiple regions, the highest value therein is used as the value of identity. Similarity is a numerical value that also includes similar amino acids in the calculation in addition to identity.

[0045] In this specification, unless otherwise specified, references to a biological substance (e.g., a protein, nucleic acid, gene) are understood to include references to variants of the biological substance (e.g., variants having modifications in the base sequence) that perform the same biological function as the biological substance (which may not be to the same extent). Such variants may include fragments of the entire original molecule, amino acid sequences or nucleic acid sequences of the original biological substance of the same size, or molecules that are at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identical to the sequence of the original molecule when compared to a sequence of the original molecule using a computer homology program known in the art. Variants may also include molecules having modified nucleotides (e.g., methylation modifications).

[0046] In this specification, a "corresponding" amino acid or nucleic acid refers to an amino acid or nucleotide that has or is predicted to have the same effect as a specified amino acid or nucleotide in a polypeptide or polynucleotide serving as a comparison benchmark in a certain polypeptide molecule or polynucleotide molecule, and particularly refers to an amino acid that is present at the same position in the active site in an enzyme molecule and makes the same contribution to the catalytic activity. For example, in the case of an antisense strand molecule, it can be the same portion in the ortholog corresponding to a specific portion of the antisense strand molecule. The corresponding amino acid can be, for example, a specific amino acid that is cysteine- or glutathionylated, forms an SS bond, is oxidized (e.g., methionine side chain oxidation), formylated, acetylated, phosphorylated, glycosylated, or myristylated. Alternatively, the corresponding amino acid can be an amino acid that is responsible for dimerization. Such a "corresponding" amino acid or nucleic acid can also be a region or domain within a certain range. Therefore, in such a case, it can be referred to as a "corresponding" region or domain in this specification.

[0047] In this specification, a "corresponding" gene (e.g., a polynucleotide sequence or molecule) refers to a gene (e.g., a polynucleotide sequence or molecule) in a certain species that has or is predicted to have the same effect as a specified gene in a species serving as a comparison benchmark. When there are multiple genes with such an effect, it refers to genes with the same evolutionary origin. Therefore, a gene corresponding to a certain gene can be a direct homolog of that gene. For example, the cap of AAV serotype 1 can correspond to the cap of AAV serotype 2. For example, a corresponding gene in a certain virus can be found by using the gene sequence of a virus that will serve as a benchmark for the corresponding gene as a query sequence and searching the sequence database of the virus.

[0048] As used herein, the term "activity" refers to the function of a molecule in its broadest sense. While not intended to be limiting, activity broadly encompasses biological, biochemical, physical, or chemical functions of a molecule. Examples of activity include enzymatic activity, the ability to interact with other molecules, the ability to activate, promote, stabilize, hinder, inhibit, or destabilize the functions of other molecules, stability, and the ability to localize to a specific intracellular location. Where applicable, the term also relates to the function of a protein complex in its broadest sense.

[0049] In this specification, "biological function" refers to the specific function that a gene, nucleic acid molecule or polypeptide may have in vivo when referring to a certain gene or a nucleic acid molecule or polypeptide related thereto, wherein for example, specific cell surface structure recognition ability, enzymatic activity, ability to bind to a specific protein, etc. can be cited, but are not limited to these. In this application, for example, the function of a certain promoter being recognized in a specific host cell can be cited, but are not limited to these. In this specification, a biological function can be exerted by "biological activity". In this specification, "biological activity" refers to the activity that a certain factor (such as a polynucleotide, protein, etc.) may have in vivo, including the activity that exerts various functions (such as transcription promoting activity), and also including the activity that activates or inactivates other molecules, for example, by interacting with a certain molecule. For example, when a certain factor is an enzyme, its biological activity includes its enzymatic activity. In other examples, when a certain factor is a ligand, it includes the binding of the ligand to the corresponding receptor. Such biological activity can be measured by techniques well known in the art.

[0050] As used herein, the "infectivity" of a virus or a construct derived from a virus refers to the ability of the virus or construct derived from a virus to introduce nucleic acid into cells through adhesion of the virus or construct derived from a virus to the cell or membrane fusion. The "replication competence" of a virus or construct derived from a virus refers to the ability to produce infectious virus particles or virus-derived construct particles in infected cells.

[0051] As used herein, the terms "transformation," "transduction," and "transfection" are used interchangeably unless otherwise specified, and refer to the introduction of a nucleic acid into a host cell (optionally via a virus or a viral-derived construct). Any method for introducing a nucleic acid into a host cell may be used as a transformation method, including various well-known techniques such as the use of competent cells, electrofection, methods using a particle gun, and the calcium phosphate method.

[0052] In this specification, "purified" substances or biological factors (such as nucleic acids or proteins, etc.) refer to substances or biological factors after at least a portion of the factors naturally associated with the biological factors have been removed. Therefore, the purity of the biological factors in the purified biological factors is usually higher (i.e., concentrated) than the state in which the biological factors normally exist. The term "purified" as used in this specification refers to the presence of preferably at least 75% by weight, more preferably at least 85% by weight, further preferably at least 95% by weight, and most preferably at least 98% by weight of the same type of biological factors. The substances used in this application are preferably "purified" substances.

[0053] In this specification, "drug ingredient" refers to any component that can constitute a drug, and examples thereof include: active ingredients (ingredients that exhibit drug effects themselves), additives (ingredients that are not expected to have drug effects themselves but are expected to play a certain role when included in a drug (such as excipients, lubricants, surfactants, etc.)). The drug ingredient can be a single substance or a combination of multiple substances or agents. It can also include any combination such as a combination of an active ingredient and an additive, or a combination of an adjuvant and an active ingredient.

[0054] In this specification, the "active ingredient" refers to an ingredient that exerts the desired medicinal effect, and may be a single ingredient or multiple ingredients.

[0055] In this specification, "additive ingredient" refers to any ingredient that is not expected to have a pharmaceutical effect but plays a certain role when contained in a drug, for example, pharmaceutically acceptable carriers, stabilizers, (auxiliary) adjuvants, solubility improvers, solubilizers, diluents, excipients, buffers, binders, diluents, flavorings, and lubricants.

[0056] In this specification, the terms "agent," "agent," or "factor" (all equivalent to "agent" in English) are used interchangeably in a broad sense and may be any substance or other element (e.g., energy such as light, radioactive energy, heat, or electricity) as long as it can achieve the desired purpose. Examples of such substances include, but are not limited to, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (e.g., DNA such as cDNA and genomic DNA, RNA such as mRNA), polysaccharides, oligosaccharides, lipids, organic low molecules (e.g., hormones, ligands, information transmission substances, organic low molecules, molecules synthesized by combinatorial chemistry, low molecules that can be used as pharmaceuticals (e.g., low molecular weight ligands), etc.), complex molecules thereof, and mixtures thereof.

[0057] As used herein, a "complex" or "complex molecule" refers to any structure comprising two or more parts. For example, if one part is a polypeptide, the other part may be a polypeptide, or may be a substance other than a polypeptide (e.g., a substrate, a sugar, a lipid, a nucleic acid, or other hydrocarbons). As used herein, the two or more parts comprising a complex may be bound by a covalent bond or by other bonds (e.g., hydrogen bonds, ionic bonds, hydrophobic interactions, van der Waals forces, etc.).

[0058] In this specification, "label" refers to a method for identifying the presence of a target molecule or substance (such as a substance, energy, electromagnetic wave, etc.) from other molecules. Examples of such labeling methods include: RI (radioisotope) method, fluorescence method, biotin method, chemiluminescence method, etc. When labeling multiple target proteins or factors or means for capturing target proteins by fluorescence method, they can be labeled with fluorescent substances with different maximum wavelengths of fluorescence emission. The difference in the maximum wavelength of fluorescence emission is preferably 10 nm or more. Although any label that does not affect the function can be used, as a fluorescent substance, Alexa Fluor TM Fluor. Alexa TM Fluor is a water-soluble fluorescent pigment obtained by modifying coumarin, rhodamine, fluorescein, cyanine, etc. It is a series of fluorescent pigments that can correspond to a wide range of fluorescence wavelengths. Compared with other fluorescent pigments of the same wavelength, it is very stable and bright, and has low pH sensitivity. As a combination of fluorescent pigments with a maximum fluorescence wavelength of more than 10nm, the following can be mentioned: Alexa TM 555 with Alexa TM 633 combination, Alexa TM 488 and Alexa TM 555 combination, etc. As other fluorescent labels, there are: cyanine pigments (such as CyDye TM In the present application, such labels can be used to modify the target object so that it can be detected by the detection method used. Such modifications are well known in the art, and those skilled in the art can appropriately implement such methods depending on the label and the target object.

[0059] In this specification, the so-called "test kit" (kit) refers to a unit that is usually divided into two or more parts and provides the parts that should be provided (for example, constructs derived from viruses, instructions, etc.). For the sake of stability, etc., it should not be provided in a mixed manner, but when the purpose is to provide a composition that is preferably mixed for use just before use, the form of the test kit is preferred. Such a test kit is preferably equipped with instructions or instructions that record how to use the provided parts or how to handle the reagents. In this specification, when the test kit is used as a reagent set, the test kit usually includes instructions that record how to use the plasmids, etc.

[0060] In this specification, the "instruction sheet" records the method of using this application for doctors or other users. The instruction sheet records written instructions for administering the medicine of this application, etc. In addition, the instruction sheet may also record written instructions for the dosage form. The instruction sheet is prepared in accordance with the format prescribed by the regulatory authorities of the country where this application is implemented (for example, the Ministry of Health, Labor and Welfare in Japan, the Food and Drug Administration (FDA) in the United States, etc.), and clearly records the subject matter recognized by the regulatory authorities. The instruction sheet is a so-called drug package insert, which is usually provided in the form of paper, but is not limited to this. For example, it can also be provided in the form of electronic media (for example, homepages or emails provided via the Internet).

[0061] In this specification, "(Gibbs') free energy change (ΔG)" is described by the following formulas (1) and (2) in terms of thermodynamics or statistical mechanics.

[0062] ΔG=ΔH-TΔS (1) ΔG=ΔG°+RTlnK (2) Here, K is the equilibrium constant, and ΔG° is the Gibbs free energy change at standard conditions (1 atm, 25°C). Considering the equilibrium constant for nucleic acids, it can be described as an equilibrium reaction in which two chains A and B (e.g., 3'UTR and 5'UTR) associate in a 1:1 ratio (Equation (3)).

[0063] Assuming the molar fraction of the double-stranded state is α and the total concentration of nucleic acid is C, the concentrations of A and B [A] and [B] when completely dissociated are C / 2, so the equilibrium constant can be expressed by the following formula (4).

[0064] K=2α / ((1-α) 2 ×C) (4) When nucleic acid is in equilibrium with a 50% deviation, Since α=1 / 2, ΔG=0(5), Therefore, when equations (4) and (5) are substituted into equation (2), we get ΔG°=-RTmln(4 / C) (6). By substituting equation (6) into equation (1), the following equation (7) is obtained.

[0065] 1 / Tm=(R / ΔH°)ln(Ct / 4)+ΔS° / ΔH° (7) When the measured values ​​are plotted as two functions of 1 / Tm and ln(C / 4), the enthalpy change ΔH° and the entropy change ΔS° in the standard state are obtained from the intercept and the slope.

[0066] The term "about" refers to the indicated value plus or minus 10%. "About" when used with respect to temperature refers to the indicated temperature plus or minus 5°C; "about" when used with respect to pH refers to the indicated pH plus or minus 0.5.

[0067] (Preferred embodiment) The preferred embodiments of the present application are described below. The embodiments provided below are provided for a better understanding of the present application, and it is understood that the scope of the present application should not be limited to the following description. Therefore, those skilled in the art will obviously be able to make appropriate changes within the scope of the present application with reference to the description in this specification. In addition, it is understood that the following embodiments can be used individually or in combination.

[0068] In one embodiment, the present application provides a nucleic acid comprising a Rep gene derived from an adeno-associated virus (AAV) of the first serotype and an inverted terminal repeat (ITR) sequence derived from an AAV of the second serotype different from the first serotype, having a ΔG value in the range of -65 to -95 kcal / mol. In the genome replication and genome packaging of AAV, the interaction between ITR and Rep is involved (Chiorini JA, et al., JOURNAL OF VIROLOGY (1999).). Therefore, when ITR and Rep do not interact, AAV is not produced, and the AAV genome is not packaged. Therefore, when the inventors focused on the free energy change (ΔG) of ITR, they found that ITRs with a free energy change in a specific range increased the productivity of AAV vectors. Therefore, the nucleic acid of the present application exhibits high AAV vector productivity. It is conceivable that any means for achieving this are within the scope of the present application. For example, even without explicit description, a description of a method using a certain component also contemplates embodiments reflecting other means, such as a composition containing the component, use of the component, and the component for using the method.

[0069] In some embodiments, the Rep gene may be derived from AAV of serotype 2 (hereinafter, there are cases where it is expressed as Rep2, Rep-2, etc.). Nucleic acids containing AAV derived from serotype 2 and ITRs having specific free energy change (ΔG) values ​​show higher productivity of AAV vectors. In some embodiments, the free energy change (ΔG) value of ITR may be -65 to -95 kcal / mol, preferably -75 to -95 kcal / mol, more preferably -80 to -90 kcal / mol, and most preferably -80 to -88 kcal / mol. In specific embodiments, the Rep gene may be derived from AAV of serotype 2, and the ITR may be derived from AAV of any one of serotypes 1 to 7, preferably derived from AAV of serotypes 1, 6 or 7 (hereinafter, there are cases where it is expressed as ITR1, ITR-1, etc.).

[0070] In some embodiments, the free energy change (ΔG (kcal / mol)) can be calculated by a nucleic acid secondary structure prediction program, such as mfold (GCG Software), IPknot, CentroidFold (https: / / www.ncrna.org / ), ViennaRNA (http: / / rna.tbi.univie.ac.at / ), RNALOSS (P Clote, RNALOSS: a web server for RNAlocally optimal secondary structures, Nucleic Acids Res. 2005 Jul 1; 33: W600-4.), or RNA secondary structure prediction (http: / / www.genebee.msu.su / services / rna2_reduced.html).

[0071] In some embodiments, the ITR sequence can be derived from any AAV serotype 1 to 7. In preferred embodiments, the ITR sequence can be derived from any AAV serotype 1 to 4, 6, and 7.

[0072] In some embodiments, the Rep gene can be derived from AAV of serotypes 1 to 12. In some embodiments, the Rep gene can be derived from AAV of serotypes 1, 2, 3, 5, 7, 8, or 10. In a preferred embodiment, the Rep gene can be derived from AAV of serotypes 1, 2, 5, 7, or 10. Since Rep4 has a high homology to Rep3, Rep6 has a high homology to Rep1, and Rep9 has a high homology to Rep7, it is predicted that AAV production equivalent to that achieved by using Rep3, Rep1, and Rep7 separately can be achieved. Therefore, in one embodiment, the Rep gene of the present application can be a gene selected from the group consisting of Rep1 / 6, Rep2, Rep3 / 4, Rep12, Rep5, Rep8, Rep7 / 9, and Rep10 / 11. In addition, the reason why they are expressed as Rep1 / 6, Rep3 / 4, and Rep7 / 9 is that, since these are similar to each other (90% identity at the amino acid sequence level), there are cases where they are classified as the same family according to the classification method. Furthermore, in one embodiment, the Rep gene may be a gene encoding an amino acid sequence having 90% or greater identity with at least one of Rep3, Rep1, or Rep7.

[0073] In a specific embodiment, the Rep gene can be derived from AAV serotype 1; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0074] In a specific embodiment, the Rep gene can be derived from AAV serotype 2; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0075] In a specific embodiment, the Rep gene can be derived from AAV serotype 3; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0076] In a specific embodiment, the Rep gene can be derived from AAV serotype 4; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0077] In a specific embodiment, the Rep gene can be derived from AAV serotype 5; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0078] In a specific embodiment, the Rep gene can be derived from AAV serotype 6; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0079] In a specific embodiment, the Rep gene can be derived from AAV serotype 7; and the ITR sequence can be derived from any AAV serotype 1-7.

[0080] In a specific embodiment, the Rep gene can be derived from AAV serotype 8; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0081] In a specific embodiment, the Rep gene can be derived from AAV serotype 9; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0082] In a specific embodiment, the Rep gene can be derived from AAV serotype 10; and the ITR sequence can be derived from any one of AAV serotypes 1-7.

[0083] In some embodiments, the nucleic acid of the present application may further contain a Cap gene (e.g., a Cap gene derived from any one of AAV serotypes 1 to 10). In a preferred embodiment, the Cap gene may be derived from AAV serotype 6 or 9.

[0084] The preferred combination of Rep gene and ITR sequence can be Rep1 / ITR1, Rep1 / ITR2, Rep1 / ITR3, Rep1 / ITR4, Rep1 / ITR6, Rep1 / ITR7, Rep2 / ITR1, Rep2 / ITR2, Rep2 / ITR3, Rep2 / ITR4, Rep2 / ITR5, Rep2 / ITR6, Rep2 / ITR7, Rep5 / ITR5, Rep7 / ITR1, Rep7 / ITR2, Rep7 / ITR3, Rep7 / ITR4, Rep7 / ITR6, Rep7 / ITR7, Rep10 / ITR1, Rep10 / ITR2, Rep10 / ITR3, Rep10 / ITR4, Rep10 / ITR6 or Rep10 / ITR7.

[0085] In more embodiments, the combination of Rep genes and ITR sequences may also include Rep6 / ITR1, Rep6 / ITR2, Rep6 / ITR3, Rep6 / ITR4, Rep6 / ITR6, Rep6 / ITR7, Rep9 / ITR1, Rep9 / ITR2, Rep9 / ITR3, Rep9 / ITR4, Rep9 / ITR6, and Rep9 / ITR7.

[0086] In some embodiments, Rep and ITR may also be included in other nucleic acids. In some embodiments, the nucleic acid comprises a 3' ITR and a 5' ITR, each of which may be derived from the same serotype of AAV or from different serotypes of AAV.

[0087] The productivity of the AAV vector using the nucleic acid of the present application can be measured by qPCR targeting the CMV promoter contained in the nucleic acid of the present application, or by quantitative analysis using HPLC as the empty rate and / or the full rate, or can be measured as the empty rate and / or the full rate by the mass photometry method using Refeyn One (LifeScience solutions). In HPLC, the x-axis represents the retention time (retention time) (min), the y-axis represents the count (Counts), and the empty rate and the full rate are calculated from the relative area ratio. In Refeyn, the x-axis represents the mass (Mass) (kDa), the y-axis represents the count (Counts), the range of 3000 to 4000 kDa is defined as empty, the range of 4010 to 5000 kDa is defined as full, and the ratio of their numbers is respectively set as the empty rate and the full rate.

[0088] In some embodiments, the nucleic acid of the present application may further contain auxiliary genes derived from adenovirus (AdV). In one embodiment, the auxiliary genes include genes selected from E1B, E2, E4 and VA of adenovirus. In one embodiment, the auxiliary genes include the E1B gene of adenovirus. In one embodiment, the auxiliary genes include two or more auxiliary genes related to the production of constructs derived from adeno-associated virus (AAV), and the auxiliary genes can be selected from E1A, E1B, E2, E4 and VA as needed. In one embodiment, the auxiliary genes include auxiliary genes selected from E1A and E1B and auxiliary genes selected from E2, E4 and VA.

[0089] In some embodiments, the above-mentioned Rep gene, the above-mentioned ITR sequence, and the Cap gene derived from AAV may be contained on the same nucleic acid molecule or nucleic acid double strand. In more embodiments, the Rep gene, the ITR sequence, the Cap gene derived from AAV, and the auxiliary gene derived from adenovirus (AdV) or any combination thereof may be contained on the same nucleic acid molecule or nucleic acid double strand.

[0090] In some embodiments, the combination of the Rep gene and the ITR sequence can produce a viral vector with a titer [GC / mL] twice or more compared to a combination of the Rep gene and ITR-5, when measured by qPCR targeting a target protein such as a CMV promoter or EGFP. For example, when Rep1 is selected as the Rep gene, a preferred combination of Rep1 and a specific ITR sequence can produce a viral vector with a titer twice or more compared to a combination of Rep1 and ITR-5.

[0091] In some embodiments, the nucleic acid of the present application can be a plasmid.

[0092] In some embodiments, the nucleic acids of the present application, such as polymers and liposomes, can form complexes with cationic substances. Examples of cationic substances include, but are not limited to, PEI pro, FectoVIR-AAV, Lipofectamine 2000, Lipofectamin 3000, FuGENE 6, FuGENE HD, and FuGENE 4K.

[0093] In more aspects, the present application provides a composition containing the above-mentioned nucleic acid for producing a viral vector.

[0094] In more aspects, the present application provides a method for synthesizing a nucleic acid, comprising the step of combining a nucleic acid comprising a Rep gene and a nucleic acid comprising an ITR.

[0095] In further aspects, the present application provides a method for producing a viral vector, comprising the steps of introducing the aforementioned nucleic acid or composition into a producer cell and forming the viral vector in the producer cell. At least a portion of the aforementioned nucleic acid may be assembled into a chromosome of the producer cell. In further aspects, the present application provides a producer cell or viral vector produced according to the aforementioned method.

[0096] In one embodiment, the present application provides a production cell containing a nucleic acid comprising a Rep gene and a nucleic acid comprising an ITR. Examples of production cells include: human embryonic kidney cells (produced by transfecting human fetal kidney cells with DNA cut from adenovirus 5), 911 cells, PER.C6 cells, E1-transformed amniotic cells, E1-transformed A549 cells, GH329: HeLa cells, HEK293 cells, IT293SF cells, HEK293T, HEK293F, Vero cells, CHO cells, Sf9 cells, Freestyle (trademark) 293-F, Expi293-F (trademark), Expi293 inducible, Expi293NGT-Viral Production Cells (Viral Production Cells). Cells) 1.0, virus producer cells 2.0 (VPC2.0 cells), AAVpro (registered trademark) 293T cell line, Lenti-X (trademark) 293T cell line, FreeStyle (trademark) CHO-S cells, ExpiCHO-S (trademark), VirusExpress (trademark) 293AAV producer cells, VirusExpress (trademark) 293T lentivirus producer cells, etc., but are not limited to these. As producer cells for producing AAV-derived constructs, in particular, HEK293, HEK293T, HEK293F, Hela, Sf9 and other cells can be mentioned.

[0097] In one embodiment, the cell contains a Rep gene and an ITR sequence in a chromosome, and may further contain one or more of an auxiliary gene and a nucleic acid element of an expression regulation system for the auxiliary gene in the chromosome as needed. In one embodiment, the cell (in the chromosome) contains a target gene (GOI) and a Cap gene (as needed). In one embodiment, the cell (in the chromosome) contains an auxiliary gene, an ITR, a GOI, a Cap gene, and a Rep gene (as needed). In one embodiment, the cell contains an auxiliary gene, an ITR, a GOI, a Cap gene, and a Rep gene at a locus on the chromosome.

[0098] The nucleic acid, elements of the expression regulation system, cells or virus-derived constructs of the present application or compositions containing these can be provided as a kit. In one embodiment, the present application provides a kit, which is a kit for regulating the expression of the Rep gene, which contains nucleic acids comprising the Rep gene, nucleic acids comprising auxiliary genes and expression regulation systems for auxiliary genes (especially their nucleic acid elements). In one embodiment, the present application provides a pharmaceutical pack or a kit, which is filled with one or more ingredients that can be added to the composition of the present application and contains one or more containers. Depending on the circumstances, information on permission for manufacture, use or sale for administration to humans from a government agency may also be attached to such a container in a form prescribed by a government agency that regulates the manufacture, use or sale of drugs or biological products.

[0099] The formulation steps of the drugs, etc., which are the compositions of the present application, are well known in the art and are described, for example, in the Japanese Pharmacopoeia, the United States Pharmacopoeia, and pharmacopoeias of other countries. Therefore, those skilled in the art can determine the dosage and other embodiments without undue experimentation based on the description of this specification.

[0100] In this specification, "or" is used when "at least one or more" of the items listed in the text can be used. The same applies to "or." When "within a range" of "two values" is explicitly stated in this specification, the range also includes the two values ​​themselves.

[0101] References such as scientific literature, patents, and patent applications cited in this specification are incorporated herein by reference in their entirety to the same extent as if each were specifically described.

[0102] The present invention is described above by showing preferred embodiments to facilitate understanding of the present application. The present application is described below based on examples, but the above description and the following examples are provided for illustrative purposes only and are not intended to limit the present application. Therefore, the scope of the present application is not limited to the embodiments specifically described in this specification or the examples, but is only limited to the claims. Example

[0103] As for reagents, although the products described in the Examples were specifically used, equivalent products from other manufacturers (Sigma-Aldrich, Wako Pure Chemical Industries, Ltd., Nacalai, R&D Systems, USCN Life Science INC, etc.) may be used instead.

[0104] (Construction of plasmid DNA) 1.SYNp34_pHelper The pUC19 vector plasmid (Addgene: #500005) was treated with restriction enzymes (AatII and PciI). The following three fragments (VA fragment, E4 fragment, and E2A fragment) were inserted into it using InFusion. The VA fragment was prepared using the Ad5 genome (referenced at ATCC VR-1516) as a template using the following primers: 5'-ttagtaagcttccctcctgacgcggtaggaggaggggagggtgccctgcatg-3' (SEQ ID NO: 3) and 5'-ccttttgctcacatgtcaattggtagatgtacctggacatccaggtgatgccggcg-3' (SEQ ID NO: 4). The E4 fragment was prepared using the Ad5 genome as a template using the following primers: 5'-tgtacaGGCGCGCCgaattcgttttagggcggagtaacttgtatgtgttgggaattgtag-3' (SEQ ID NO: 5) and 5'-agggaagcttactaaacggtacacaggaaacaggagacacaactccaagtg-3' (SEQ ID NO: 6). The E2A fragment was prepared using the Ad5 genome as a template using the following primers: 5'-gaaaagtgccacctgacgtcgcggccgcGCGATCGCggtacccaactccatgctcaacagtccccaggtacagccc-3' (SEQ ID NO: 7) and 5'-gaattcGGCGCGCCtgtacagcccgggcgaccgcaccctgtgacgaaagccgcccgcaag-3' (SEQ ID NO: 8).

[0105] 2.pAAV-ITR1-EGFP The pUC19 vector plasmid was treated with restriction enzymes (AatII, PciI). The following two fragments were inserted into it using InFusion. Primer sequences: 5'-cgaaaagtgccacctAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAA TTGATGAGCAA-3' (SEQ ID NO. 9), 5'-caggccCACCTGCtcagattaCAACTTTTGTATACAAAGTTGGCATTATAAAAAAGCATTGC TCATCAATTTG-3' (SEQ ID NO. 10), without template (when there is no template, the fragments are formed by primers binding to each other and extending. Since they are shorter fragments, they can be produced using this method). Primer sequences: 5'-gaGCAGGTGggcctgattggccCAACTTTTCTATACAAAGTTGGCATTATAAGAAAGCATTG CTTATCAATTTG-3' (SEQ ID NO: 11) and 5'-tggccttttgctcgcAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAA-3' (SEQ ID NO: 12), without template. The resulting plasmid (pUC19_PaqCI-SfiI) was treated with restriction enzymes (PaqCI and SfiI). Three fragments excised from a plasmid containing the 5' ITR, EGFP, and 3' ITR gene portions of seed plasmid #2 shown in Table 1 below using PaqCI, PaqCI, PaqCI, and SfiI, respectively, were inserted by ligation.

[0106] [Table 1]

[0107] 3.pAAV-ITR2wt-EGFP pUC19_PaqCI-SfiI was treated with restriction enzymes (PaqCI, SfiI) and three fragments excised from a plasmid containing the 5'ITR, EGFP, and 3'ITR gene portions of seed plasmid #3 in Table 1 using PaqCI, PaqCI, PaqCI, and SfiI, respectively, were inserted into the plasmid by ligation.

[0108] 4.pAAV-ITR4-EGFP pUC19_PaqCI-SfiI was treated with restriction enzymes (PaqCI, SfiI) and three fragments excised from a plasmid containing the 5'ITR, EGFP, and 3'ITR gene portions of seed plasmid #5 in Table 1 using PaqCI, PaqCI, PaqCI, and SfiI, respectively, were inserted into the plasmid by ligation.

[0109] 5.pAAV-ITR5-EGFP pUC19_PaqCI-SfiI was treated with restriction enzymes (PaqCI, SfiI) and three fragments excised from plasmids containing the 5'ITR of seed plasmid #6, EGFP, and 3'ITR gene portions of seed plasmid #1 in Table 1 using PaqCI, PaqCI, PaqCI, and SfiI were inserted into the plasmid by ligation.

[0110] 6.pAAV-ITR6-EGFP pUC19_PaqCI-SfiI was treated with restriction enzymes (PaqCI, SfiI), and three fragments excised from a plasmid containing the 5'ITR, EGFP, and 3'ITR gene portions of seed plasmid #7 in Table 1 using PaqCI, PaqCI, PaqCI, and SfiI, respectively, were inserted into the plasmid by ligation.

[0111] 7.pAAV-ITR7-EGFP pUC19_PaqCI-SfiI was treated with restriction enzymes (PaqCI, SfiI) and three fragments excised from a plasmid containing the 5'ITR, EGFP, and 3'ITR gene portions of seed plasmid #8 in Table 1 using PaqCI, PaqCI, PaqCI, and SfiI, respectively, were inserted into the plasmid by ligation.

[0112] 8.pAAV-ITR2 variant-EGFP pAAV-CMV (Takara 6230) was treated with restriction enzymes (EagI and BamHI). The following fragments were inserted using InFusion. Primer sequences were 5'-gccCGAATCCCGGCCGGCCACCATGGTGAGCAAG-3' (SEQ ID NO: 11) and 5'-TGCCACCCGTggatccTTACTTGTACAGCTCGTC-3' (SEQ ID NO: 12). The EGFP gene sequence (VectorBuilder) was used as a template.

[0113] 9.pR1C6 The following 10.pR2C6 (plasmid #10) was treated with restriction enzymes (SwaI and NotI). The following fragments were inserted using InFusion. The primer sequences were 5'-ATAAAGTTGgcggccgctcgcgaagcgcctcccac-3' (SEQ ID NO: 13) and 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' (SEQ ID NO: 14). The artificially synthesized AAV1 Rep gene was used as the template.

[0114] 10.pR2C6 The pUC19 vector plasmid was treated with restriction enzymes (AatII and PciI). The following three fragments were inserted into it using InFusion. Primer sequences: 5'-gaaaagtgccacctgacgtcgcggccgcggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtc acgtgagtgttttgcgac-3' (SEQ ID NO: 15) and 5'-gttcaaacctcccgcttcaaaatggagaccctgcgtgctcactcgggcttaaatacccagcgtgaccacatggtgtcgcaaaatgtcgcaaa acactca-3' (SEQ ID NO: 16), without template. The primer sequences were 5'-gcgggaggtttgaacgcgcagccgccATGCCGGGGTTTTAC-3' (SEQ ID NO: 17) and 5'-actagtAGCGCTatttaaatcatTTATTGTTCAAAGAT-3' (SEQ ID NO: 18), and the template used was pRC2-mi342 (Takara). The primer sequences were 5'-aatAGCGCTGCGATCGCggcctccaaaaaagc-3' (SEQ ID NO: 19) and 5'-ccttttgctcacatgtcaattgatcccgcccctaact-3' (SEQ ID NO: 20), and the template used was the SV40ori gene sequence (TOYOBO). The resulting plasmid was treated with restriction enzymes (SwaI, AfeI). The following fragments were inserted into it using InFusion. The primer sequences were 5'-AACAATAAatgatttaaatcagg-3' (SEQ ID NO: 21) and 5'-ggccGCGATCGCAGCGCTgtagccatggaaactagata-3' (SEQ ID NO: 22), and the template used was the artificially synthesized AAV6 Cap gene. The resulting plasmid (pR2C6_1) was treated with the restriction enzyme (NotI). The following fragments were inserted into it using InFusion. The primer sequences were 5'-gtgccacctgacgtcAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAA TTGATGAGCAAT-3' (SEQ ID NO: 23) and 5'-cgactccacccctccgcggccgcCAACTTTATTATACAAAGTTGGCATTATAAAAAAGCATTGCT CATCAATTT-3' (SEQ ID NO: 24), without a template. The resulting plasmid was treated with the restriction enzyme (AsiSI). The following fragments were inserted into it using InFusion.Primer sequences: 5'-catggctacAGCGCTGCGATCGCACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAA GCATTGCTTATCAATTTG-3' (SEQ ID NO: 25), 5'-tttttggaggccGCGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAA-3' (SEQ ID NO: 26), no template.

[0115] 11.pR3C6 The above-mentioned 10.pR2C6 (plasmid #10) was treated with restriction enzymes (SwaI and NotI). The following fragments were inserted into it using InFusion. The primer sequences were 5'-ATAAAGTTGgcggccgcagtgacgtaacgcgaagc-3' (SEQ ID NO: 27) and 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' (SEQ ID NO: 28). The artificially synthesized AAV3Rep gene was used as the template.

[0116] 12.pR5C6 The above-mentioned 10.pR2C6 (plasmid #10) was treated with restriction enzymes (SwaI and NotI). The following fragments were inserted into it using InFusion. The primer sequences were 5'-ATAAAGTTGgcggccgcgggttttgtaagcagtga-3' (SEQ ID NO: 29) and 5'-AGCCATacctgatttaaatcatTTACTGTTCTTTA-3' (SEQ ID NO: 30). The artificially synthesized AAV5Rep gene was used as the template.

[0117] 13.pR7C6 The above-mentioned 10.pR2C6 (plasmid #10) was treated with restriction enzymes (SwaI and NotI). The following fragments were inserted into it using InFusion. The primer sequences were 5'-ATAAAGTTGgcggccgcaagcgcctcccacgctg-3' (SEQ ID NO: 31) and 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' (SEQ ID NO: 32). The artificially synthesized AAV7Rep gene was used as the template.

[0118] 14.pR8C6 The above-mentioned 10.pR2C6 (plasmid #10) was treated with restriction enzymes (SwaI and NotI). The following fragments were inserted into it using InFusion. The primer sequences were 5'-ATAAAGTTGgcggccgccagagagggagtggccaa-3' (SEQ ID NO: 33) and 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' (SEQ ID NO: 34). The template used was the artificially synthesized AAV8 Rep gene.

[0119] 15.pR10C6 The above-mentioned 10.pR2C6 (plasmid #10) was treated with restriction enzymes (SwaI and NotI). The following fragments were inserted into it using InFusion. The primer sequences were 5'-ATAAAGTTGgcggccgccagagagggagtggccaa-3' (SEQ ID NO: 35) and 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' (SEQ ID NO: 36). The artificially synthesized AAV10 Rep gene was used as the template.

[0120] 16.pR2C9 pR2C6_1 was treated with restriction enzymes (SwaI and AfeI). The following fragments were inserted using InFusion. The primer sequences were 5'-AACAATAAatgatttaaatcagg-3' (SEQ ID NO: 37) and 5'-ggccGCGATCGCAGCGCTgtagccatggaaactagata-3' (SEQ ID NO: 38). The synthetic AAV9 Cap gene was used as the template.

[0121] 17.pAAV-ITR3-EGFP Gene synthesis was produced by the OGAB method. The following represents the genes and their order possessed by the plasmid: 5'ITR3 (artificial gene synthesis), CMV promoter (TAKARA), EGFP (VectorBuilder), hGH polyA signal (TAKARA), 3'ITR3 (artificial gene synthesis), ampicillin resistance gene (pUC19), Escherichia coli replication origin (pUC19). Among them, the exemplary steps of the OGAB method are shown below. The target imported nucleic acid is divided into fragments of about 1kb or less. The ends of each fragment are unique and designed to be complementary only to a specific fragment. Primers are designed for each of the fragments designed in this way, and each fragment is prepared by PCR. Each fragment is cloned into a vector plasmid, and each vector plasmid is used to transform Escherichia coli to obtain clones containing the correct sequence of each fragment. Plasmids are purified from these Escherichia coli clones, and the DNA concentration of the plasmid solution is measured. After the individual plasmid solutions are prepared and separated, they are mixed so that the amount of plasmid in each fragment is equal. Restriction enzymes are added to this mixture to generate unique DNA fragments with ends complementary only to specific fragments. An OGAB accumulation vector, cut with the same restriction enzyme, is then added to the solution in an amount appropriate for the molar concentration of each fragment. Ligation is performed, ligating the fragments (including the OGAB accumulation vector) with complementary ends. This is then added to competent Bacillus subtilis cells and cultured to obtain transformed colonies. From these colonies, a plasmid containing the desired structure is recovered.

[0122] (rAAV production (293T cells)) Schematic diagram of the construct is shown in Figure 1 shown.

[0123] One day before transfection, 6 × 10 6 293T cells were seeded in 10 cm culture dishes. After 22 hours, 9.5 mL of DMEM medium (2% FBS, 1% penicillin / streptomycin) was replaced and cultured at 37°C, 5% CO2 for 2 hours. A transfection solution was added to the confluent 293T cells. The transfection solution was prepared by mixing 250 μL of DMEM medium containing a mixture of 49 plasmids (Table 1), including one pHelper, seven pAAVs, and seven pRCs, and 250 μL of DMEM medium containing 1-fold the amount of DNA in PEIpro (registered trademark) (PolyPlus-transfection SAS).

[0124] [Table 2] Table 2: Plasmid DNA used in 293T cells

[0125] After incubation at 37°C and 5% CO₂ for 72 hours, the cells were suspended in 1 mL of 10× lysis buffer (20 mM MgCl₂, 1.5 M NaCl, 500 mM Tris, 1% Triton (registered trademark) X-100 (NACALAI TESQUE); pH 7.5). 0.5 μL of Benzonase (registered trademark) (Novagen) was added and the cells were reacted at 37°C for 60 minutes. A 2 / 100 volume of 1.9 M MgSO₄ solution was then added, and the cells were allowed to stand at room temperature for 10 minutes. The supernatant was recovered by centrifugation at 12,000 × g and 4°C for 10 minutes, and Pluronic (registered trademark) F-68 (Thermo Fisher Scientific) was added to a final concentration of 0.001%.

[0126] Three cesium chloride solutions (1.35 g / cm 3 , 1.27g / cm 3 , 1.25g / cm 3 ) and 8 mL of sample solution were separated by density gradient centrifugation at 226,000 × g, 18°C, and 1.5 hours. 3 Approximately 2 mL of rAAV was recovered from the surrounding solution. Pluronic (registered trademark) F-68 (Thermo Fisher Scientific) was added to the solution to a final concentration of 0.001%. The buffer (10% sucrose, 100 mM Tris, 200 mM NaCl, 0.005% Pluronic F-68; pH 7.4) was then replaced using a 100K Amicon Ultra-4 and concentrated to approximately 0.5 mL.

[0127] (rAAV production (293 cells)) The schematic diagram of the construct is shown in Figure 3 shown.

[0128] One day before transfection, 3.62 × 10 6293 cells were seeded in a 10 cm culture dish. After 22 hours, the medium was replaced with 9.5 mL of DMEM medium (2% FBS, 1% penicillin / streptomycin) and cultured at 37°C, 5% CO2 for 2 hours. A transfection solution was added to the confluent 293 cells. The transfection solution was prepared by mixing 250 μL of DMEM medium containing a mixture of 14 plasmids (Table 2), including one pHelper, seven pAAVs, and two pRCs, and 250 μL of DMEM medium containing 1-fold the amount of DNA in PEIpro (registered trademark) (PolyPlus-transfection SAS).

[0129] [Table 3] Table 3: Plasmid DNA used in 293 cells

[0130] After incubation at 37°C and 5% CO₂ for 72 hours, the cells were suspended in 1 mL of 10× lysis buffer (20 mM MgCl₂, 1.5 M NaCl, 500 mM Tris, 1% Triton (registered trademark) X-100 (NACALAI TESQUE); pH 7.5). 0.5 μL of Benzonase (registered trademark) (Novagen) was added and the cells were reacted at 37°C for 60 minutes. A 2 / 100 volume of 1.9 M MgSO₄ solution was then added, and the cells were allowed to stand at room temperature for 10 minutes. The supernatant was recovered by centrifugation at 12,000 × g and 4°C for 10 minutes, and Pluronic (registered trademark) F-68 (Thermo Fisher Scientific) was added to a final concentration of 0.001%.

[0131] Three cesium chloride solutions (1.35 g / cm 3 , 1.27g / cm 3 , 1.25g / cm 3 ) and 8 mL of sample solution were separated by density gradient centrifugation at 226,000 × g, 18°C, and 1.5 hours. 3 Approximately 2 mL of rAAV was recovered from the surrounding solution. Pluronic (registered trademark) F-68 (Thermo Fisher Scientific) was added to the solution to a final concentration of 0.001%. The buffer (10% sucrose, 100 mM Tris, 200 mM NaCl, 0.005% Pluronic F-68; pH 7.4) was then replaced using a 100K Amicon Ultra-4 and concentrated to approximately 0.5 mL.

[0132] (rAAV Evaluation) To quantify the rAAV genome titer, samples were treated with DNase I for 30 minutes, then reacted at 95°C for 10 minutes and diluted 1000-fold for qPCR. Primers used were 5'-CATCAATGGGCGTGGATAGC-3' (SEQ ID NO: 39) and 5'-GGAGTTGTTACGACATTTTGGAAA-3' (SEQ ID NO: 40), targeting the CMV promoter. PCR conditions were 95°C for 10 minutes, followed by 40 cycles of 95°C / 15 seconds, 55°C / 5 seconds, and 72°C / 30 seconds.

[0133] In order to determine the solid ratio, quantitative analysis by HPLC was performed. A fluorescence height meter was used as the detector, and a CIMac AAV solid / empty column (full / empty column)-0.1 (inner diameter 5.2 mm, length 4.95 mm, channel diameter 1.3 μm, manufactured by BIA separation) was used as the chromatographic column. As for the mobile phase, A: ultrapure water, B: 1 M tetramethylammonium chloride solution, C: 250 mM Bis-Tris propane (pH 9.0) was used at a flow rate of 0.5 mL per minute. The mixing ratio was changed as shown in Table 3 for AAV6 and as shown in Table 4 for AAV9. The concentration gradient was adjusted before liquid delivery. 5 μL of the sample prepared in 293T cells was injected, and 25 μL of the sample prepared in 293 cells was injected.

[0134] [Table 4] Table 4: HPLC gradient program (for AAV6)

[0135] [Table 5] Table 5: HPLC gradient program (for AAV9)

[0136] (result) The results are as follows Figure 2 and 4 As shown. As shown, AAV vector production (titer and filling rate) greatly depends on the combination of Rep and ITR. Rep2 showed high titer and filling rate in combination with all ITRs, suggesting that it interacts with all ITRs. Rep1, 7, and 10 showed high titer and filling rate in combination with all but ITR5. Rep8 had low titer and filling rate in combination with all ITRs.

[0137] (Example 2: Calculation of free energy) (method) The ITR base sequence was input into the DNA Folding Form (http: / / www.unafold.org / mfold / applications / dna-folding-form.php) of the Mfold web server to perform DNA folding (using the default settings). (result) The results are as follows Figure 5 When considered in conjunction with the results of Example 1, the free energy change (ΔG) of ITR may be in the range of -65 to -95 kcal / mol, preferably -75 to -95 kcal / mol, more preferably -80 to -90 kcal / mol, and most preferably -80 to -88 kcal / mol.

[0138] (Example 3: Other Rep Examples) In this example, it was demonstrated that even if the Rep sequence was derived from any AAV of the serotype 1 / 6 family, serotype 2 family, serotype 3 / 4 family, serotype 12 family, serotype 5 family, serotype 8 family, serotype 7 / 9 family, or serotype 10 / 11 family, the desired effect was achieved.

[0139] In this example, the same experiment as in Example 1 was performed, except that the pDNAs used for transfection of 293T cells indicated by the plasmid DNA shown in Table 2 were replaced with pR4C6, pR6C6, and pR9C6. Each base length was 6541 bp.

[0140] Rep4, Rep6, and Rep9 are expected to exhibit titers and solidification rates comparable to those of Rep3, Rep1, and Rep7, respectively.

[0141] (Note) As shown above, although the present application is illustrated using the preferred embodiments of the present application, it is understood that the scope of the present application should be interpreted only in accordance with the claims. For the patents, patent applications and documents cited in this specification, it should be understood that their contents themselves are the same as the contents specifically recorded in this specification, and their contents are cited as references to this specification. This application claims priority to Special Application No. 2023-023545 applied to the Japan Patent Office on February 17, 2023, and all of its contents are cited as references in this application. Industrial applicability

[0142] The present application provides a plasmid DNA or DNA / cationic substance complex containing Rep and ITR with high productivity of an AAV vector. Sequence Listing Free Text

[0143] SEQ ID NO: 1: CMV-F primer (CATCAATGGGCGTGGATAGC) SEQ ID NO: 2: CMV-R primer (GGAGTTGTTACGACATTTTGGAAA) SEQ ID NO: 3: Primer sequence 5'-ttagtaagcttccctcctgacgcggtaggaggaggggagggtgccctgcatg-3', SEQ ID NO: 4: Primer sequence 5'-ccttttgctcacatgtcaattggtagatgtacctggacatccaggtgatgccggcg-3' SEQ ID NO: 5: Primer sequence 5'-tgtacaGGCGCGCCgaattcgttttagggcggagtaacttgtatgtgttgggaattgtag-3' SEQ ID NO: 6: Primer sequence 5'-agggaagcttactaaacggtacacaggaaacaggagacacaactccaagtg-3' SEQ ID NO: 7: Primer sequence 5'-gaaaagtgccacctgacgtcgcggccgcGCGATCGCggtacccaactccatgctcaacagtccccaggtacagccc-3' SEQ ID NO: 8: Primer sequence 5'-gaattcGGCGCGCCtgtacagcccgggcgaccgcaccctgtgacgaaagccgcccgcaag-3' SEQ ID NO: 9: Primer sequence 5'-cgaaaagtgccacctAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAA TTGATGAGCAA-3' SEQ ID NO: 10: Primer sequence 5'-caggccCACCTGCtcagattaCAACTTTTGTATACAAAGTTGGCATTATAAAAAAGCATTGC TCATCAATTTG-3' SEQ ID NO: 11: Primer sequence 5'-gccCGAATCCCGGCCGGCCACCATGGTGAGCAAG-3' SEQ ID NO: 12: Primer sequence 5'-TGCCACCCGTggatccTTACTTGTACAGCTCGTC-3' SEQ ID NO: 13: Primer sequence 5'-ATAAAGTTGgcggccgctcgcgaagcgcctcccac-3' SEQ ID NO: 14: Primer sequence 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' SEQ ID NO: 15: Primer sequence 5'-gaaaagtgccacctgacgtcgcggccgcggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtc acgtgagtgttttgcgac-3' SEQ ID NO: 16: Primer sequence 5'-gttcaaacctcccgcttcaaaatggagaccctgcgtgctcactcgggcttaaatacccagcgtgaccacatggtgtcgcaaaatgtcgcaaa acactca-3' SEQ ID NO: 17: Primer sequence 5'-gcgggaggtttgaacgcgcagccgccATGCCGGGGTTTTAC-3' SEQ ID NO: 18: 5'-actagtAGCGCTatttaaatcatTTATTGTTCAAAGAT-3' SEQ ID NO: 19: Primer sequence 5'-aatAGCGCTGCGATCGCggcctccaaaaaagc-3' SEQ ID NO: 20: Primer sequence 5'-ccttttgctcacatgtcaattgatcccgcccctaact-3' SEQ ID NO: 21: Primer sequence 5'-AACAATAAatgatttaaatcagg-3' SEQ ID NO: 22: Primer sequence 5'-ggccGCGATCGCAGCGCTgtagccatggaaactagata-3' SEQ ID NO: 23: Primer sequence 5'-gtgccacctgacgtcAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAA TTGATGAGCAAT-3' SEQ ID NO: 24: Primer sequence 5'-cgactccacccctccgcggccgcCAACTTTATTATACAAAGTTGGCATTATAAAAAAGCATTGCT CATCAATTT-3' SEQ ID NO: 25: Primer sequence 5'-catggctacAGCGCTGCGATCGCACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAA GCATTGCTTATCAATTTG-3' SEQ ID NO: 26: Primer sequence 5'-tttttggaggccGCGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACA AATTGATAAGCAA-3' SEQ ID NO: 27: Primer sequence 5'-ATAAAGTTGgcggccgcagtgacgtaacgcgaagc-3' SEQ ID NO: 28: Primer sequence 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' SEQ ID NO: 29: Primer sequence 5'-ATAAAGTTGgcggccgcgggttttgtaagcagtga-3' SEQ ID NO: 30: Primer sequence 5'-AGCCATacctgatttaaatcatTTACTGTTCTTTA-3' SEQ ID NO: 31: Primer sequence 5'-ATAAAGTTGgcggccgcaagcgcctcccacgctg-3' SEQ ID NO: 32: Primer sequence 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' SEQ ID NO: 33: Primer sequence 5'-ATAAAGTTGgcggccgccagagagggagtggccaa-3' SEQ ID NO: 34: Primer sequence 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' SEQ ID NO: 35: Primer sequence 5'-ATAAAGTTGgcggccgccagagagggagtggccaa-3' SEQ ID NO: 36: Primer sequence 5'-AGCCATacctgatttaaatcatTTATTGCTCAGAA-3' SEQ ID NO: 37: Primer sequence 5'-AACAATAAatgatttaaatcagg-3' SEQ ID NO: 38: Primer sequence 5'-ggccGCGATCGCAGCGCTgtagccatggaaactagata-3' SEQ ID NO: 39: Primer sequence 5'-CATCAATGGGCGTGGATAGC-3' SEQ ID NO: 40: Primer sequence 5'-GGAGTTGTTACGACATTTTGGAAA-3'

Claims

A nucleic acid comprising a Rep gene derived from a first serotype of an adeno-associated virus (AAV) and an inverted terminal repeat (ITR) sequence derived from a second serotype of AAV different from the first serotype and having a ΔG value in the range of -65 to -95 kcal / mol. 2 . The nucleic acid according to claim 1 , wherein the Rep gene is derived from AAV serotype 2, and the ITR sequence has a ΔG value ranging from -75 to -95 kcal / mol. The nucleic acid according to claim 2 , wherein the ITR sequence has a ΔG value in the range of -80 to -88 kcal / mol.

4. The nucleic acid of claim 2 or 3, wherein the ITR sequence is derived from AAV serotype 1, 6 or 7. The nucleic acid according to claim 1 , wherein the Rep gene is derived from AAV serotype 1, 2, 5, 7 or 10, and the ITR sequence has a ΔG value ranging from -75 to -95 kcal / mol. The nucleic acid according to claim 5 , wherein the ITR sequence has a ΔG value in the range of -80 to -90 kcal / mol. The nucleic acid according to claim 5 or 6, wherein the ITR sequence is derived from any one of AAV serotypes 1 to 7. The nucleic acid according to any one of claims 1 to 7, further comprising a Cap gene derived from AAV. 9 . The nucleic acid according to claim 1 , further comprising a Cap gene derived from any one of AAV serotypes 1 to 10. 10 . The nucleic acid according to claim 1 , comprising the Rep gene, the ITR sequence, and the AAV-derived Cap gene on the same nucleic acid molecule or on a double-stranded nucleic acid. The nucleic acid according to any one of claims 1 to 10, further comprising an auxiliary gene derived from adenovirus AdV.

12. The nucleic acid according to any one of claims 1 to 11, wherein the combination of the Rep gene and the ITR sequence, when measured by qPCR targeting the CMV promoter or EGFP, has the ability to produce a viral vector with a titer twice or more than that of the combination of the Rep gene and ITR-5, wherein the unit of the titer is GC / mL. The nucleic acid according to any one of claims 1 to 12, which is a plasmid. The nucleic acid according to any one of claims 1 to 13, which forms a complex with a cationic substance. The nucleic acid according to claim 14 , wherein the cationic substance comprises a polymer or a liposome. 16 . A composition for producing a viral vector, comprising the nucleic acid according to claim 1 . 17 . A method for synthesizing the nucleic acid according to claim 1 , comprising the step of combining a nucleic acid comprising the Rep gene and a nucleic acid comprising the ITR.

18. A method for producing a viral vector, comprising the steps of introducing the nucleic acid according to any one of claims 1 to 15 or the composition according to claim 16 into a producer cell and forming the viral vector in the producer cell.

19. The method of claim 18, wherein at least a portion of the nucleic acid is assembled into a chromosome of the producer cell.

20. A production cell or viral vector produced by the method of claim 18 or 19.

Images