SNP marker influencing pig UMP content and application thereof

Abstract

The invention relates to the technical field of molecular markers and animal genetic breeding, in particular to an SNP marker influencing pig UMP content and application thereof. Whole genome re-sequencing and GWAS analysis are adopted, American-series purebred landrace pigs, American-series purebred large white pigs and American-series purebred duroc are used as research objects, seven SNP markers related to the pig UMP content are researched and determined, by optimizing dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the UMP content can be increased, and the pig UMP content can be improved. The pig genetic improvement progress is accelerated, so that the economic benefit of breeding pig breeding is effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers and animal genetic breeding, and in particular to a SNP marker affecting pig UMP content and an application thereof. Background Art

[0002] UMP (uridine monophosphate) is a building block of pyrimidine metabolism and a key node in multiple metabolic pathways, including the synthesis of RNA, cell membrane components (such as phosphatidylcholine), and glycosylation intermediates. It participates in muscle cell growth, repair, and energy metabolism, indirectly influencing muscle development and meat quality. As a core substance in pyrimidine metabolism, UMP is closely linked to various metabolic processes. Its synthesis pathway involves the catalysis of several key enzymes, and it can be converted into other important nucleotides, such as UDP and UTP, which then participate in various biosynthetic processes. The UMP metabolite UDP is an activating carrier for monosaccharides and participates in the biosynthesis of monosaccharides, disaccharides, and polysaccharides. This suggests that UMP plays a crucial role in maintaining cellular energy metabolism and structural integrity. Furthermore, UMP and glutamate may exhibit synergistic flavor-enhancing effects, having been found to mitigate bitterness or enhance sweetness in certain models. Although UMP itself has a weak umami flavor, its high content may reflect more active muscle cell metabolism and a healthy tissue physiological state, making it suitable as an auxiliary indicator in breeding strategies focused on muscle development, healthy metabolism, and potential flavor structure optimization.

[0003] Therefore, identifying marker loci that influence UMP content and improving breeding populations is crucial for the production and economic benefits of the pig industry. Genome-wide association studies (GWAS) provide powerful technical support for achieving this goal. GWAS can scan marker loci associated with UMP content genome-wide, precisely locating key gene regions that influence UMP synthesis, metabolism, and regulation. This allows breeders to directly select at the genetic level, avoiding errors caused by factors such as environmental interference in traditional selection, and improving the accuracy and efficiency of selection. Key marker loci identified by GWAS can be used to construct an efficient molecular marker-assisted selection (MAS) system. In actual breeding, by testing the genotypes of target individuals at the corresponding marker loci, individuals carrying favorable alleles can be quickly identified.

[0004] Furthermore, GWAS can be used not only to select for the specific trait of UMP content, but also to simultaneously analyze other traits related to production performance, meat quality, and health. This multi-trait integrated selection approach can better balance the relationships between different breeding goals, optimize the genetic improvement process of pigs, and achieve sustainable development of the pig farming industry. Summary of the Invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a SNP marker that affects the UMP content of pigs.

[0006] Another object of the present invention is to provide applications of the above-mentioned SNP markers.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A SNP marker affecting pig UMP content comprises at least one of the following SNP markers:

[0009] (I) The SNP site corresponds to the T>C mutation at position 49824761 on chromosome 15 of the international porcine genome version 11.1;

[0010] (II) The SNP site corresponds to the G>C mutation at position 64738361 on chromosome 5 of the international porcine genome version 11.1;

[0011] (III) The SNP site corresponds to the A>G mutation at position 7847557 on chromosome 2 of the international porcine genome version 11.1;

[0012] (IV) The SNP site corresponds to the T>C mutation at position 7800167 on chromosome 2 of the international porcine genome version 11.1;

[0013] (V) The SNP site corresponds to the T>C mutation at position 7820968 on chromosome 2 of the international porcine genome version 11.1;

[0014] (VI) The SNP site corresponds to the T>C mutation at position 80754161 on chromosome 7 of the international porcine genome version 11.1;

[0015] (VII) The SNP site corresponds to the A>G mutation at position 80919433 on chromosome 7 of the international porcine genome version 11.1.

[0016] For (I), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 1, wherein M in the sequence is C or T, and the SNP site is the nucleic acid single base mutation C232-T232 at position 232 of the sequence annotation of SEQ ID NO: 1.

[0017] For (III), the sequence of the SNP-tagged nucleic acid is preferably as shown in SEQ ID NO: 2, wherein M in the sequence is A or G, and the SNP site is the nucleic acid single base mutation A85-G85 at position 85 of the sequence annotation of SEQ ID NO: 2.

[0018] In a specific embodiment:

[0019] For (I), the source of the pig is American Duroc pig or its synthetic line.

[0020] For (II), the source of the pig is American Landrace pig or its synthetic line.

[0021] For (III)-(V), the source of the pig is American Large White pig or its synthetic line.

[0022] For (VI)-(VII), the source of the pig is American Landrace pig, American Large White pig or American Duroc pig or their synthetic lines.

[0023] A primer combination for detecting the above-mentioned SNP marker, comprising at least one of the primer pair primer-F1 and primer-R1, and the primer pair primer-F2 and primer-R2, the nucleotide sequences of which are shown in SEQ ID NOs: 3-6;

[0024] A kit for detecting the above-mentioned SNP marker comprises the above-mentioned primer combination.

[0025] The SNP marker, primer combination or kit is used in identifying UMP content or meat quality-related traits in pigs or pork, screening pig breeds with high UMP content or excellent meat quality, or breeding pigs with UMP content or meat quality-related traits.

[0026] A method for genetic improvement of pigs, comprising the following steps:

[0027] Determine the above SNP markers for the sows in the sow core group and make corresponding selections based on the SNP markers:

[0028] For (I), selecting from the core population of sows those with the T / T or T / C genotype at position 49824761 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating those with the C / C genotype to increase the frequency of the allele T at this site generation by generation;

[0029] For (II), selecting from the core population of sows those with the C / C or C / G genotype at position 64738361 on chromosome 5 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of the allele C at this site generation by generation;

[0030] For (III), selecting from the core population of sows those with the G / G or G / A genotype at position 7847557 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation;

[0031] For (IV), selecting from the core group of sows the C / C or C / T genotype at position 7800167 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating the T / T genotype sows to increase the frequency of the allele C at this site generation by generation;

[0032] For (V), selecting from the core population of sows individuals with a C / C or C / T genotype at position 7820968 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating sows with a T / T genotype, so as to increase the frequency of the allele C at this site generation by generation;

[0033] For (VI), selecting from the core population of sows those with the T / T or C / T genotype at position 80754161 on chromosome 7 of the International Porcine Genome Version 11.1, and eliminating those with the C / C genotype to increase the frequency of the T allele at this position generation by generation;

[0034] For (VII), select breeding pig individuals with A / A or G / A genotype at position 80919433 on chromosome 7 of the international porcine genome version 11.1 from the breeding pig core group, and eliminate breeding pig individuals with G / G genotype to increase the frequency of allele A at this site generation by generation.

[0035] A method for identifying UMP content or meat quality-related traits in pigs, comprising the following steps:

[0036] Determine the above-mentioned SNP markers of pigs, and judge the UMP content or meat quality-related traits of pigs based on the SNP sites of the SNP markers, wherein:

[0037] For (I), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 49824761 on chromosome 15 of the International Porcine Genome Version 11.1, which is: T / T genotype, T / C genotype and C / C genotype;

[0038] For (II), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 64738361 on chromosome 5 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / G genotype and G / G genotype;

[0039] For (III), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 7847557 on chromosome 2 of the International Porcine Genome Version 11.1, which is: G / G genotype, G / A genotype and A / A genotype;

[0040] For (IV), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 7800167 on chromosome 2 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / T genotype and T / T genotype;

[0041] For (V), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 7820968 on chromosome 2 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / T genotype and T / T genotype;

[0042] For (VI), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 80754161 on chromosome 7 of the International Porcine Genome Version 11.1, which is: T / T genotype, C / T genotype and C / C genotype;

[0043] For (VII), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 80919433 on chromosome 7 of the international porcine genome version 11.1, which are: A / A genotype, G / A genotype and G / G genotype.

[0044] Application of the SNP marker, primer combination or kit in the field of gene editing or transgenic;

[0045] A method for establishing a new pig strain and / or new pig breed for increasing UMP content or improving pork quality-related traits comprises the following steps:

[0046] The above-mentioned SNP markers of pigs were determined, and the following mutations were performed based on the SNP markers:

[0047] For (I), the pigs whose SNP marker genotype is C / C or T / C are mutated to T / T genotype by site-directed mutagenesis;

[0048] For (II), for pigs whose SNP marker genotype is G / G or C / G, the G / G or C / G genotype is changed to C / C genotype by site-directed mutagenesis;

[0049] For (III), for pigs whose SNP marker genotype is A / A or G / A, the A / A or G / A genotype is changed to G / G genotype by site-directed mutagenesis;

[0050] For (IV), in pigs whose SNP marker genotype is T / T or C / T, the T / T or C / T genotype is changed to C / C genotype by site-directed mutagenesis;

[0051] For (V), the pigs whose SNP marker genotype is T / T or C / T are mutated to C / C genotype by site-directed mutagenesis;

[0052] For (VI), the pigs whose SNP marker genotype is C / C or C / T are mutated to T / T genotype by site-directed mutagenesis;

[0053] For (VII), for pigs whose SNP marker genotype is G / G or G / A, the G / G or G / A genotype is mutated to A / A genotype by site-directed mutagenesis.

[0054] The mutation method is to use a transgenic method or a gene editing method to perform mutation.

[0055] The mutation method is preferably to perform mutation using the CRISPR / Cas9 gene editing method.

[0056] The present invention has the following advantages and effects compared to the prior art:

[0057] (1) The present invention uses whole genome resequencing and GWAS analysis to study and identify seven SNP markers associated with UMP content in pigs using American purebred Landrace pigs, American purebred Large White pigs and American purebred Duroc pigs as research objects. At least one of the SNP markers of the present invention can be used to detect relevant indicators of pigs, or at least one of these SNP markers can be used to perform genetic improvement.

[0058] (2) The present invention establishes a set of efficient and accurate molecular marker-assisted breeding technologies based on SNP markers that affect pig UMP content, including products such as primers and kits for detecting the SNP markers, methods for identifying pig UMP content or meat quality-related traits, methods for genetic improvement of pigs, etc., which can be applied to the genetic improvement of pig UMP content or meat quality-related traits, and can quickly and accurately select pigs for UMP content or meat quality-related traits, thereby accelerating the breeding process.

[0059] (3) The present invention uses molecular breeding to solve the problem of low UMP content. By optimizing the dominant allele of the above-mentioned SNP, the dominant allele frequency can be increased from generation to generation, the UMP content can be improved, the progress of pig genetic improvement can be accelerated, and the economic benefits of pig breeding can be effectively improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 This is the Manhattan plot of the GWAS analysis of UMP content traits in different experimental groups on different chromosomes, where the X-axis is the position of the molecular marker site on the chromosome and the Y-axis is the -log 10 (P value).

[0061] Figure 2 This is a violin plot of the corresponding UMP content of the genotypes of all sites in the corresponding population. The X-axis represents the genotype of the SNP molecular marker site, and the Y-axis represents the UMP content of the individual. DETAILED DESCRIPTION

[0062] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0063] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0064] In the examples, the standard substance uridine monophosphate (UMP) (3387-36-8) for HPLC detection was purchased from Shanghai Anpu Laboratory Technology Co., Ltd.

[0065] Example 1

[0066] 1. Experimental Animals

[0067] The pig populations used in the present invention are: American purebred Landrace pigs (173 heads), American purebred Large White pigs (166 heads), and American purebred Duroc pigs (158 heads).

[0068] All pigs were obtained from Jiangxi Yudu Jiada Livestock Co., Ltd. and slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. at 200 days of age in the slaughterhouse's butchering area. Carcasses were obtained after slaughter, exsanguination, removal of hair, viscera, head, tail, and limbs (below the wrist and joints), and skinning. Sampling was completed within 30 minutes of slaughter to minimize the effects of post-mortem metabolism on the content of nucleotides and their metabolites. The longissimus dorsi muscle was precisely isolated from the left side of the carcass between the first and second lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0 g of muscle tissue was quickly transferred to a 2 mL cryotube, minced, and quickly frozen in liquid nitrogen (-196°C). The sample was then stored in a -80°C freezer until testing.

[0069] 2. Quantitative determination of UMP content in pork by HPLC

[0070] (1) Extraction of UMP: Accurately weigh 0.4 g (accurate to 0.001 g) of muscle sample from the minced longissimus dorsi muscle and place it in a 15 mL polypropylene acid-resistant centrifuge tube.

[0071] (2) Acid hydrolysis extraction: Add 6 mL of 6% (w / w) perchloric acid solution precooled to 4°C, and then homogenize using a handheld high-speed homogenizer for 45 seconds (run 10 seconds / pause 5 seconds, cycle 3 times), with ice bath intermittently to prevent overheating.

[0072] (3) Purification by centrifugation: Transfer the homogenate to a constant temperature water bath shaker (4°C) and shake at 200 rpm for 15 min to promote nucleotide release. Centrifuge at 4°C and 5000 rpm for 10 min, collect the supernatant into a new tube, repeat the centrifugation twice, and combine the supernatants from the two centrifugations.

[0073] (4) Precise pH control for acid-base neutralization: Place the combined supernatant in step (3) in an ice bath, and use a micropipette to add 3 mol / L NaOH solution dropwise to adjust the pH to 6.5 ± 0.1 (using a pH meter for real-time monitoring) to minimize the interference of ATPase activity. Add ultrapure water to a volume of 10 mL, vortex to mix, and let it stand for 10 minutes to promote ion balance.

[0074] (5) High performance liquid chromatography (HPLC) was used to detect the content of UMP in the longissimus dorsi muscle extract of each individual pig (unit: mg / 100 g). The HPLC analysis was performed on an ACQUITY UPLCH-Class PLUS System (Waters). The chromatographic column used was Waters BEH C18 (1.7 μm, 2.1× 100 mm), the mobile phase was 0.05 mol / L KH2PO4 buffer (pH 6.0)-methanol (95:5, v / v), the flow rate was 0.2 mL / min (isocratic elution), the column temperature was 30°C, the detection wavelength was 254 nm, the injection volume was 2 μL, and the external standard method was used for quantification.

[0075] Concentration data obtained from the HPLC system were converted from the original unit of µg / mL to mg / 100g using the following formula:

[0076]

[0077] where C represents the content of UMP in 100 g of pork (mg / 100 g), and C0 represents the concentration of UMP measured by HPLC (µg / mL).

[0078] This study performed descriptive statistics on HPLC data for UMP in the longissimus dorsi muscle of three commercial pig breeds (Large White, Landrace, and Duroc). The system calculated the sample size (N), mean (mean), standard deviation (SD), extreme value (min-max), and coefficient of variation (CV). The descriptive statistical results are shown in Table 1. As can be seen, uridine monophosphate (UMP) levels decrease gradually across breeds: Large White > Landrace > Duroc. The coefficient of variation in Duroc is 68.9%, indicating a low detected level, suggesting a high degree of volatility in the regulation of its purine metabolism pathway.

[0079] Table 1. Descriptive statistics of UMP content in three varieties (unit: mg / 100g)

[0080]

[0081] Example 2

[0082] 1. Acquisition, quality control, and typing of pig whole-genome resequencing data

[0083] (1) DNA Extraction: Ear tissue samples were collected from each individual in the three experimental pig groups described in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was measured using a Nanodrop-ND1000 spectrophotometer. Quality standards were met when the A260 / 280 ratio was between 1.8 and 2.0 and the A260 / 230 ratio was between 1.7 and 1.9.

[0084] (2) DNA sequencing: The concentration of DNA samples that meet the standards was diluted to 50 ng / μL, and the whole genome resequencing was completed using the BGI T7 sequencing platform (double-end 150 bp sequencing mode). The average sequencing depth of the samples reached 30×, and the raw sequencing data in fastq format were obtained. Clean reads were obtained through fastp (v0.23.0) quality control for subsequent analysis.

[0085] (3) Sequence alignment: The raw sequencing data obtained in step (2) were aligned with the Sscrofa11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.

[0086] (4) Variation detection: Use samtools (v1.10) to convert the sam format file in step (3) into a bam format file. Then use Sambamba (v0.8.2) to remove PCR duplicate sequences in the bam format file. Finally, use Graphtyper (v2.7.7) to detect genetic variations in all individual bam files and obtain population-level genotype data (vcf file).

[0087] (5) Variant quality control: samtools was used to perform quality control on the population-level genotype data obtained in step (4). For variant sites that met the conditions of "FILTER="PASS" and variant detection quality value GQ>20, high-quality detection sites were retained. Plink (v1.9) was further used to perform quality control on the population-level genotype data, excluding variant sites with minor allele frequency (MAF) less than 5% and samples with individual genotype call rate less than 80%. Finally, beagle (r1399) was used to perform self-filling on the genotypes to obtain high-quality genotype data.

[0088] After a series of treatments using the above methods, 1,928,103, 1,964,653, and 1,513,322 mutation sites (including SNPs and Indels) were obtained in Large White, Landrace, and Duroc, respectively.

[0089] 2. Genome-wide association study (GWAS) analysis and meta-analysis

[0090] (1) Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1) was used to perform genome-wide association analysis on phenotypic data corrected for confounding factors. Specifically:

[0091] ① We used the lm() function in R language to process the phenotype, put gender and batch into the function for simple linear regression, and the corrected residuals were used as the phenotype for the final association analysis.

[0092] ② The univariate linear mixed model (ULMM) was used for statistical inference, and its mathematical expression is constructed as follows:

[0093] Where y represents the n-dimensional vector of the phenotype to be analyzed (quantitative trait or binary vector), which is the content of UMP in this study; W represents a matrix consisting of a column of "1" (n×c dimensions); α is the effect of the corresponding covariate and the intercept value vector (c dimension), x represents the vector of genotypes at the test site (n dimension); β represents the vector of the effect size of the test site; u represents the mean is 0, and the covariance-variance matrix is ​​λτ -1 K random effect vectors (n dimensions) of a multivariate normal distribution; ε indicates that the mean is 0, and the covariance-variance matrix is ​​τ -1 The remaining residual vector (n-dimensional) of In. In two n-ary normal distributions, n represents the number of phenotypes, τ -1 represents the variance of the residuals, λ represents the ratio of the variance of the random effect to the variance of the residuals, K represents the n×n kinship matrix, and In represents the n×n identity matrix. MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, the genome-wide significance threshold was set at 0.05 / N (Bonferroni correction), where N is the number of valid SNPs / indels.

[0094] (2) Using the results of the above GWAS analysis, a meta-analysis of the UMP content in these three groups was performed in the METAL software. The meta-analysis was performed based on the standard error weighted method (SCHEME STDERR).

[0095] Based on GWAS analysis ( Figure 1 Table 2 lists the basic genetic parameter information for the seven representative SNP loci obtained in this study (including those obtained through meta-analysis). The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the SNP name for a locus is unavailable on the website, the SNP name is presented as "chromosome_position." Other important genetic parameter information for each representative locus can be obtained from the GWAS analysis results using GEMMA software, including chromosome location and position information, alleles, effect size, and P value (Wald test).

[0096] Table 2. Basic genetic parameter information of 7 representative SNP loci

[0097]

[0098] Note: The meta-analysis integrated genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.

[0099] 3. Analysis of UMP content phenotype differences among different genotypes

[0100] The genotypes of the molecular marker sites displayed by each individual of the 497 pigs in the three groups were extracted from the sequencing files using Plink (v1.9). After counting the number of individuals of each genotype, the genotypes of these individuals were matched with their corresponding UMP contents. Then, the summarise function in the dplyr package in R language was used to statistically analyze the differences in phenotypic distribution under different genotypes. The results are shown in Tables 3 and Figure 2 As shown in Figure 2. Among them, the P value is obtained from the variance test.

[0101] Table 3. Effects of various molecular marker sites on UMP content (unit: mg / 100g)

[0102]

[0103] 4. Heritability Analysis

[0104] Heritability is the most important basic genetic parameter in quantitative genetics and can be divided into broad-sense heritability, narrow-sense heritability and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h 2 ), which refers to the proportion of the variance of the quantitative trait's breeding value to the phenotypic variance. It is the additive effect after eliminating dominant and epistatic effects and is stably inherited across generations. This method estimates single-marker heritability based on the effect value (β) and its standard error (SE) for each locus in the GWAS result file from step 3 above, and takes their mean as the approximate narrow-sense heritability at the genome-wide level. The specific calculation formula is as follows:

[0105]

[0106] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.

[0107] Table 4 shows the heritability estimation analysis results of UMP content in the three populations, among which the heritability distribution of UMP content in the three populations is 0.354-0.361.

[0108] Table 4. Estimated heritability of UMP content in three populations (h 2 )

[0109]

[0110] Example 3

[0111] This example provides a method and process for detecting the SNP markers in Example 2, specifically using the SNP markers rs326811755 and rs327623943 as examples, which correspond to the Duroc and Large White pig breeds, respectively. The specific method is as follows:

[0112] 1. Primer Design

[0113] (1) The target fragment containing the SNP site significantly associated with the UMP content of American Duroc pigs is a 512 bp nucleotide sequence on chromosome 15 (SEQ ID NO: 1). The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and their nucleic acid sequences are as follows:

[0114] Upstream primer primer-F1: 5′-GCAAGGGGGTCAGGTTATCC-3′ (SEQ ID NO: 3);

[0115] Downstream primer: primer-R1: 5′-CACCCGCATGTTCATTGCAG-3′ (SEQ ID NO: 4).

[0116] (2) The target fragment containing the SNP site significantly associated with the UMP content of American Large White pigs is a 238 bp nucleotide sequence on chromosome 2 (SEQ ID NO: 2). The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and their nucleic acid sequences are as follows:

[0117] Upstream primer primer-F2: 5′-GCCGAGGAGAGAACAGGGAA-3′ (SEQ ID NO: 5);

[0118] Downstream primer primer-R2: 5′-TTCTATTTTTGCCCCCTGCCC-3′ (SEQ ID NO: 6).

[0119] 2. PCR Amplification

[0120] To a 10 μL reaction system, add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2× Taq PCR StarMix with Loading Dye, and 0.3 μL each of the forward and reverse primers. PCR reaction conditions were: 94°C denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55-65°C for 30 s, and extension at 72°C for 45 s, with a final extension at 72°C for 5 min.

[0121] 3. DNA Sequencing

[0122] DNA sequencing: performed at Shenzhen BGI Genomics Co., Ltd., with both forward and reverse reactions of the gene fragments tested. The resulting sequence was compared with the NCBI genome sequence to identify the mutation at the corresponding SNP site.

[0123] SEQ ID NO:1 (chr15:49824529-49825041): GCAAGGGGGTCAGGTTATCCTTACATGTATACATTACAATTACAGTTTTTCCCCCACCCTTTCTTCTGTTGCAACATGAGTATCTAGACATAGTTCTCAATGCTATTCAGCAGGATCTCCTTGTCAATCTATTCTAAGTTGTGTCTGATAAGCCCAAGCTCCCGATCCCTCCCACTCCCTCCCCTCCCATCAGGCAGGGACAAGTCTCTTCTCCAAGTCCATGATTTTCT M(C / T) TTCTGAGGAGATGTTCATTTGTGCTGGATATTAGATTCCAGTTATAAGTGATATCATATGGTATTTGTCTTTCTCTTTCTGGCTCATTTCACTCAGGATGAGAGTCTCTAGTTCCATCCATGTTGCTGCAAATGGCCTTA TGTCATTCTTTTTTATGGCTGAGTAGTATTCCATTGTGTATATATACCACCTCTTCCGAATCCAATCCTCTGTCAATGGACATTTGGGTTGTTTCCATGTCCTGGCTATTGTGAATAGTGCTGCAATGAACATGCGGGTG SEQ ID NO:2 (chr2:7847472-7847710): GCCGAGGAGAGAACAGGGAACGACTCCTCTCCGCCCACCCCGCCCCAGGCGCCCCTCACCTGGGCTGCTGAGGGAGGTGCTGGT M(G / A) GGGGAGGTGGTGGGGCCCGGGGGCCGGCGGGGGAGGCGTCCAGGGGGCTGGGTGTGGGGTTTGGGGTCAGCTGGGATCCTGGCTGCTGAGACTGGGTCTCCTGGCTTGTCTCCGGGCCAGCCTGAGCCTGAAGGGCAGGGGGCAAAAATAGAA

[0124] Note: The M marked in the sequence is the mutation site, which is underlined (the mutated base in brackets is the allele mutation). The bold at the beginning and end of the sequence is the primer sequence binding position.

[0125] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A use of a SNP marker affecting pig UMP content in identifying pig or pork UMP content or meat quality related traits, screening pig breeds with high UMP content or excellent meat quality, or pig UMP content or meat quality related traits breeding, characterized in that The SNP markers include at least one of the following SNP markers: (I) The SNP site corresponds to the T>C mutation at position 49824761 on chromosome 15 of the international porcine genome version 11.1; (II) The SNP site corresponds to the G>C mutation at position 64738361 on chromosome 5 of the international porcine genome version 11.1; (III) The SNP site corresponds to the A>G mutation at position 7847557 on chromosome 2 of the international porcine genome version 11.1; (IV) The SNP site corresponds to the T>C mutation at position 7800167 on chromosome 2 of the international porcine genome version 11.1; (V) The SNP site corresponds to the T>C mutation at position 7820968 on chromosome 2 of the international porcine genome version 11.1; (VI) The SNP site corresponds to the T>C mutation at position 80754161 on chromosome 7 of the international porcine genome version 11.1; (VII) The SNP site corresponds to the A>G mutation at position 80919433 on chromosome 7 of the international porcine genome version 11.

1.

2. The use according to claim 1, characterized in that: For (I), the nucleic acid sequence of the SNP marker is as shown in SEQ ID NO: 1, wherein M in the sequence is C or T; For (III), the sequence of the SNP-tagged nucleic acid is shown in SEQ ID NO: 2, wherein M in the sequence is A or G.

3. A primer combination for detecting SNP markers affecting pig UMP content in identifying pig or pork UMP content or meat quality related traits, screening pig breeds with high UMP content or excellent meat quality, or pig UMP content or meat quality related traits breeding, characterized in that The primer combination comprises at least one of the primer pair primer-F1 and primer-R1 and the primer pair primer-F2 and primer-R2, and the nucleotide sequences thereof are shown in SEQ ID NOs: 3-6.

4. A kit for detecting SNP markers affecting pig UMP content for use in identifying pig or pork UMP content or meat quality-related traits, screening pig breeds with high UMP content or excellent meat quality, or breeding pigs for UMP content or meat quality-related traits, characterized in that The kit comprises the primer combination described in claim 3.

5. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the SNP markers of the sows in the sow core group according to claim 1 or 2, and make corresponding selections based on the SNP markers: For (I), selecting from the core population of sows those with the T / T or T / C genotype at position 49824761 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating those with the C / C genotype to increase the frequency of the allele T at this site generation by generation; For (II), selecting from the core population of sows those with the C / C or C / G genotype at position 64738361 on chromosome 5 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of the allele C at this site generation by generation; For (III), selecting from the core population of sows those with the G / G or G / A genotype at position 7847557 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation; For (IV), selecting from the core group of sows the C / C or C / T genotype at position 7800167 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating the T / T genotype sows to increase the frequency of the allele C at this site generation by generation; For (V), selecting from the core population of sows individuals with a C / C or C / T genotype at position 7820968 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating sows with a T / T genotype, so as to increase the frequency of the allele C at this site generation by generation; For (VI), selecting from the core population of sows those with the T / T or C / T genotype at position 80754161 on chromosome 7 of the International Porcine Genome Version 11.1, and eliminating those with the C / C genotype to increase the frequency of the T allele at this position generation by generation; For (VII), select breeding pig individuals with A / A or G / A genotype at position 80919433 on chromosome 7 of the international porcine genome version 11.1 from the breeding pig core group, and eliminate breeding pig individuals with G / G genotype to increase the frequency of allele A at this site generation by generation.

6. A method for identifying UMP content or meat quality related traits in pigs, characterized in that The following steps are included: Determine the SNP marker of claim 1 or 2 of a pig, and judge the UMP content or meat quality-related traits of the pig based on the SNP site of the SNP marker, wherein: For (I), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 49824761 on chromosome 15 of the International Porcine Genome Version 11.1, which is: T / T genotype, T / C genotype and C / C genotype; For (II), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 64738361 on chromosome 5 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / G genotype and G / G genotype; For (III), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 7847557 on chromosome 2 of the International Porcine Genome Version 11.1, which is: G / G genotype, G / A genotype and A / A genotype; For (IV), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 7800167 on chromosome 2 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / T genotype and T / T genotype; For (V), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 7820968 on chromosome 2 of the International Porcine Genome Version 11.1, which is: C / C genotype, C / T genotype and T / T genotype; For (VI), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 80754161 on chromosome 7 of the International Porcine Genome Version 11.1, which is: T / T genotype, C / T genotype and C / C genotype; For (VII), the UMP content of the pigs is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 80919433 on chromosome 7 of the international porcine genome version 11.1, which are: A / A genotype, G / A genotype and G / G genotype.

7. Use of a SNP marker affecting porcine UMP content, a primer combination for detecting a SNP marker affecting porcine UMP content, or a kit for detecting a SNP marker affecting porcine UMP content in the field of gene editing or transgenics, characterized in that: The SNP marker is the SNP marker described in claim 1; The primer combination comprises at least one of the primer pair primer-F1 and primer-R1, and the primer pair primer-F2 and primer-R2, the nucleotide sequences of which are shown in SEQ ID NOs: 3-6; The kit comprises the above primer combination.

8. A method for establishing a new pig strain and / or new pig breed for increasing UMP content or improving pork quality-related traits, characterized in that The following steps are included: Determine the SNP marker of claim 1 or 2 in a pig, and perform the following mutation based on the SNP marker: For (I), the pigs whose SNP marker genotype is C / C or T / C are mutated to T / T genotype by site-directed mutagenesis; For (II), for pigs whose SNP marker genotype is G / G or C / G, the G / G or C / G genotype is changed to C / C genotype by site-directed mutagenesis; For (III), for pigs whose SNP marker genotype is A / A or G / A, the A / A or G / A genotype is changed to G / G genotype by site-directed mutagenesis; For (IV), in pigs whose SNP marker genotype is T / T or C / T, the T / T or C / T genotype is changed to C / C genotype by site-directed mutagenesis; For (V), the pigs whose SNP marker genotype is T / T or C / T are mutated to C / C genotype by site-directed mutagenesis; For (VI), the pigs whose SNP marker genotype is C / C or C / T are mutated to T / T genotype by site-directed mutagenesis; For (VII), for pigs whose SNP marker genotype is G / G or G / A, the G / G or G / A genotype is mutated to A / A genotype by site-directed mutagenesis.

9. The method for establishing a new pig strain and / or new pig breed for increasing UMP content or improving pork quality-related traits according to claim 8, characterized in that: The mutation method is to use a transgenic method or a gene editing method to perform mutation.

Images