Application of RNF145 inhibitor in preparation of medicine for treating hepatocellular carcinoma

Abstract

The invention relates to the field of biological medicine, in particular to application of an RNF145 inhibitor in preparation of a hepatocellular carcinoma treatment medicine and a hepatocellular carcinoma treatment medicine composition with the RNF145 inhibitor as an active component. Experimental results show that the expression of RNF145 in tumor tissues is increased, normal proliferation of liver cancer cells is not affected, but the sensitivity of the cells to sorafenib can be reduced, and acquired drug resistance is promoted. According to the present invention, inhibition of RNF145 expression or RNF145- / -tumor cells is more sensitive to sorafenib treatment, and patients with high RNF145 expression are more difficult to benefit from sorafenib treatment, such that the new use of the RNF145 molecule in hepatocellular carcinoma treatment typing and treatment scheme selection is disclosed, and the new idea and the new approach are provided for research, development and utilization of the RNF145.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and specifically to the use of an RNF145 inhibitor in the preparation of a drug for treating hepatocellular carcinoma. Background Art

[0002] Hepatocellular carcinoma (HCC) is a common malignancy worldwide and a leading cause of cancer-related mortality. It is characterized by high morbidity, mortality, and poor prognosis. It is often caused by chronic liver diseases such as hepatitis B, hepatitis C, and alcoholic liver disease. Early symptoms are insidious, and most patients are diagnosed in the advanced stage. For early-stage HCC, radical treatments such as surgical resection and liver transplantation can achieve long-term survival for some patients, but surgery is no longer feasible for most patients by the time of diagnosis. Interventional therapy, radiotherapy, and chemotherapy are commonly used for patients in the advanced stage. Sorafenib is an oral, multi-targeted tyrosine kinase inhibitor that inhibits multiple kinases involved in tumor cell proliferation, such as the RAF / MEK / ERK pathway, as well as targets involved in tumor angiogenesis, such as VEGFR, PDGFR, and c-Kit, thereby exerting anti-tumor effects. It is commonly used in patients with good liver function. However, the efficacy of sorafenib varies significantly among patients, with some experiencing significant survival benefits while others experience poor responses. In addition, after long-term use of sorafenib, some patients may develop drug resistance, leading to tumor progression (Zhu YJ et al., New knowledge of the mechanisms of sorafenib resistance in liver cancer[J]. Acta Pharmacol Sin, 2017, 38(5):614-622.). The mechanisms of drug resistance are not yet fully understood and may be related to multiple factors, such as tumor cell heterogeneity and changes in signaling pathway activation. Therefore, improving the therapeutic effect of sorafenib and reducing drug resistance is one of the important research directions.

[0003] Ring finger protein 145 (RNF145) is an endoplasmic reticulum-resident E3 ubiquitin ligase. Currently, research on RNF145 focuses on its regulation of cholesterol metabolism. In addition, RNF145 also plays a role in tumor progression. In oral squamous cell carcinoma, the circular RNA circZDBF2 upregulates RNF145 expression through a ceRNA model and promotes the progression of oral squamous cell carcinoma via the nuclear factor NFκB signaling pathway (Rong L et al., CircZDBF2 up-regulates RNF145 by ceRNA model and recruits CEBPB to accelerate oral squamous cell carcinoma progression via NFκB signaling pathway[J]. J TranslMed. 2022 20(1):148.), indicating that RNF145 may play an important role in the biological processes of certain tumors and may become a potential therapeutic target. To date, there have been no reports of studies directly targeting RNF145 to regulate HCC progression or sorafenib resistance. Summary of the Invention

[0004] The present invention aims to provide the use of RNF145 inhibitors in the treatment of hepatocellular carcinoma, particularly in combination with sorafenib. RNF145 inhibitors can be used to enhance sorafenib-induced ferroptosis in tumor cells and inhibit acquired drug resistance, thereby improving the therapeutic efficacy of sorafenib and patient responsiveness to treatment.

[0005] After long-term and in-depth research, the present invention found that the RNF145 molecule is highly expressed in tumor tissue cells of HCC patients, and its expression level is closely related to the prognosis of the tumor. The results show that after sorafenib treatment, tumors with high expression of RNF145 have a milder degree of cell ferroptosis, a lower treatment response, and a relatively short survival period of patients. By reducing the level or activity of RNF145 in tumor tissue or cells, the sensitivity of HCC cells to sorafenib can be significantly increased, and the treatment effect can be effectively improved. The present invention reveals for the first time the important role of RNF145 inhibitors in reducing tumor acquired drug resistance, thereby providing a theoretical basis for the use of RNF145 inhibitors as acquired drug resistance inhibitors, especially in the treatment of hepatocellular carcinoma, especially in combination with sorafenib.

[0006] A first aspect of the present invention provides use of an RNF145 inhibitor in the preparation of a medicament for treating hepatocellular carcinoma.

[0007] Furthermore, the drug for treating hepatocellular carcinoma is a drug that inhibits acquired drug resistance of hepatocellular carcinoma.

[0008] The present invention targets patients with acquired drug resistance, those who have responded poorly to sorafenib or whose response is expected to be poor, those currently receiving, about to receive, or who have already received sorafenib, and those with two or more of the above conditions. Therefore, RNF145 inhibitors are preferably used in combination with therapeutic agents (such as sorafenib) to improve the response to sorafenib or in cases where further improvement is needed.

[0009] Furthermore, the RNF145 can be any of the following substances: RNF145 gene, RNF145 mRNA or cDNA, RNF145 protein, or active or characteristic fragments of any of the above.

[0010] Furthermore, the RNF145 is selected from the following sequences:

[0011] (a) RNF145 molecule having the sequence shown in Gene ID: 153830;

[0012] (b) a molecule that hybridizes under stringent conditions to the sequence defined in (a);

[0013] (c) an RNF145 molecule having a sequence identity of 70% or more (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5% or more, or any value or range of values ​​therein) with the sequence in (a) or (b), and the encoded polypeptide or protein has an activity of inhibiting acquired drug resistance, such as an RNF145 molecule obtained by codon optimization;

[0014] (d) A polypeptide encoded by any of the above RNF145 molecules, or a derivative protein in which one or more amino acids are substituted, deleted or added in the polypeptide.

[0015] As used herein, "stringent conditions" refer to any of the following: (1) hybridization and elution are performed at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, and 60°C; (2) a denaturing agent is added during hybridization, such as 50% (volume ratio) formamide, 0.1% calf serum, 0.1% Ficoll, and 42°C; (3) hybridization occurs only when the identity between the two sequences is at least 50%, preferably 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%, and more preferably 95% or more. For example, the sequence may be the complement of the sequence defined in (a).

[0016] Furthermore, the RNF145 inhibitor is selected from any one of the following: a substance that can reduce the expression level of RNF145, a substance that can reduce the activity of RNF145, and a substance that can promote the metabolism of RNF145.

[0017] Furthermore, the RNF145 inhibitor includes but is not limited to: any one of RNF145 sgRNA and CRISPR-Cas9 mRNA, small interfering RNA molecules, short hairpin RNA, antisense nucleotides, or nanoparticles, viral vectors, PEG-modified proteins, protein microspheres, liposomes or extracellular vesicles carrying any of the above substances.

[0018] Furthermore, the full-length sequences of RNF145 sgRNA and CRISPR-Cas9 mRNA, or fragments thereof, can typically be obtained through PCR amplification, recombination, or synthetic methods. For PCR amplification, primers can be designed based on the relevant nucleotide sequences disclosed herein to amplify the relevant sequences. For longer sequences, two or more PCR amplifications are typically required, followed by splicing the fragments amplified from each amplification in the correct order.

[0019] It should be understood that the RNF145 molecules of the present invention are preferably derived from humans, but other RNF145 molecules derived from other animals that are highly homologous to human RNF145 (e.g., having a sequence identity of greater than 70%, greater than 75%, greater than 80%, more preferably greater than 85%, such as 85%, 90%, 95%, 98%, or even 99% or greater) are also within the scope of the present invention. Methods and tools for comparing sequence identity are well known in the art, such as BLAST.

[0020] The RNF145 sgRNA and its inhibitors of the present invention can enhance the sensitivity and efficacy of anti-tumor therapies. They can be further used in anti-tumor treatments by enhancing sorafenib-induced ferroptosis in tumor cells and inhibiting acquired drug resistance. Furthermore, by increasing the sensitivity of anti-tumor drugs (such as sorafenib), the combined use of the RNF145 sgRNA and its inhibitors of the present invention in tumor treatment can reduce the dosage or frequency of anti-tumor drug use, thereby reducing toxic side effects and improving patient compliance.

[0021] In terms of source, the inhibitor of the present invention is selected from: natural purified substances, modified natural purified substances, semi-synthetic substances, and chemically synthesized substances; further, the inhibitor is derived from mammals, such as humans, non-human primates (such as orangutans and apes), rodents (such as rats, mice, and guinea pigs), pets (such as cats and dogs), and livestock (such as horses, cattle, sheep, pigs, and rabbits).

[0022] Furthermore, the RNF145 inhibitor is a recombinant vector comprising an expression vector and RNF145 sgRNA and Crisper-CAS9 mRNA, RNF145 siRNA, RNF145 shRNA or STRIP antisense nucleotides inserted into the expression vector.

[0023] The second aspect of the present invention provides use of an RNF145 inhibitor in combination with sorafenib in the preparation of a medicament for treating hepatocellular carcinoma.

[0024] In a third aspect, the present invention provides a pharmaceutical composition for treating hepatocellular carcinoma, comprising the RNF145 inhibitor as described above and a medically acceptable excipient, carrier or diluent.

[0025] Furthermore, the pharmaceutical composition is a drug for inhibiting acquired drug resistance in hepatocellular carcinoma.

[0026] Furthermore, the pharmaceutical composition may also include other active anti-tumor ingredients. Tumor treatment options include, but are not limited to, surgery, radiotherapy, chemotherapy, targeted therapy, and immunotherapy, with chemotherapy being preferred. In some embodiments, targeted therapy includes, but is not limited to, sorafenib, lenvatinib, and regorafenib.

[0027] That is, the present invention provides an acquired drug resistance inhibition product comprising:

[0028] (A) Inhibitors of RNF145;

[0029] (B) a pharmaceutically or immunologically acceptable carrier or excipient;

[0030] (C) Optionally, one or more other anti-tumor active ingredients.

[0031] The term "pharmaceutically / immunologically acceptable" refers to substances that are suitable for use in humans and / or animals without causing excessive adverse side effects (e.g., toxicity, irritation, or allergic reactions) and are reasonably balanced in terms of benefit and risk. An effective amount is a dose that produces the intended function or activity in humans and / or animals and is tolerated by them.

[0032] The term "pharmaceutically acceptable carrier" refers to a vehicle used to administer a therapeutic agent, including various excipients and diluents. These vehicles are not themselves active ingredients and are not unduly toxic upon administration. Suitable vehicles are well known in the art and are discussed in Remington's Pharmaceutical Sciences (Mack Pub. Co., NJ 1991).

[0033] In the pharmaceutical compositions of the present invention, the pharmaceutically acceptable carrier may comprise a liquid, such as water, saline, glycerol, and ethanol. Furthermore, these carriers may also contain auxiliary substances, such as fillers, disintegrants, lubricants, glidants, effervescent agents, wetting agents, emulsifiers, flavoring agents, pH buffering substances, and the like. Typically, these substances are formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, typically at a pH of about 5-8, preferably about 6-8.

[0034] The active substance in the pharmaceutical composition of the present invention accounts for 0.001 to 99.9 wt % of the total weight of the composition; preferably 1 to 95 wt % of the total weight of the composition, more preferably 5 to 90 wt %, and even more preferably 10 to 80 wt % of the total weight of the composition, with the remainder being pharmaceutically acceptable carriers and other additives.

[0035] The pharmaceutical composition of the present invention may be in solid form (such as granules, tablets, lyophilized powder, suppositories, capsules, sublingual tablets) or liquid form (such as oral solution) or other suitable forms. The administration routes include but are not limited to the following: (1) direct naked DNA / RNA injection; (2) linking RNF145 molecule-related sgRNA and CRISPR-Cas9 mRNA to transferrin / poly-L-lysine complexes to enhance their biological effects; (3) forming complexes between RNF145 sgRNA and CRISPR-Cas9 mRNA and positively charged lipids to overcome the difficulty of crossing the cell membrane caused by the negative charge of the phosphate backbone; (4) encapsulating RNF145 sgRNA and CRISPR-Cas9 mRNA in liposomes and mediating their entry into cells to promote the smooth entry of large molecules into cells and avoid hydrolysis by extracellular enzymes; (5) binding RNF145 sgRNA and CRISPR-Cas9 mRNA to cholesterol to increase their cytoplasmic retention time by 10 times; (6) transporting RNF145 sgRNA and CRISPR-Cas9 mRNA using immunoliposomes to achieve their specific transport to target tissues and target cells; (7) sgRNA and CRISPR-Cas9 mRNA are transfected into target cells (such as fibroblasts) in vitro, thereby effectively loading the relevant drugs into the target cells; (8) electroporation, that is, using electric current to introduce RNF145 sgRNA and CRISPR-Cas9 mRNA into the target cells.

[0036] As used in the present invention, the term "unit dosage form" means that for the convenience of taking, the composition of the present invention can be prepared into the dosage form required for single administration, including but not limited to various solid dosage forms (such as tablets), liquid dosage forms, capsules, sustained-release preparations, etc.

[0037] In some embodiments of the present invention, the pharmaceutical composition can be in unit dosage form or multiple dosage form. As needed, the composition can be administered at an appropriate frequency, such as daily, every other day, weekly, every other week or two weeks, monthly, every other month or every other month, 1 to 6 doses.

[0038] It should be understood that the effective dose of the active substance can be adjusted according to the severity of the condition of the subject to be treated. The specific dose should be determined based on the individual circumstances of the subject (e.g., weight, age, physical condition, desired effect), which is within the judgment of a skilled physician.

[0039] In certain embodiments, the present application further provides a method for treating tumor, which involves administering to a subject in need a therapeutically effective amount of RNF145 sgRNA and / or its inhibitor. More preferably, the present application also suggests that other anti-tumor drugs, especially sorafenib, can be used in combination with RNF145 sgRNA and / or its inhibitor before, simultaneously or after the administration of RNF145 sgRNA and / or its inhibitor, so as to enhance the therapeutic effect.

[0040] The administration mode of the present application is diverse, aiming to ensure that the drug can be accurately and efficiently delivered to the target site. The specific administration routes include but are not limited to oral administration, injection administration (such as direct naked DNA or protein injection, liposome-encapsulated DNA, RNA or protein injection), gold-coated gene gun bombardment, delivery of plasmid DNA carried by propagation-defective bacteria, delivery of target DNA or its encoded protein mediated by replication-defective adenovirus, electroporation technology, and intravenous, pulmonary, mucosal, nasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal or transdermal administration.

[0041] The present application has the advantages of:

[0042] 1. The applicant has obtained a large number of tumor tissue samples of hepatocellular carcinoma patients from cooperative hospitals, which provides a solid foundation and strong guarantee for the research of the present application.

[0043] 2. The detection of RNF145 uses quantitative PCR technology. This technology has been widely used in the field of clinical testing due to its simple operation, high sensitivity, good specificity and excellent repeatability. The present application provides precise detection support for the application of RNF145 in HCC treatment with the help of this mature and efficient technical means.

[0044] 3. The experimental results show that the expression level of RNF145 in tumor tissue is significantly increased, which does not affect the normal proliferation of HCC cells, but significantly reduces the sensitivity of cells to sorafenib, and promotes the occurrence of acquired drug resistance. Further research has found that by inhibiting the expression of RNF145, or in RNF145 knockout (RNF145 - / - ) tumor cells, the sensitivity to sorafenib treatment is significantly enhanced. In addition, patients with high expression of RNF145 often have difficulty in obtaining significant clinical benefits from sorafenib treatment. Therefore, the present application reveals the new application value of RNF145 molecule in HCC treatment classification and treatment scheme selection, which not only provides a new target and strategy for the precise treatment of HCC, but also opens up new ideas and ways for the in-depth research and development of RNF145, which has important scientific significance and clinical application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1: qRT-PCR detection of RNF145 expression in HCC tissues and adjacent adjacent tissues; P values ​​were calculated using T test.

[0046] Figure 2 : RNF145 knockout (RNF145 - / - ) HCC cell lines.

[0047] Figure 3 :RNF145 - / - Comparison of the half-lethal dose of sorafenib between HCC cells and wild type (WT) cells, that is, the relationship between RNF145 expression and sorafenib sensitivity.

[0048] Figure 4 :RNF145 - / - Tumor tissue growth after HCC cells and control cells were inoculated into mice and treated with sorafenib.

[0049] Figure 5 :RNF145 - / - Lipid peroxidation in HCC tissues and control tissues; RNF145 - / - Lipid peroxidation in tumor tissues after mice were inoculated with HCC cells and control cells and treated with sorafenib.

[0050] Figure 6 : Kaplan-Meier survival curve comparison of overall survival time in patients with liver cancer with high and low RNF145 expression. DETAILED DESCRIPTION

[0051] The specific embodiments provided by the present invention are described in detail below in conjunction with the examples. It should be understood that these examples are only used to illustrate the principles and applications of the present application and should not be construed as limiting the scope of the present application. Those skilled in the art may make appropriate adjustments and optimizations to the present invention according to actual needs, and these adjustments and optimizations are all within the scope of the present invention.

[0052] The reagents and raw materials used in the present invention can be obtained from commercial sources or prepared according to published methods. Experimental procedures in the following examples, where specific conditions are not specified, generally follow conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual, 4th edition, by Michael R. Green et al. (New York: Cold Spring Harbor Laboratory Press, 2017), or according to conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0053] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those known to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein may be applied to this application. The preferred embodiments and materials described herein are merely illustrative and intended to provide a reference for those skilled in the art.

[0054] Example 1: Preparation of RNF145 Detection Kit

[0055] An RNF145 detection kit was prepared according to the following composition. The kit is suitable for detecting the expression of RNF145 in biological samples by real-time quantitative reverse transcription PCR (qRT-PCR):

[0056] (a) A container containing reverse transcriptase and RNase inhibitor (Takara, Catalog No. RR037);

[0057] (b) Container filled with reverse transcription 5 buffer (75 mM KCl, 500 mM Tris-Cl, pH 8.3, 25 (C, 3 mM MgCl2, 10 mM DTT);

[0058] (c) Container containing reverse transcription primer (10 μM) of target gene;

[0059] RNF145 reverse transcription primers:

[0060] Oligo (dT): 5'-TTTTTTTTTTTTTTTTTT-3' (SEQ ID NO.7);

[0061] (d) Container containing target gene PCR upstream primer and downstream primer (10 μM each):

[0062] Quantitative PCR primers:

[0063] 5'- CCATCGTCCACCGCAAAT -3' (upstream, SEQ ID NO. 1); and

[0064] 5′- GCTGTCACCTTCACCGTTCC -3′ (downstream, SEQ ID NO. 2);

[0065] (e) Container containing internal control reverse transcription primer and PCR upstream and downstream primers (10 μM):

[0066] Reverse transcription primers for internal reference β-actin:

[0067] Oligo (dT): 5'-TTTTTTTTTTTTTTTTTT-3' (SEQ ID NO. 7);

[0068] Quantitative PCR primers:

[0069] 5'-CCATCGTCCACCGCAAAT -3' (upstream, SEQ ID NO. 3); and

[0070] 5′- GCTGTCACCTTCACCGTTCC -3′ (downstream, SEQ ID NO. 4);

[0071] (f) Container containing Taq DNA polymerase, dNTPs, fluorescent dye TB Green, and 2X PCR buffer (Takara, Cat. No. RR430);

[0072] (g) Instructions for use.

[0073] Example 2: RNF145 expression in hepatocellular carcinoma

[0074] The real-time quantitative reverse transcription PCR (qRT-PCR) method was used to analyze the expression of RNF145 mRNA levels in tumor tissues and adjacent cancer tissues of 120 patients with hepatocellular carcinoma who received sorafenib treatment from Shanghai Oriental Hepatobiliary Surgery Hospital from 2016 to 2020 using the detection kit in Example 1.

[0075] Total RNA from tissues was extracted using TRIzol (Invitrogen). qRT-PCR was performed using the test kit of Example 1 on a LightCycler 1.5 (Roche) real-time quantitative PCR instrument.

[0076] Relative quantification of RNF145 was performed using 2 -ΔΔCt The expression of 2-ΔΔCt was calculated using the real-time quantitative PCR method (β-actin was used as an internal reference) (Livak, KJ. ​​et al., Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods. 2001; 25: 402-408).

[0077] qRT-PCR analysis results showed that RNF145 expression was increased in tumor tissues compared with adjacent non-tumor tissues ( Figure 1 ).

[0078] Example 3: Relationship between RNF145 expression and sorafenib sensitivity.

[0079] According to the literature (Genome engineering using the CRISPR-Cas9 system. Ran FA, HsuPD, Wright J, Agarwala V, Scott DA, Zhang F. Nat Protoc. 2013 Nov;8(11):2281-308.), CRISPR-cas9 gene editing technology was used to knock out RNF145 expression in hepatocellular carcinoma cell HepG2, and RNF145 was obtained. - / - Cells and control cells without RNF145 knockout. The specific method is as follows:

[0080] Will RNF145 The gRNA upstream and downstream sequences were mixed and inserted into PX458 (purchased from Addgene, Plasmid #48138) as the RNF145 gRNA vector. HepG2 cells were transfected using JetPEI transfection reagent (purchased from PolyPlus, catalog number 101000053) at a final transfection concentration of 1 μg / ml.

[0081] RNF145 gRNA upstream primer:

[0082] 5'-caccCACCGTTTCAATCGACCAAGTTCCA-3' (SEQ ID NO.5)

[0083] RNF145 gRNA downstream primers:

[0084] 5'-aaacAAACTGGAACTTGGTCGATTGAAAC-3' (SEQ ID NO.6)

[0085] After transfection, single cells were sorted into well plates using a flow cytometer (Sony SH800 Cell Sorter). Monoclonal cells were collected 3 weeks later, and proteins were extracted for Western Blot analysis.

[0086] Western Blot was performed according to the literature (Tao Y et al., UFL1 promotes antiviral immune response by maintaining STING stability independent of UFMylation. Cell Death Differ (2022). https: / / doi.org / 10.1038 / s41418-022-01041-9), and RNF145 antibody (purchased from Proteintech, Cat. No. 24524-1-AP) was diluted 1:500. RNF145 successfully knocked out cell clones were selected as RNF145 - / - cells, and non-knockout cells served as control cells ( Figure 2 ).

[0087] Stimulation of RNF145 with different concentrations of sorafenib - / - Cells and control cells were tested using CCK8 (purchased from Selleck, catalog number B34302) to detect the cell survival rate and calculate the half cell lethal dose (IC50). - / - The IC50 of cells was significantly lower than that of control cells, indicating that RNF145 - / - Cells are more sensitive to sorafenib ( Figure 3 ).

[0088] Example 4: Relationship between RNF145 expression and the therapeutic efficacy of sorafenib in liver cancer

[0089] Nude mice are mutant mice with congenital thymus defects and are good tool mice for inoculating human cells. - / - HepG2 cells and control HepG2 cells were inoculated subcutaneously into mice. Tumor volume was measured periodically to compare the growth rates of the two tumors. Tumor volume was calculated according to the literature (Qi, R. et al., Notch1 signaling inhibits growth of human hepatocellular carcinoma through induction of cell cycle arrest and apoptosis. Cancer Res. 2003;63:8323-8329).

[0090] The results showed that there was no difference in the size of the two tumors in nude mice ( Figure 4 ), describes RNF145 - / -There was no significant difference in proliferation and apoptosis between RNF145 and control HepG2 cells. - / - The growth rate of tumor cells is significantly slower than that of control cells, indicating that RNF145 - / - Tumor cells are more sensitive to sorafenib treatment.

[0091] The above results suggest that RNF145 does not affect the normal proliferation of liver cancer cells, but can reduce the sensitivity of cells to sorafenib and promote the occurrence of acquired drug resistance.

[0092] Example 5: Relationship between RNF145 expression and the severity of ferroptosis in liver cancer cells

[0093] Tumor tissues of the subcutaneous tumor-bearing nude mice in Example 4 were collected on day 21 after treatment, and tissue lipid peroxides were detected and histochemically stained.

[0094] Tissue peroxide assay (purchased from Nanjing Jiancheng Biological Research Institute, catalog number A106-1-2): Mouse tumor tissue was accurately weighed and added to normal saline at a weight (g): volume (ml) ratio of 1:9. The mixture was homogenized in an ice-water bath and centrifuged at 2500 rpm for 10 minutes. The supernatant was collected for analysis. 200 μL of supernatant was added to 650 μL of reaction solution, mixed, and incubated at 45°C for 60 minutes. The supernatant was removed and centrifuged at 4000 rpm for 10 minutes. 200 μL of supernatant was added to a 96-well plate and the OD value was measured at 586 nm.

[0095] Histochemical staining: Mouse tumor tissue was obtained, embedded, and sectioned before the experiment began. Slides were placed in a dedicated slide rack and dewaxed to water using a 65°C slide oven for 1.5-3 hours. Dewax in xylene for 30 minutes, 30 minutes, and 20 minutes (optional). Washes were performed in a gradient of ethanol: 100%, 100%, 95%, 85%, 75%, distilled water, and distilled water for 5 minutes each. Antigen retrieval was then performed using 3% H₂O₂ in PBS to block endogenous catalase. Antigen retrieval was performed at room temperature for 20 minutes in the dark. 700-800 ml of antigen retrieval solution was added to the autoclave and timed for 2.5 minutes. The slide rack was then returned to its box and the hot antigen retrieval solution was added. The slides were allowed to cool to room temperature and then washed twice in PBS on a shaker. After removing the slides, circle the tissue locations with a histochemical pen. Block each sample with 100-200 μl of goat serum and incubate at room temperature for 30-60 minutes. Dilute the primary antibody to the working concentration (1:50, 1:100, 1:200, 1:500) in antibody diluent and incubate overnight in a humidified chamber. Wash three times with PBS on a shaker, then incubate with the secondary antibody for 40 minutes at 37°C. Wash three times with PBS. DAB is added for color development. Once the sections appear light brown, aspirate the DAB and return them to the slide rack. Rinse the slide rack under running tap water and stain with hematoxylin for 40 seconds. Rinse the slide rack several times in hydrochloric acid-alcohol to remove nonspecific hematoxylin. Return the slides to tap water; the slides should now appear light purple with a hint of brown. After completion, rinse with a gentle stream of tap water for approximately five minutes and dehydrate with a reverse-gradient alcohol solution: 75%, 80%, 95% for 2 minutes each, and 100% for 5 minutes each twice. Finally, seal the slides with a resin adhesive containing xylene.

[0096] The results showed that RNF145 - / - The total lipid peroxide (LPO) in tumor tissue Figure 5 ), or histochemical MDA (purchased from Abcam, catalog number ab283311) staining were significantly higher than those in the control group ( Figure 5 ), suggesting that RNF145 deficiency promotes lipid peroxidation in liver cancer cells.

[0097] The above results suggest that RNF145 - / - The tumors were more sensitive to sorafenib treatment and the degree of lipid peroxidation was higher than that in the control group.

[0098] Example 6: Relationship between RNF145 expression and HCC

[0099] Real-time quantitative PCR was used to measure RNF145 expression in tumor tissues of 120 patients receiving sorafenib therapy, using the kit method described in Example 1. The patients were divided into two groups, 60 high and 60 low, based on the median RNF145 expression level. No significant differences were observed between the two groups in terms of age, gender, TNM stage, tumor location, or tumor size (Table 1).

[0100] Table 1. Correlation analysis between RNF145 expression in hepatocellular carcinoma tissues and clinical factors of patients

[0101]

[0102] The correlation between RNF145 expression and patient survival time was analyzed, and the P value was calculated using the log-rank test. The results are as follows Figure 6 The results showed that high expression of RNF145 was significantly associated with shorter overall survival time of patients.

[0103] Cox regression analysis was performed to identify risk factors affecting HCC prognosis. Hazard ratios (95% confidence intervals) and P values ​​were calculated using univariate and multivariate Cox regression analysis in SPSS 17.0. Table 2 shows the results of univariate and multivariate Cox regression analysis of risk factors affecting HCC prognosis in 120 patients (same as in Table 1). Age and sex adjustment was used in the multivariate analysis.

[0104] Table 2 Univariate and multivariate Cox regression analysis of risk factors affecting the prognosis of HCC patients

[0105]

[0106] Univariate and multivariate analyses revealed that high expression of RNF145 was a significant and independent risk factor for predicting lower survival time in HCC patients.

[0107] These results indicate that RNF145 expression is significantly elevated in patients with liver cancer, and that elevated RNF145 expression can inhibit sorafenib-induced ferroptosis in tumor cells, leading to acquired drug resistance. Clinically, elevated RNF145 expression is significantly associated with a poorer prognosis, and patients with elevated RNF145 expression are less likely to benefit from sorafenib treatment. These results suggest a close correlation between RNF145 and tumor development and progression, and that RNF145 can reduce the responsiveness and efficacy of sorafenib treatment by inhibiting sorafenib-induced ferroptosis.

[0108] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art may make various equivalent modifications or substitutions without departing from the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. Use of RNF145 inhibitors in the preparation of drugs for the treatment of hepatocellular carcinoma.

2. The use according to claim 1, characterized in that The drug for treating hepatocellular carcinoma is a drug for inhibiting acquired drug resistance of hepatocellular carcinoma.

3. The use according to claim 1, characterized in that The RNF145 is selected from any one of the following: RNF145 gene, RNF145 mRNA or cDNA, RNF145 protein, or active or characteristic fragments of any of the above; the RNF145 inhibitor is selected from any one of the following: a substance that can reduce the expression level of RNF145, a substance that can reduce the activity of RNF145, and a substance that can promote the metabolism of RNF145.

4. The use according to claim 3, characterized in that The RNF145 inhibitor is selected from any one of the following: any one of RNF145 sgRNA and Crisper-CAS9 mRNA, small interfering RNA molecules, short hairpin RNA, antisense nucleotides, or nanoparticles, viral vectors, PEG-modified proteins, protein microspheres, liposomes or extracellular vesicles carrying any of the above substances.

5. The use according to claim 4, characterized in that The RNF145 inhibitor is a recombinant vector comprising an expression vector and RNF145 sgRNA and Crisper-CAS9 mRNA, RNF145 siRNA, RNF145 shRNA or STRIP antisense nucleotides inserted into the expression vector.

6. Use of RNF145 inhibitors in combination with sorafenib in the preparation of drugs for the treatment of hepatocellular carcinoma.

7. A pharmaceutical composition for treating hepatocellular carcinoma, characterized in that: The invention comprises an RNF145 inhibitor and a medically acceptable excipient, carrier or diluent.

8. The pharmaceutical composition according to claim 7, characterized in that The pharmaceutical composition is a drug for inhibiting acquired drug resistance of hepatocellular carcinoma.

9. The pharmaceutical composition according to claim 7, characterized in that The pharmaceutical composition also includes other anti-tumor active ingredients.

10. The pharmaceutical composition according to claim 9, characterized in that The other anti-tumor active ingredient is sorafenib.

Images