A sex-specific molecular marker method for largemouth bass and its application

By using sex-specific primer pairs for PCR or qPCR amplification, combined with SDS lysis to extract DNA, the problem of expensive, complex, and costly equipment for sex identification of largemouth bass has been solved, achieving rapid, accurate, and low-cost sex identification.

CN120775970BActive Publication Date: 2026-03-13ZHEJIANG DANSHUI FISHERY RESEARCH INSTITUTE (ZHEJIANG DANSHUI FISHERY ENVIRONMENTAL MONITORING STATION)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-10
Publication Date
2026-03-13

Smart Images

  • Figure CN120775970B_ABST
    Figure CN120775970B_ABST
Patent Text Reader

Abstract

This invention relates to the fields of molecular biology and aquatic breeding technology, and particularly to a sex-specific molecular marker method for largemouth bass and its application, comprising the following steps: Step 1, extracting genomic DNA from the fin tissue of largemouth bass; Step 2, performing PCR or qPCR amplification using sex-specific primer pairs; Step 3, determining sex based on the amplification results: if a specific band of 350bp~380bp is amplified in ordinary PCR, or if the CT value is ≤27 in qPCR, it is determined to be male; if no amplified band or the CT value is >27, it is determined to be female; the primers and probes designed based on the SVER-Y region have high specificity and low false positive rate; wide applicability: suitable for largemouth bass at different growth stages; rapid and efficient: qPCR can be completed within 2 hours, suitable for large-scale sample screening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and aquatic breeding technology, and in particular to a sex-specific molecular marker method for largemouth bass and its application. Background Technology

[0002] Largemouth bass (Micropterus salmoides) is one of my country's important freshwater economic fish species, widely favored by fish farmers due to its rapid growth and delicious flesh. Female largemouth bass typically grow faster than males, therefore sex-controlled breeding is crucial for improving aquaculture efficiency. Currently, sex determination in largemouth bass mainly relies on the following methods: physiological sex determination: observing gonadal morphology through dissection; only applicable to sexually mature individuals and requires necropsy; chromosome analysis: highly accurate, but complex to operate, requiring specialized equipment and technicians; endoscopic techniques: require surgical incisions, expensive equipment, and limited applicability; ultrasound detection: unsuitable for small individuals, high equipment cost; hormone detection: costly, hormone levels fluctuate greatly, prone to misjudgment; whole genome sequencing: highly accurate but expensive, complex data analysis, and time-consuming. Summary of the Invention

[0003] The purpose of this invention is to provide a sex-specific molecular marker method for largemouth bass and its application, so as to solve the problems existing in the prior art.

[0004] The above-mentioned technical objective of the present invention is achieved through the following technical solution:

[0005] A sex-specific molecular marker method for largemouth bass includes the following steps:

[0006] Step 1: Extract genomic DNA from the fin tissue of the largemouth bass;

[0007] Step 2: Perform conventional PCR or qPCR amplification using sex-specific primer pairs;

[0008] Step 3: Determine the sex based on the amplification results: If a specific band of 350bp~380bp is amplified in ordinary PCR, or the CT value is ≤27 in qPCR, it is determined to be male; if there is no amplified band or the CT value is >27, it is determined to be female.

[0009] In a further embodiment, the sex-specific primer pair includes:

[0010] Standard PCR primer pairs:

[0011] Forward primer F: ACAGCCTGCCTGAGGAAATC (SEQ ID NO:1)

[0012] Reverse primer R: TCACTGCAATGCTGACGACT (SEQ ID NO: 2)

[0013] qPCR primer pairs and probes:

[0014] Forward primer F: CAGTGACGTCTCCTGTGGTC (SEQ ID NO:3)

[0015] Reverse primer R: TCTTGTTGGTGCTTTCCCACA (SEQ ID NO:4)

[0016] Probe sequence: TGATGAGTCTCTGGCTCCGGCTTG (SEQ ID NO: 5)

[0017] In a further embodiment, the genomic DNA extraction employs the SDS lysis method, which includes steps such as liquid nitrogen grinding, proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation.

[0018] In a further embodiment, the conventional PCR reaction system comprises: 2×PCR premix, betaine additive, primer pairs and DNA template, and the reaction procedure includes pre-denaturation, denaturation, and annealing / extension steps.

[0019] In a further embodiment, the qPCR reaction system comprises: 2×qPCR premix, betaine additive, primer pairs, probes and DNA template, and the reaction procedure includes pre-denaturation, denaturation, annealing / extension and acquisition of fluorescence signals.

[0020] In a further embodiment, the method is applicable to sex determination of juvenile and adult largemouth bass.

[0021] In a further embodiment, the method can also be used in sex-controlled breeding of largemouth bass.

[0022] The present invention also provides a kit for sex identification of largemouth bass, comprising the above-mentioned sex-specific primer pairs and / or probes, PCR or qPCR reaction premix, betaine additive, DNA extraction reagent and instructions for use.

[0023] In summary, this invention has the following advantages: simple operation: no complex equipment is required, and it can be completed in a regular laboratory; low cost: compared with whole genome sequencing, the cost of a single test is significantly reduced; high accuracy: primers and probes designed based on the SVER-Y region have high specificity and low false positive rate; wide applicability: suitable for largemouth bass at different growth stages; rapid and efficient: qPCR can be completed within 2 hours, suitable for large-scale sample screening. Attached Figure Description

[0024] Figure 1This is an electrophoresis image of a routine PCR amplification result, showing a band at 368bp in the male sample;

[0025] Figure 2 This is a qPCR amplification curve, showing that the CT value of the male sample is ≤27;

[0026] Figure 3 This is a schematic diagram of primer specificity comparison. Detailed Implementation

[0027] To facilitate understanding of the content described in this invention, the technical solutions of this invention will be further explained below with reference to specific embodiments; however, this invention is not limited thereto. All reagents or instruments used, unless otherwise specified, are commercially available conventional products.

[0028] Example 1:

[0029] like Figures 1-3 As shown, a sex-specific molecular marker method for largemouth bass and its application are described.

[0030] Includes the following steps:

[0031] Step 1: Extract genomic DNA from the fin tissue of the largemouth bass;

[0032] Step 2: Perform PCR or qPCR amplification using sex-specific primer pairs;

[0033] Step 3: Determine sex based on amplification results: If a specific band of 350bp~380bp is amplified in conventional PCR, with 368bp being the optimal value, or if the CT value is ≤27 in qPCR, then it is determined to be male; if no amplified band or the CT value is >27, then it is determined to be female; the sex-specific primer pairs include:

[0034] Standard PCR primer pairs:

[0035] Forward primer F: ACAGCCTGCCTGAGGAAATC;

[0036] Reverse primer R: TCACTGCAATGCTGACGACT;

[0037] qPCR primer pairs and probes:

[0038] Forward primer F: CAGTGACGTCTCCTGTGGTC;

[0039] Reverse primer R: TCTTGTTGGTGCTTTCCCACA;

[0040] Probe sequence: TGATGAGTCTCTGGCTCCGGCTTG; Genomic DNA extraction was performed using SDS lysis, including liquid nitrogen grinding, proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation; The standard PCR reaction system includes: 2×PCR premix, betaine additive, primer pairs, and DNA template, with the reaction program including pre-denaturation, denaturation, and annealing / extension steps; The qPCR reaction system includes: 2×qPCR premix, betaine additive, primer pairs, probe, and DNA template, with the reaction program including pre-denaturation, denaturation, annealing / extension, and fluorescence signal acquisition; A kit containing sex-specific primer pairs and / or probes is included; PCR or qPCR reaction premix; betaine additive; DNA extraction reagent; Instructions for use; This kit is suitable for sex identification of juvenile and adult largemouth bass.

[0041] Specific implementation process:

[0042] DNA extraction: Take 50 mg of fin tissue, grind it with liquid nitrogen, add lysis buffer and proteinase K, digest at 56 °C for 1 hour, extract with phenol-chloroform, precipitate with ethanol, wash and dissolve in sterile water;

[0043] PCR reaction: Primers F (SEQ ID NO: 1) and R (SEQ ID NO: 2) were used. The reaction system was as follows: 2×PCR premix: 12.5 μl; primer F (10 μM): 0.4 μl; primer R (10 μM): 0.4 μl; betaine: 4 μl; DNA template: 2 μl; DEPC water: 5.7 μl; total volume: 25 μl.

[0044] Reaction procedure: 37°C for 5 min; then 95°C for 5 min; finally 95°C for 15 seconds, then 60°C for 30 seconds, for 34 cycles.

[0045] Results analysis: Electrophoresis showed that if a band appeared at 368bp, the animal was male; otherwise, it was female.

[0046] Example 2:

[0047] qPCR sex determination; DNA extraction; qPCR reaction: using primers F (SEQ ID NO:3), R (SEQ ID NO:4) and probe (SEQ ID NO:5), the reaction system is as follows: 2×qPCR premix: 12.5 μl; primer F: 0.4 μl; primer R: 0.4 μl; probe: 0.2 μl; betaine: 4 μl; DNA template: 2 μl; DEPC water: 5.5 μl; total volume: 25 μl.

[0048] Reaction procedure: 37℃ for 5 min; 95℃ for 5 min; 95℃ for 15 seconds, then quickly switch to 60℃ for 30 seconds (for fluorescence collection), 45 cycles.

[0049] Results analysis: If the CT value is ≤27, the animal is male; if it is >27, the animal is female.

[0050] Detailed implementation of the qPCR sex determination method:

[0051] The qPCR (real-time quantitative polymerase chain reaction) sex determination method, based on the sex-specific primer and probe system developed in this invention, achieves rapid and accurate sex identification of individuals by amplifying and detecting the target sequence of the Y chromosome-specific SV enriched region (SVER-Y) in the genomic DNA of largemouth bass. This embodiment will elaborate on the implementation steps, technical principles, optimization process, and verification results of this method.

[0052] I. Optimization and Implementation of DNA Extraction Methods

[0053] Although SDS lysis was used to extract genomic DNA in Example 1, the DNA extraction process was further optimized in this example to improve the sensitivity and stability of qPCR detection. The specific steps are as follows:

[0054] Sample pretreatment: Take about 50 mg of dorsal or caudal fin tissue from the largemouth bass, freeze it rapidly in liquid nitrogen, grind it into powder, and transfer it into a 1.5 mL centrifuge tube.

[0055] Cell lysis: Add 1 mL of lysis buffer (containing 100 mM Tris-HCl pH 8.0, 10 mM EDTA, 0.5% SDS, and 20 μg / mL RNase A), vortex to mix, then add 20 μL of proteinase K (20 mg / mL), and digest in a 56°C water bath overnight (12-16 hours) until the tissue is completely lysed.

[0056] DNA purification: Extract twice with phenol-chloroform-isoamyl alcohol (25:24:1), centrifuged at 12000 rpm for 10 minutes each time, and carefully aspirated the supernatant; add 0.1 volume of 3 M sodium acetate (pH 5.2) and 2 volumes of pre-cooled anhydrous ethanol, and precipitate at -20℃ for 30 minutes; after centrifugation, wash the precipitate twice with 70% ethanol, air dry for 5 minutes, and dissolve in 50 μL TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).

[0057] DNA quality testing: DNA concentration and purity were determined using a NanoDrop spectrophotometer (A260 / A280 ratio should be between 1.8 and 2.0), and DNA integrity was verified by 1% agarose gel electrophoresis.

[0058] II. Design and Specificity Verification of qPCR Primers and Probes

[0059] Based on the SVER-Y region (located on chromosome 10) identified in previous genome alignment analysis, specific primers and TaqMan probes were designed:

[0060] Forward primer F: 5'-CAGTGACGTCTCCTGTGGTC-3' (SEQ ID NO: 3);

[0061] Reverse primer R: 5'-TCTGTTGGTGCTTTCCCACA-3' (SEQ ID NO: 4);

[0062] Probe sequence: 5'-FAM-TGAATGAGTCTCTGGCTCCGGCTTG-BHQ1-3' (SEQ ID NO: 5);

[0063] To verify the specificity of the primers and probes, the following experiments were conducted:

[0064] Sequence alignment using the BLAST tool confirmed that the primers and probes specifically bound to the SVER-Y region and showed no significant homology with other genomic regions.

[0065] qPCR amplification was performed using genomic DNA from female and male largemouth bass as templates. The results showed that male samples exhibited a typical S-shaped amplification curve with a stable CT value between 22 and 24; female samples showed no amplification signal (CT value > 35 or undetectable).

[0066] The specificity of the amplification products was verified by melting curve analysis: male samples showed a single peak (Tm value of about 78℃), while female samples did not have a specific peak shape.

[0067] Cross-reactivity test: Amplification was performed using genomic DNA from common farmed fish such as mandarin fish, tilapia, etc. No non-specific amplification was observed, demonstrating that the primer system has high species specificity for largemouth bass.

[0068] III. Establishment and optimization of the qPCR reaction system; After multiple optimization experiments, the optimal reaction system was determined as follows (25 μL system):

[0069] 2× TaqMan Universal PCR Master Mix (containing UNG enzyme): 12.5 μL;

[0070] Forward primer (10 μM): 0.4 μL;

[0071] Reverse primer (10 μM): 0.4 μL;

[0072] TaqMan probe (10 μM): 0.2 μL;

[0073] 5 M Betaine: 4 μL;

[0074] Genomic DNA template (50 ng / μL): 2 μL;

[0075] Nuclease-free water: 5.5 μL;

[0076] Reaction program settings:

[0077] UNG enzyme activation: Hold at 37°C for 2 minutes (optional, to prevent residual contamination).

[0078] Pre-denaturation: Hold at 95℃ for 5 minutes

[0079] Amplification cycle (45 cycles): denaturation at 95°C for 15 seconds, annealing / extension at 60°C and acquiring fluorescence signal for 30 seconds; cooling: hold at 25°C for 10 seconds.

[0080] Instrument setup: Use an Applied Biosystems QuantStudio 5 or similar qPCR instrument, select the FAM channel to collect fluorescence signals, set the threshold to 10 times the baseline standard deviation of the fluorescence signal, and set the baseline cycle to 3-15 cycles.

[0081] IV. Establishment and Quantitative Analysis of Standard Curves

[0082] To verify the quantitative accuracy and reproducibility of the qPCR method, a standard curve was constructed:

[0083] The genomic DNA of male largemouth bass was serially diluted (100 ng / μL, 10 ng / μL, 1 ng / μL, 0.1 ng / μL, 0.01 ng / μL) to serve as a standard.

[0084] For each concentration, three replicate wells were set up for qPCR amplification, and the CT value was recorded.

[0085] A standard curve was plotted with the logarithm of DNA concentration on the x-axis and the CT value on the y-axis. The results showed good linearity within the concentration range of 0.01-100 ng / μL (R0.01). 2The amplification efficiency is between 90% and 105%, which is greater than 0.99, and meets the quantitative requirements.

[0086] Sensitivity tests showed that this method can stably detect target sequence DNA down to 0.01 ng / μL, equivalent to about 3 genome copies.

[0087] V. Establishment and Verification of Gender Determination Criteria

[0088] By conducting blinded testing on largemouth bass samples with known sex (verified through dissection), the following sex determination criteria were established:

[0089] CT value ≤ 27: identified as male (corresponding target sequence successfully amplified);

[0090] CT value > 27 or undetectable (NoCT): female (target sequence missing or below the detection limit);

[0091] To verify the reliability of this standard, 240 samples (120 males and 120 females) were tested:

[0092] The CT values ​​of male samples ranged from 21.5 to 24.8 (mean 23.2 ± 0.8).

[0093] No amplification signal was observed in any of the female samples (CT value > 35);

[0094] The accuracy rate of gender determination reached 100% (240 / 240).

[0095] In addition, repeatability tests (3 times within the group) and reproducibility tests (different operators, different instruments) were performed on the same batch of samples. The results showed that the coefficient of variation (CV) of the CT values ​​was less than 2%, indicating that the method has high repeatability and stability.

[0096] VI. Practical Application Examples and Large-Scale Screening Process

[0097] This method has been applied to a sex control project at a largemouth bass breeding center. The specific process is as follows:

[0098] Sample collection: 1000 juvenile fish (5-8 cm in length) aged 3-5 months were randomly selected from the breeding pond, and approximately 2 mm samples were cut. 2 Fin tissue was placed in 96-well plates, and 200 μL of DNA preservation solution (containing 25 mM NaOH and 0.2 mM EDTA) was added to each well.

[0099] High-throughput DNA extraction: A magnetic bead-based nucleic acid extraction system (such as the TIANamp Marine Animals DNAKit) was used, and an automated workstation (such as the KingFisher Flex) was used to process 96 samples simultaneously, with an extraction time of approximately 45 minutes.

[0100] qPCR detection: A 384-well qPCR plate was used, with two technical replicates per sample. A positive control (male DNA), a negative control (female DNA), and a blank control (water) were also included. The entire amplification process takes approximately 1.5 hours.

[0101] Results analysis: The instrument automatically generates amplification curves and CT values, and automatically determines the sex and generates a report by using a custom analysis template (setting the CT threshold to 27).

[0102] Data analysis: Of the 1000 fish identified, 512 were male and 488 were female, a sex ratio close to 1:1, consistent with theoretical expectations. Fifty fish were randomly selected for dissection and verification, and the results were completely consistent with qPCR results.

[0103] VII. Technological Advantages and Innovations

[0104] Compared with existing technologies in this field, this qPCR sex determination method has the following significant advantages:

[0105] Fast detection speed: From sample processing to result output, it can be completed within 3 hours, which is much faster than traditional chromosome analysis (3-5 days) or whole genome sequencing (1-2 weeks).

[0106] Low cost: The cost of testing a single sample is about 5 RMB, which is less than 1 / 100 of the cost of whole genome sequencing.

[0107] Wide applicability: It is not only applicable to sexually mature individuals, but can also accurately identify juvenile fish (body length ≥ 1.5 cm) that are over 20 days old.

[0108] High degree of automation: It can be integrated with automated nucleic acid extraction and qPCR systems to achieve high-throughput screening of thousands of samples per day.

[0109] The results are objective and accurate: quantitative detection based on fluorescence signals avoids subjective misjudgment, and DNA quality and amplification efficiency can be further monitored by setting internal reference genes (such as β-aCTin).

[0110] VIII. Precautions and Troubleshooting

[0111] DNA quality requirements: Degraded DNA may cause false negatives. It is recommended that the A260 / A280 ratio be between 1.8 and 2.0, and that no degradation be verified by electrophoresis.

[0112] Inhibitor effects: Residual phenol, ethanol, or hemoglobin in the sample may inhibit the PCR reaction. It is recommended to eliminate the effect by diluting the sample or purifying the DNA with a purification column.

[0113] Contamination control: Strictly separate operations (sample processing, PCR preparation, amplification and detection), use UNG enzyme to prevent carryover contamination, and wipe the workbench regularly with 10% sodium hypochlorite.

[0114] Instrument calibration: Perform optical and temperature calibrations on the qPCR instrument regularly to ensure the accuracy of fluorescence acquisition and temperature control.

[0115] Primer and probe stability: The lyophilized primers and probes can be stored at -20°C for 2 years. Avoid repeated freeze-thaw cycles (alteration storage is recommended).

[0116] The qPCR sex determination method provided in this embodiment has been verified through extensive experiments and has advantages such as high reliability, good reproducibility, and ease of standardization. It can provide strong technical support for sex control breeding of largemouth bass. Those skilled in the art can make appropriate adjustments to the reaction system, program parameters, etc., according to actual needs, and all such adjustments fall within the protection scope of this invention.

[0117] The technical solutions in the embodiments of the present invention have been clearly and completely described. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0118] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A method for gender-specific molecular marker of Micropterus salmoides, characterized in that, The method comprises the following steps: Step 1: extracting genomic DNA from the fin tissue of Micropterus salmoides; Step 2: performing common PCR or qPCR amplification using a gender-specific primer pair; Step 3: determining the gender according to the amplification results: if a specific band of 350-380 bp is amplified in common PCR or the CT value is ≤27 in qPCR, it is determined as male; if no band is amplified or the CT value is >27, it is determined as female; The gender-specific primer pair comprises: A common PCR primer pair: Forward primer F: ACAGCCTGCCTGAGGAAATC; Reverse primer R: TCACTGCAATGCTGACGACT; A qPCR primer pair and a probe: Forward primer F: CAGTGACGTCTCCTGTGGTC; Reverse primer R: TCTGTTGGTGCTTTCCCACA; Probe sequence: TGAATGAGTCTCTGGCTCCGGCTTG. The genomic DNA is extracted by SDS lysis method, which comprises the steps of liquid nitrogen grinding, proteinase K digestion, phenol-chloroform extraction and ethanol precipitation.

2. The method of claim 1, wherein, The common PCR reaction system comprises 2×PCR premix, betaine additive, a primer pair and a DNA template, and the reaction procedure comprises pre-denaturation, denaturation and annealing / extension steps.

3. The method of claim 1, wherein, The qPCR reaction system comprises 2×qPCR premix, betaine additive, a primer pair, a probe and a DNA template, and the reaction procedure comprises pre-denaturation, denaturation and annealing / extension and fluorescence signal collection.

4. The method of claim 1, wherein, 5. Application of the method according to any one of claims 1-4 in gender control breeding of Micropterus salmoides. The application is suitable for gender identification of juvenile and adult Micropterus salmoides.

6. Use according to claim 5, characterized in that, ​