Disease-resistant gene OsSTOMR and application thereof in improving disease resistance of plants and preventing and controlling diseases

Abstract

The invention belongs to the technical field of gene engineering, and discloses a disease-resistant gene OsSTOMR and application thereof in improving the disease resistance of plants and preventing and controlling diseases, the sequence of a protein coded by the gene is shown as SEQ ID NO.2, and the nucleotide sequence of the coded protein is shown as SEQ ID NO.1. Molecular genetic experiments show that in a tobacco mutant (nbstomr) in which a receptor NbSTOMR gene for recognizing a pathogen-related molecular mode STOM is knocked out, expression of OsSTOMR can enhance generation of reactive oxygen induced by STOM in the mutant, it is considered that OsSTOMR is a mode recognition receptor for recognizing the pathogen-related molecular mode STOM, and expression of OsSTOMR in tobacco can enhance the disease resistance of tobacco to sclerotinia sclerotiorum. Therefore, the OsSTOMR provided by the invention is a disease-resistant related mode recognition receptor in rice, can improve the disease resistance of tobacco to sclerotinia sclerotiorum, and can be applied to disease-resistant breeding of tobacco.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, in particular to the field of disease-resistant genes OsSTOMR and its application in improving plant disease resistance and disease control. Background Art

[0002] Plants have evolved a complex and highly effective immune system over the course of long evolutionary processes to defend against a wide range of pathogens. Unlike animals, plants lack mobile immune cells and therefore rely on innate cellular defense mechanisms to identify and prevent pathogen invasion. Pattern recognition receptors (PRRs) are the first line of defense in the plant immune system, sensing conserved molecular structures widely present in pathogens, known as pathogen-associated molecular patterns (PAMPs), thereby triggering pattern-triggered immunity (PTI). PTI typically manifests as a series of defensive responses, including a burst of reactive oxygen species, activation of MAPK signaling, upregulation of immune-related gene expression, and cell wall reinforcement, effectively inhibiting the initial invasion of pathogens.

[0003] Over the past two decades, several important PRRs and the PAMPs they recognize have been identified. For example, FLS2 in Arabidopsis thaliana recognizes the bacterial flagellin fragment flg22; EFR recognizes the bacterial elongation factor EF-Tu; and LYK5 / CERK1 recognizes fungal chitin oligosaccharides. Rice also possesses a series of PRRs, such as OsCERK1 and OsCEBiP, that are involved in chitin recognition and activation of immune responses. These discoveries have not only deepened our understanding of plant immune perception mechanisms but also provided important molecular resources for crop disease resistance breeding.

[0004] However, the distribution of PRRs among different plant species is uneven, and there are phenomena of evolutionary loss or functional loss. Nicotiana benthamiana ) , some PRRs fail to recognize specific PAMPs due to mutations or deletions, resulting in a weakened plant immune response to certain pathogens. Recent studies have revealed that a new class of fungal PAMPs, STOM (Secreted Toxin-like Oligopeptide Motif), can be recognized by PRRs in Nicotiana species of the Solanaceae family and induce a typical immune response. However, when the corresponding PRR genes in Nicotiana benthamiana are knocked out, the plant's ability to sense STOM is significantly impaired, thereby weakening its resistance to related pathogens.

[0005] Notably, rice also possesses pattern recognition receptors with similar functions to the STOM receptor in tobacco. The OsSTOMR discussed in this article is one of these receptors. OsSTOMR is capable of recognizing STOM and activating an immune response. Introducing the rice-derived OsSTOMR gene into a receptor-deficient mutant of Nicotiana benthamiana restored its ability to sense STOM, thereby reactivating the typical PTI response. This result demonstrates that OsSTOMR is functional across species and can complement the immune deficiencies of receptor-deficient plants.

[0006] Sclerotinia sclerotiorum is a globally important fungal pathogen with a broad host range, infecting nearly all major crops, including rapeseed, soybeans, cotton, and tobacco. Sclerotinia can cause stem rot, soft leaf rot, and fruit rot, leading to widespread yield loss or even total crop failure in severe cases. Due to the pathogen's tenacious survival and complex infection mechanisms, effective chemical control measures are currently lacking, making breeding for disease resistance one of the most economical and sustainable strategies for controlling the disease. However, the reported genetic resources for S. sclerotiorum resistance in tobacco are limited, and conventional breeding for disease resistance has been slow. Introducing new disease resistance genes through molecular breeding is an urgent challenge in tobacco breeding.

[0007] PRR-mediated innate immunity is a broad-spectrum, long-lasting defense method against pathogens that does not rely on specific resistance genes. Therefore, the use of heterologous PRR to enhance crop disease resistance has become an emerging strategy. Studies have shown that the introduction of Arabidopsis EFR genes into plants such as tomatoes and tobacco can confer resistance to a wide range of bacteria on the recipient plants. The rice pattern recognition receptor OsSTOMR identified in the present invention can perceive STOM across families and activate immune responses. By introducing OsSTOMR into Nicotiana benthamiana, not only its sensitivity to STOM was restored, but also the disease resistance of tobacco to Sclerotinia sclerotiorum was significantly enhanced. This discovery provides new genetic resources and technical routes for using rice PRR genes to improve the disease resistance of tobacco and other crops. Summary of the Invention

[0008] In order to solve the above technical problems, the present invention identifies pattern recognition receptors in rice that can recognize pathogen-associated molecular patterns (STOMs). OsSTOMR , knocking out the receptor that recognizes pathogen-associated molecular patterns STOM NbSTOMR Tobacco mutants with the gene nbstomr ), expression of OsSTOMR enhanced the production of reactive oxygen species induced by STOM in this mutant; at the same time, OsSTOMR It can also enhance tobacco's resistance to Sclerotinia sclerotiorum, as shown by the fact that when Nicotiana benthamiana expresses this gene, its resistance to Sclerotinia sclerotiorum is enhanced. Therefore, the purpose of the present invention is to provide a new disease-resistant gene derived from rice.OsSTOMR The protein encoded by this gene can recognize pathogen-associated molecular patterns STOM. After the gene was transferred into tobacco, it significantly enhanced the disease resistance of Nicotiana benthamiana to Sclerotinia sclerotiorum.

[0009] In a first aspect, the present invention provides a disease resistance protein OsSTOMR derived from rice that can be used in tobacco against Sclerotinia sclerotiorum. The protein OsSTOMR is a protein according to 1) or 2) or 3) or 4) below: 1) A protein consisting of the amino acid sequence of SEQ ID NO: 2 in the sequence listing; 2) A protein derived from SEQ ID NO: 2 in the sequence listing, wherein the amino acid sequence of SEQ ID NO: 2 in the sequence listing is substituted and / or deleted and / or added with one or more amino acid residues and still has the function of recognizing pathogen-associated molecular patterns or enhancing plant disease resistance.

[0010] 3) A protein that has an amino acid sequence homology of more than 90% with 1) or 2) and encodes a protein that has the function of recognizing pathogen-associated molecular patterns or enhancing tobacco disease resistance.

[0011] 4) A protein derived from the protein shown in SEQ ID NO: 2 that still has the function of recognizing pathogen-associated molecular patterns or enhancing plant disease resistance after the amino acid sequence of 1) or 2) has been deleted or recombined.

[0012] In a second aspect, the present invention also provides a disease resistance gene derived from rice that can be used in tobacco to resist Sclerotinia sclerotiorum. OsSTOMR , the gene OsSTOMR It is a nucleic acid molecule of the following 1) or 2) or 3) or: 1) The nucleotide sequence is shown in SEQ ID NO. 1; 2) a nucleotide sequence encoding the protein described in the first aspect; 3) A nucleic acid molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the disease resistance-related protein OsSTOMR.

[0013] In the third aspect, the present invention also provides a OsSTOMR A biological material containing nucleic acid molecules, wherein the biological material is any of the following, 1) Containing the second aspect OsSTOMR an expression cassette for a nucleic acid molecule; 2) Containing the second aspect OsSTOMR Recombinant expression vectors of nucleic acid molecules; 3) an expression vector containing the expression cassette described in 1); 4) a recombinant microorganism containing the recombinant expression vector described in 2); 5) A recombinant microorganism containing the recombinant expression vector described in 3).

[0014] In a fourth aspect, the present invention further provides a composition capable of improving tobacco's resistance to Sclerotinia sclerotiorum, the composition comprising the protein OsSTOMR described in the first aspect, the gene described in the second aspect OsSTOMR Or the biomaterial described in the third aspect.

[0015] In a fifth aspect, the present invention further provides the protein OsSTOMR described in the first aspect, the gene described in the second aspect OsSTOMR Or use of the biological material described in the third aspect in breeding tobacco varieties resistant to Sclerotinia sclerotiorum or in preventing and controlling tobacco Sclerotinia sclerotiorum diseases.

[0016] In certain embodiments, the application includes the protein OsSTOMR described in the first aspect, the antinuclear gene described in the second aspect OsSTOMR Or the step of transferring the biological material described in the third aspect into tobacco through gene editing, genetic modification and other technologies.

[0017] In a sixth aspect, the present invention also provides a method for improving tobacco's resistance to diseases caused by Sclerotinia sclerotiorum, the method comprising: ​ Or the step of transferring the biological material described in the third aspect into tobacco through gene editing, genetic modification and other technologies.

[0018] In certain embodiments, the method is specifically, introducing the protein described in the first aspect into tobacco tissue; or introducing the gene described in the second aspect into tobacco tissue. ​ The fragments were connected to plant expression vectors and introduced into tobacco tissues.

[0019] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) The present invention identifies a disease resistance gene derived from rice that can be used to protect tobacco against Sclerotinia sclerotiorum. ​ , which acts as a pattern recognition receptor and can recognize pathogen-related molecular patterns STOM and induce plant immune response. ​ It can enhance the disease resistance of Nicotiana benthamiana to Sclerotinia sclerotiorum.

[0020] (2) Resistance-related genes described in the present invention ​ The identified pathogen-associated molecular pattern STOM exists in different pathogens, so it has broad-spectrum disease resistance potential and good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] ​ Disease resistance-related genes ​ Interacts with pathogen-associated molecular patterns (STOMs).

[0022] ​ Nicotiana benthamiana ​ Expression of OsSTOMR in knockout cells can mediate STOM-induced reactive oxygen species production.

[0023] ​ To express OsSTOMR in Nicotiana benthamiana to enhance tobacco resistance to Sclerotinia sclerotiorum. DETAILED DESCRIPTION

[0024] In order to enable those skilled in the art to better understand the present invention, the technical solution of the present invention is further described below with reference to specific examples. The experimental methods used in the examples are conventional methods unless otherwise specified; the materials and reagents used are all commercially available unless otherwise specified.

[0025] Example 1 Disease resistance-related genes ​ Interaction with pathogen-associated molecular patterns (STOMs) Pattern recognition receptors ​ The nucleotide sequence is shown in SEQ ID NO: 1 in the sequence listing, and the amino acid sequence is shown in SEQ ID NO: 2.

[0026] (1) Construction of prokaryotic expression vector Specific primers encoding the STOM gene, a pathogen-associated molecular pattern of U. oryzae, were designed: forward primer: 5'-ggatccccaggaattcccgggATGCTGTACTTTGACTTCCGGC-3' (SEQ ID NO: 3); reverse primer: 5'-tcagtcagtcacgatgcggccgcTCAGTCAAGACCGACGTTGGG-3' (SEQ ID NO: 4). Using U. oryzae cDNA as a template, the full-length STOM gene was amplified (94°C for 5 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 34 cycles; 72°C for 5 min). The pGEX4T vector was digested with Sma I and Not I, and the STOM fragment was cloned into the pGEX4T vector by recombinant cloning.

[0027] Similarly, designing encoding pattern recognition receptors ​The product was amplified using primers specific for the extracellular domain: forward primer: 5'-ctgtattttcagggcgaattcATGGAACATCTCTTCACCCTCATC-3' (SEQ ID NO: 5) and reverse primer: 5'-caggtcgactctagaggatccTTACTTCTTTTGTTTCTTCCACTTGAT-3' (SEQ ID NO: 6). The product was then recombinantly cloned into the pHMTc vector that had been cut with EcoRI and BamHI.

[0028] The recombinant vector was transformed into Escherichia coli DH5α strain, plated with ampicillin antibiotics, and positive clones were screened by colony PCR. The screened positive clones were shaken to extract plasmids to obtain the recombinant vector for prokaryotic expression.

[0029] Results: The prokaryotic expression vector was obtained through colony PCR verification and sequencing verification.

[0030] (2) Induced protein expression The recombinant plasmid was introduced into the E. coli Rosetta expression host and plated onto selective medium containing ampicillin and chloramphenicol. Positive clones were screened by colony PCR. Positive strains were selected and inoculated into 4 mL of LB medium containing both antibiotics. The culture was shaken and cultured overnight at 37°C. The culture was then transferred to 200 mL of LB liquid medium containing the same antibiotic conditions and cultured until the OD600 reached 0.6–0.8. Subsequently, 200 μL of 0.1 M IPTG was added and the culture was induced overnight at 28°C with shaking.

[0031] (3) Recombinant protein purification After induction, collect the cells in a 50 mL centrifuge tube and centrifuge at 8000 rpm for 10 min at 4°C. Resuspend the cells in 10-20 mL of lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM Imidazole, pH 8.0) and add 20 μL of lysozyme. Incubate on ice for 30 min. Sonicate (1 s / 3 s intervals for 30 min) and centrifuge at 10,000 rpm at 4°C for 70 min. Remove the supernatant. Wash a 400 μL nickel column twice with 10 mL of lysis buffer, add the supernatant, and incubate on a shaker at 4°C for 2 h. After incubation, remove the supernatant by centrifugation at 3210 rpm for 5 min. The sample was then washed three times with 20 mM elution buffer (50 mM NaH₂PO₄, 300 mM NaCl, 20 mM imidazole, pH 8.0), three times with 50 mM elution buffer (50 mM imidazole), and finally 10 times with 250 μL of elution buffer (250 mM imidazole). Ten μL of the eluate was added to 6× SDS loading buffer and incubated in a boiling water bath for 10 minutes before analysis by SDS-PAGE and staining with Coomassie Brilliant Blue R250 to verify purification. The purified product was then transferred to imidazole-free Tris buffer via ultrafiltration (Millipore Amicon Ultra-15c) for subsequent use in subsequent experiments.

[0032] Results: The purified GST-tagged STOM and MBP-tagged OsSTOMR extracellular domain proteins were successfully obtained.

[0033] (4) Pull-Down detection interaction Equal amounts of GST-tagged STOM and MBP-tagged ​The extracellular domains were incubated in a buffer (50 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA, 1 mM DTT, 10 mM MgCl2, and 1% NP-40) containing Glutathione Sepharose 4B (GS4B, Cytiva) resin. After incubation at 4°C for 1 hour, the cells were washed five times with elution buffer (50 mM Tris-HCl (pH 8.0), 400 mM NaCl, 50 mM reduced glutathione, 1 mM EDTA, and 1 mM DTT). GST was used as a negative control. The loaded and eluted proteins were then treated with 6× SDS loading buffer in a boiling water bath for 10 minutes before SDS-PAGE and western blotting. GST and MBP antibodies were used to detect the expression of the STOM and OsSTOMR extracellular domains, respectively.

[0034] Results: STOM interacted with the extracellular domain of OsSTOMR, while GST itself could not interact with the extracellular domain of OsSTOMR (see ​ ).

[0035] Example 2: ​ OsSTOMR expression in knockout mutants mediates pathogen-associated molecular pattern (STOM)-induced reactive oxygen species production (1) Ben's tobacco ​ Obtaining knockout mutants 1) Construction of knockout vector Design targeting ​The target gene t1: 5'- ATCGAGCTCGTTGCTGATCG CGG-3' (SEQ ID NO:7); t2: 5'- GGAGATAATCCAGCTCCTAAAGG-3' (SEQ ID NO:8); t3: 5'-CTTGTTGTTGAGGACTAGTA AGG-3' (SEQ ID NO:9) was then fused together through fragment synthesis to serve as a template for subsequent amplification. Amplification primers were designed: forward primer: 5'- cagtGGTCTCatgcaatcgagctcgttgctgatcggtttc-3' (SEQ ID NO:10); reverse primer: 5'- cagtGGTCTCaaaactactagtcctcaacaacaagtgcaccag-3' (SEQ ID NO:11). The fusion fragment was amplified and constructed into the K5-KRSN vector digested with BsaI / Eco31I. The recombinant vector was transformed into Escherichia coli, and positive clones were screened by colony PCR. Finally, the knockout vector was obtained by extracting the plasmid by shaking the bacteria.

[0036] 2) Plasmid transformation into Agrobacterium GV3101 Transfer 1 µL of plasmid to 50 µL of GV3101 competent Agrobacterium cells and transform them using the liquid nitrogen method. Add the successfully transformed GV3101 to 1 mL of LB liquid medium and incubate on a shaker at 30°C, 180 rpm, for 30 minutes. Inoculate 50 µL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30°C for 48 hours.

[0037] 3) Agrobacterium-mediated stable transformation of Nicotiana benthamiana Cut the sterile tobacco leaves into small pieces with a scalpel and inoculate them on the pre-culture medium. Prepare an Agrobacterium resuspension with OD600=0.2, inoculate the tobacco leaves that have been pre-cultured for 2-3 days into the suspension and infect for 10-15 minutes, then inoculate the infected tobacco leaves on filter paper, dry them and inoculate them on the co-culture medium, and culture them in the dark for 48-72 hours. After culturing for 2 days, transfer the leaves to the induction medium to induce callus, and wait for about 10 days for callus tissue to grow. Select callus tissue that meets the standards and inoculate it on the screening medium with the corresponding resistance for 15-30 days. Inoculate the second screened positive callus tissue with vigorous growth onto the differentiation medium, 4-5 calli / dish, and culture at 23℃ 16h / 8h light / dark for 15-30 days. During the differentiation process, if seedlings are formed on the callus, inoculate them onto the seedling medium and grow them for 7-10 days. The CTAB method was used to extract tobacco genomic DNA, and PCR detection was performed to finally obtain the N. benthamiana. ​ Knockout mutants.

[0038] (2) Construction of plant expression vector Design Coding ​ Gene-specific primers (forward primer: 5'-gaacgatagggtacccccgggATGGAACATCTCTTCACCCTCATC-3' (SEQ ID NO: 12) and reverse primer: 5'-gtaaggcctactagtggatccCTGGAGTGAACTGATATATGATGCAG-3' (SEQ ID NO: 13)) were used to amplify the gene (94°C for 5 minutes, followed by 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, 34 cycles, and 72°C for 5 minutes). The pBINHA vector was digested with Sma I and BamH I, and the amplified product was cloned into the pBINHA vector by recombinant cloning. The recombinant vector was transformed into Escherichia coli DH5α strain, plated with kanamycin, and positive colonies were screened by colony PCR. Positive colonies were shaken to extract the plasmid and obtain the plant expression recombinant vector.

[0039] (3) Agrobacterium-mediated transient transformation of Nicotiana benthamiana will contain ​ The plant expression vector was transformed into competent Agrobacterium GV3101 using the liquid nitrogen method. Positive clones were screened by colony PCR and then added to 4 ml of liquid LB medium. After incubation at 30°C, shaking at 180 rpm for 36 days, the cells were washed and adjusted to an OD value of 0.5. The cells were then injected into the underside of Nicotiana benthamiana leaves using a 1 ml needleless syringe. Twelve hours later, the plant expression vector containing STOM was injected.

[0040] (4) Observation of reactive oxygen species phenotype Reactive oxygen phenotypes can be observed using DAB staining: Place the injected leaves in DAB staining solution (1 mg / ml, pH 3.8) at room temperature in the dark for 8 hours. Remove the staining solution and decolorize with anhydrous ethanol. Once the green color has completely faded, remove the leaves and photograph them.

[0041] Results: In ​ Expression in knockout ​ Afterwards, it was found that the expression ​ Can restore pathogen-associated molecular pattern-induced cell death and reactive oxygen species (see ​ ), further indicating that OsSTOMR recognizes pathogen-associated molecular patterns and stimulates plant immune responses.

[0042] Example 3 Overexpression of disease resistance-related genes ​ Enhance the resistance of Nicotiana benthamiana to Sclerotinia sclerotiorum In Nicotiana benthamiana, transient expression ​, then inoculate with Sclerotinia sclerotiorum, culture with moisturizing, and count the area of ​​lesions.

[0043] Results: Overexpression in Nicotiana benthamiana ​ The lesion area of ​​the WT was significantly smaller than that of the WT, indicating that OsSTOMR positively regulates the resistance to Sclerotinia sclerotiorum (see ​ ).

[0044] The above is an exemplary description of the present invention. It should be noted that, without departing from the core of the present invention, any simple deformation, modification or other equivalent replacement that can be made by other skilled in the art without expending creative labor falls within the scope of protection of the present invention.

Claims

1. A rice-derived protein OsSTOMR capable of improving tobacco's resistance to Sclerotinia sclerotiorum, characterized in that: The protein OsSTOMR is the protein of 1) or 2) or 3) or 4) as follows: 1) A protein consisting of the amino acid sequence of SEQ ID NO: 2 in the sequence listing; 2) A protein derived from SEQ ID NO: 2 in the sequence listing, wherein the amino acid sequence is substituted and / or deleted and / or added with one or more amino acid residues and still has the function of recognizing pathogen-associated molecular patterns or enhancing plant disease resistance; 3) Proteins that have an amino acid sequence homology of more than 90% with 1) or 2) and encode proteins that have the function of recognizing pathogen-associated molecular patterns or enhancing tobacco disease resistance; 4) A protein derived from the protein shown in SEQ ID NO: 2, which has the function of recognizing pathogen-associated molecular patterns or enhancing plant disease resistance after the amino acid sequence of 1) or 2) has been deleted or recombined.

2. A rice-derived gene that improves tobacco's resistance to Sclerotinia sclerotiorum OsSTOMR , characterized in that, The gene OsSTOMR It is a nucleic acid molecule of the following 1) or 2) or 3) or: 1) The nucleotide sequence is shown in SEQ ID NO. 1; 2) a nucleotide sequence encoding the protein according to claim 1; 3) A nucleic acid molecule that hybridizes with the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the disease resistance-related protein OsSTOMR.

3. Containing the substance described in claim 2 OsSTOMR A biological material of nucleic acid molecules, characterized in that The biological material is any of the following, 1) Containing the substance described in claim 2 OsSTOMR an expression cassette for a nucleic acid molecule; 2) Containing the substance described in claim 2 OsSTOMR Recombinant expression vectors of nucleic acid molecules; 3) an expression vector containing the expression cassette described in 1); 4) a recombinant microorganism containing the recombinant expression vector described in 2); 5) A recombinant microorganism containing the recombinant expression vector described in 3).

4. A composition capable of improving tobacco's resistance to Sclerotinia sclerotiorum, characterized in that: The combination contains the protein OsSTOMR according to claim 1 and the gene according to claim 2 OsSTOMR Or the biomaterial according to claim 3.

5. The protein OsSTOMR according to claim 1, and the gene according to claim 2 OsSTOMR Or the use of the biomaterial according to claim 3 in the breeding of tobacco varieties resistant to Sclerotinia sclerotiorum or in the prevention and control of tobacco Sclerotinia sclerotiorum disease.

6. The use according to claim 5, characterized in that The application includes the protein OsSTOMR according to claim 1 and the gene according to claim 2 OsSTOMR Or the step of transferring the biological material described in claim 3 into tobacco through gene editing, genetic modification and other technologies.

7. A method for improving tobacco resistance to diseases caused by Sclerotinia sclerotiorum, characterized in that: The method comprises the steps of: OsSTOMR Or the step of transferring the biological material described in claim 3 into tobacco through gene editing, genetic modification and other technologies.

8. The method according to claim 7, characterized in that The method specifically comprises: OsSTOMR or partial sequences are connected to a plant expression vector and introduced into tobacco.

Images