SNP marker influencing pig AMP content and application thereof

Abstract

The invention relates to the technical field of molecular markers and animal genetic breeding, in particular to an SNP (Single Nucleotide Polymorphism) marker influencing the pig AMP (Adenosine monophosphate) content and application thereof. On the basis of three test swinery of American-series purebred landrace pigs, American-series purebred large white pigs and American-series purebred Duroc, pig whole genome re-sequencing and GWAS analysis research are adopted, 14 SNP molecular markers remarkably related to the AMP content are determined, dominant alleles of the SNP are optimized, the frequency of the dominant alleles can be increased generation by generation, the AMP content can be increased, the number of the SNP molecular markers is increased, and the number of the SNP molecular markers is increased. The pig genetic improvement progress is accelerated, so that the economic benefit of breeding pig breeding is effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers and animal genetic breeding, in particular to a SNP marker affecting pig AMP content and application thereof. Background Art

[0002] Adenosine monophosphate (AMP) is a compound composed of one adenosine molecule and one phosphate group. It is a nucleotide obtained by the double hydrolysis of ATP. AMP is one of the components of RNA and is also a component of NAD. + and NADP. It has multiple potential advantages in breeding. First, AMP has a certain basis for umami, and synergizes with IMP and GMP to enhance the umami perception of meat products. It can also be converted into IMP and is an important flavor potential precursor. Secondly, AMP is a signaling molecule of cellular energy status, which can activate the AMPK pathway, participate in the regulation of fat metabolism, muscle generation and oxidative stress response, and has a positive effect on improving meat quality and increasing lean meat rate. In post-slaughter metabolism, AMP affects the glycolysis rate and pH drop, which helps to maintain meat color, tenderness and water retention. In addition, the ability of AMP to generate uric acid after metabolism is weaker than that of inosine, and it is safer in controlling the purine burden. In summary, moderately increasing the AMP content is an effective breeding strategy to achieve the dual goals of flavor optimization and healthy meat quality.

[0003] Marker-Assisted Selection (MAS) in pigs is a breeding technique based on molecular genetic markers. By identifying molecular markers linked to genes for target traits, MAS indirectly screens for superior genotypes to accelerate genetic improvement. Genome-wide association studies (GWAS) utilize high-throughput genotyping technologies (such as SNP arrays and sequencing) to identify mutations significantly associated with target traits. They are widely used to explore the genetic nature of phenotypic variation. GWAS can identify molecular markers associated with important economic traits in pigs and apply these markers to marker-assisted breeding in pigs.

[0004] Therefore, GWAS analysis can be used to identify SNP markers significantly associated with AMP content in pig muscle. These markers can be applied to molecular marker-assisted breeding in pigs to precisely improve AMP content at the genetic level. This strategy can significantly accelerate the genetic improvement of AMP, a key flavor and meat quality trait, and thereby enhance the economic value of pork by optimizing its flavor quality. Summary of the Invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a SNP marker that affects the AMP content of pigs.

[0006] Another object of the present invention is to provide applications of the above-mentioned SNP markers.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] A SNP marker affecting pig AMP content comprises at least one of the following SNP markers:

[0009] (I) The SNP site corresponds to the C>T mutation at position 32536427 on chromosome 2 of the international porcine genome version 11.1;

[0010] (II) The SNP site corresponds to the T>G mutation at position 32536373 on chromosome 2 of the international porcine genome version 11.1;

[0011] (III) The SNP site corresponds to the A>G mutation at position 136973141 on chromosome 6 of the international porcine genome version 11.1;

[0012] (IV) The SNP site corresponds to the T>TACCACCACC mutation at position 133224163 on chromosome 6 of the international porcine genome version 11.1;

[0013] (V) The SNP site corresponds to the G>A mutation at position 136598298 on chromosome 6 of the international porcine genome version 11.1;

[0014] (VI) The SNP site corresponds to the G>A mutation at position 6299793 on chromosome 9 of the international porcine genome version 11.1;

[0015] (VII) The SNP site corresponds to the T>G mutation at position 6280446 on chromosome 9 of the international porcine genome version 11.1;

[0016] (VIII) The SNP site corresponds to the T>C mutation at position 6304526 on chromosome 9 of the international porcine genome version 11.1;

[0017] (IX) The SNP site corresponds to the T>G mutation at position 41059384 on chromosome 18 of the international porcine genome version 11.1;

[0018] (Ⅹ) The SNP site corresponds to the A>G mutation at position 73513150 on chromosome 16 of the international porcine genome version 11.1;

[0019] (Ⅺ) The SNP site corresponds to the G>A mutation at position 6452450 on chromosome 9 of the international porcine genome version 11.1;

[0020] (Ⅻ) The SNP site corresponds to the G>T mutation at position 6349025 on chromosome 9 of the international porcine genome version 11.1;

[0021] (ⅩⅢ) The SNP site corresponds to the G>A mutation at position 6245852 on chromosome 9 of the international porcine genome version 11.1;

[0022] (ⅩⅣ) The SNP site corresponds to the G>T mutation at position 6275369 on chromosome 9 of the international porcine genome version 11.1.

[0023] In a specific embodiment:

[0024] For (I), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 1, wherein M in the sequence is T or C, and the SNP site is the nucleic acid single base mutation T278-C278 at position 278 of the sequence annotation of SEQ ID NO: 1.

[0025] For (VI), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 2, wherein M in the sequence is A or G, and the SNP site is the nucleic acid single base mutation A223-G223 at position 223 of the sequence annotation of SEQ ID NO: 2.

[0026] For (IX), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 3, wherein M in the sequence is G or T, and the SNP site is the nucleic acid single base mutation G274-T274 at position 274 of the sequence annotation of SEQ ID NO: 3.

[0027] For (I)-(V), the source of the pig is American Duroc pig or its synthetic line.

[0028] For (VI)-(VIII), the pig is derived from American Landrace pig or its synthetic strain.

[0029] For (IX)-(X), the source of the pig is American Large White pig or its synthetic line.

[0030] For (XI)-(XIV), the pigs are American Landrace pigs, American Large White pigs, American Duroc pigs or their synthetic lines.

[0031] A primer combination for detecting the above-mentioned SNP marker comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, whose nucleotide sequences are shown in SEQ ID NO:4-9.

[0032] A kit for detecting the above-mentioned SNP marker comprises the above-mentioned primer combination.

[0033] The SNP marker, primer combination or kit is used in identifying pig or pork AMP content or meat quality related traits, screening pig breeds with high AMP content or excellent meat quality, or genetic breeding of pig AMP content or meat quality related traits.

[0034] A method for genetic improvement of pigs, comprising the following steps:

[0035] Determine the above SNP markers for the sows in the sow core group and make corresponding selections based on the SNP markers:

[0036] For (I), selecting from the core population of sows individuals with a C / C genotype at position 32536427 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating sows with a C / T genotype, so as to increase the frequency of the allele C at this site generation by generation;

[0037] For (II), select from the core group of sows the T / T genotype at position 32536373 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminate the T / G genotype sows to increase the frequency of the T allele at this site generation by generation;

[0038] For (III), selecting from the core group of sows those with the G / G or G / A genotype at position 136973141 on chromosome 6 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation;

[0039] For (IV), select from the core group of sows the genotype of TACCACCACC / TACCACCACC or T / TACCACCACC at position 133224163 on chromosome 6 of the International Porcine Genome Version 11.1, and eliminate the genotype of T / T sows to increase the frequency of the allele TACCACCACC at this site generation by generation;

[0040] For (V), selecting from the core population of sows those with the A / A or A / G genotype at position 136598298 on chromosome 6 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of allele A at this site generation by generation;

[0041] For (VI), selecting from the core population of sows those with the A / A or G / A genotype at position 6299793 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of allele A at this site generation by generation;

[0042] For (VII), selecting from the core population of sows those with the T / T or T / G genotype at position 6280446 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of the T allele at this site generation by generation;

[0043] For (VIII), selecting from the core population of sows individuals with a T / T or C / T genotype at position 6304526 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating sows with a C / C genotype to increase the frequency of the T allele at this site generation by generation;

[0044] For (IX), selecting from the core group of sows those with the G / G or T / G genotype at position 41059384 on chromosome 18 of the International Porcine Genome Version 11.1, and eliminating those with the T / T genotype to increase the frequency of the G allele at this position generation by generation;

[0045] For (X), selecting from the core population of sows those with the G / G or A / G genotype at position 73513150 on chromosome 16 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation;

[0046] For (XI), selecting from the core population of sows those with the G / G or G / A genotype at position 6452450 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation;

[0047] For (XII), selecting from the core population of sows those with the T / T or T / G genotype at position 6349025 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of the allele T at this site generation by generation;

[0048] For (XIII), selecting from the core population of sows those with the G / G or G / A genotype at position 6245852 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation;

[0049] For (XIV), select breeding pig individuals with T / T or T / G genotype at position 6275369 on chromosome 9 of the international porcine genome version 11.1 from the breeding pig core group, and eliminate breeding pig individuals with G / G genotype to increase the frequency of allele T at this site generation by generation.

[0050] A method for identifying AMP content or meat quality-related traits in pigs or pork, comprising the following steps:

[0051] Determine the above-mentioned SNP markers of pigs or pork, and judge the AMP content or meat quality-related traits of pigs or pork based on the SNP sites of the SNP markers:

[0052] For (I), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 32536427 on chromosome 2 of the International Porcine Genome Version 11.1, as follows: C / C genotype, C / T genotype;

[0053] For (II), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 32536373 on chromosome 2 of the International Porcine Genome Version 11.1, which is: T / T genotype, T / G genotype;

[0054] For (III), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 136973141 on chromosome 6 of the International Porcine Genome Version 11.1, which is: G / G genotype, G / A genotype and A / A genotype;

[0055] For (IV), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 133224163 on chromosome 6 of the International Porcine Genome Version 11.1, which is: TACCACCACC / TACCACCACC genotype, T / TACCACCACC genotype and T / T genotype;

[0056] For (V), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 136598298 on chromosome 6 of the International Porcine Genome Version 11.1, which is: A / A genotype, A / G genotype and G / G genotype;

[0057] For (VI), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 6299793 on chromosome 9 of the International Porcine Genome Version 11.1, which is: A / A genotype, G / A genotype and G / G genotype;

[0058] For (VII), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 6280446 on chromosome 9 of the International Porcine Genome Version 11.1, as follows: T / T genotype, T / G genotype, and G / G genotype;

[0059] For (VIII), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 6304526 on chromosome 9 of the International Porcine Genome Version 11.1, as follows: T / T genotype, C / T genotype and C / C genotype;

[0060] For (IX), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 41059384 on chromosome 18 of the International Porcine Genome Version 11.1, which is: G / G genotype, T / G genotype and T / T genotype;

[0061] For (X), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 73513150 on chromosome 16 of the International Porcine Genome Version 11.1, which is: G / G genotype, A / G genotype and A / A genotype;

[0062] For (XI), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 6452450 on chromosome 9 of the International Porcine Genome Version 11.1, as follows: G / G genotype, G / A genotype and A / A genotype;

[0063] For (XII), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 6349025 on chromosome 9 of the International Porcine Genome Version 11.1, as follows: T / T genotype, T / G genotype and G / G genotype;

[0064] For (XIII), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 6245852 on chromosome 9 of the International Porcine Genome Version 11.1, which is: G / G genotype, G / A genotype and A / A genotype;

[0065] For (XIV), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 6275369 on chromosome 9 of the International Porcine Genome Version 11.1, which are: T / T genotype, T / G genotype and G / G genotype.

[0066] Application of the SNP marker, primer combination or kit in the field of gene editing or transgenic.

[0067] A method for establishing a new pig strain and / or new pig breed for increasing pig AMP content or improving meat quality-related traits comprises the following steps:

[0068] The above-mentioned SNP markers of pigs were determined, and the following mutations were performed based on the SNP markers:

[0069] For (I), the genotype of the SNP marker is C / T in pigs, and the C / T genotype is mutated to C / C genotype by site-directed mutagenesis;

[0070] For (II), the genotype of the SNP marker is T / G in pigs, and the T / G genotype is mutated to T / T genotype by site-directed mutagenesis;

[0071] For (III), for pigs whose SNP marker genotype is G / A or A / A, the G / A or A / A genotype is mutated to the G / G genotype by site-directed mutagenesis;

[0072] For (IV), for pigs whose SNP marker genotype is T / TACCACCACC or T / T, the T / TACCACCACC or T / T genotype is mutated to TACCACCACC / TACCACCACC genotype by site-directed mutagenesis;

[0073] For (V), for pigs whose SNP marker genotype is A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype by site-directed mutagenesis;

[0074] For (VI), for pigs whose SNP marker genotype is G / A or G / G, the G / A or G / G genotype is mutated to A / A genotype by site-directed mutagenesis;

[0075] For (VII), for pigs whose SNP marker genotype is T / G or G / G, the T / G or G / G genotype is mutated to T / T genotype by site-directed mutagenesis;

[0076] For (VIII), for pigs whose SNP marker genotype is C / C or C / T, the C / C or C / T genotype is mutated to T / T genotype by site-directed mutagenesis;

[0077] For (IX), for pigs whose SNP marker genotype is T / G or T / T, the T / G or T / T genotype is mutated to a G / G genotype by site-directed mutagenesis;

[0078] For (X), the genotype of the SNP marker is A / G or A / A in pigs, and the A / G or A / A genotype is mutated to G / G genotype by site-directed mutagenesis;

[0079] For (XI), for pigs whose SNP marker genotype is G / A or A / A, the G / A or A / A genotype is mutated to a G / G genotype by site-directed mutagenesis;

[0080] For (XII), for pigs whose SNP marker genotype is T / G or G / G, the T / G or G / G genotype is mutated to a T / T genotype by site-directed mutagenesis;

[0081] For (XIII), for pigs whose SNP marker genotype is G / A or A / A, the G / A or A / A genotype is mutated to a G / G genotype by site-directed mutagenesis;

[0082] For (XIV), in pigs whose SNP marker genotype is T / G or G / G, the T / G or G / G genotype is mutated to T / T genotype by site-directed mutagenesis.

[0083] The mutation method is to use a transgenic method or a gene editing method to perform mutation.

[0084] The mutation method is preferably to perform mutation using the CRISPR / Cas9 gene editing method.

[0085] The present invention has the following advantages and effects compared to the prior art:

[0086] (1) The present invention is based on three experimental pig groups, namely, American purebred Landrace pigs, American purebred Large White pigs, and American purebred Duroc pigs. The present invention uses pig whole genome resequencing and GWAS analysis to study and determine 14 SNP molecular markers that are significantly correlated with AMP content. At least one of the SNP markers of the present invention is used to detect relevant indicators of pigs, or at least one of these SNP markers is used to perform genetic improvement.

[0087] (2) The present invention establishes a set of efficient and accurate molecular marker-assisted breeding technologies based on SNP markers that affect the AMP content of pigs, including primers and kits for detecting the SNP markers, methods for identifying the AMP content or meat quality-related traits of pigs or pork, methods for genetic improvement of pigs, etc., which are applied to the genetic improvement of pig AMP content and meat quality-related traits, and can quickly and accurately select pigs for AMP content and meat quality-related traits, thereby accelerating the breeding process.

[0088] (3) The present invention uses molecular breeding to solve the problem of low AMP content. By optimizing the dominant allele of the above-mentioned SNP, the dominant allele frequency can be increased from generation to generation, the AMP content can be improved, the progress of pig genetic improvement can be accelerated, and the economic benefits of pig breeding can be effectively improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] Figure 1 This is the Manhattan plot of the GWAS analysis of AMP content traits in different experimental groups on different chromosomes; the X-axis is the position of the molecular marker site on the chromosome, and the Y-axis is the -log 10 (P value).

[0090] Figure 2 This is a violin plot of the AMP content of different genotypes at all sites in the corresponding population. The X-axis represents the genotype of the SNP molecular marker site, and the Y-axis represents the AMP content of the individual. DETAILED DESCRIPTION

[0091] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0092] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0093] In the examples, the standard substance for HPLC detection is adenylic acid (CAS: 61-19-8), which was purchased from Shanghai Anpu Laboratory Technology Co., Ltd.

[0094] Example 1

[0095] 1. Experimental Animals

[0096] The pig populations used in the present invention are: American purebred Landrace pigs (173 heads), American purebred Large White pigs (166 heads), and American purebred Duroc pigs (158 heads).

[0097] All pigs were obtained from Jiangxi Yudu Jiada Livestock Co., Ltd. and slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. at 200 days of age in the slaughterhouse's butchering area. Carcasses were obtained after slaughter, exsanguination, removal of hair, viscera, head, tail, and limbs (below the wrist and joints), and skinning. Sampling was completed within 30 minutes of slaughter to minimize the effects of postmortem metabolism on the content of purine nucleotides and their metabolites. The eye muscle (longissimus dorsi) was precisely dissected from the left side of the carcass between the first and second lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0 g of muscle tissue was quickly transferred to a 2 mL cryotube, minced, and quickly frozen in liquid nitrogen (-196°C). The sample was then stored in a -80°C freezer until the experiment.

[0098] 2. Quantitative determination of AMP content in pork by HPLC

[0099] (1) Extraction of AMP: Accurately weigh 0.4 g (accurate to 0.001 g) of the longissimus dorsi muscle sample from the minced longissimus dorsi muscle and place it in a 15 mL polypropylene acid-resistant centrifuge tube.

[0100] (2) Acid hydrolysis extraction: Add 6 mL of 6% (w / w) perchloric acid solution precooled to 4°C, and then homogenize using a handheld high-speed homogenizer for 45 seconds (run 10 seconds / pause 5 seconds, cycle 3 times), with ice bath intermittently to prevent overheating.

[0101] (3) Purification by centrifugation: Transfer the homogenate to a constant temperature water bath oscillator (4°C) and oscillate at 200 rpm for 15 min to promote the release of nucleotides; centrifuge at 4°C and 5000 rpm for 10 min, collect the supernatant into a new tube, repeat the centrifugation twice, and combine the supernatants from the two centrifugations.

[0102] (4) Precise pH control for acid-base neutralization: Place the combined supernatant in step (3) in an ice bath, and use a micropipette to add 3 mol / L NaOH solution dropwise to adjust the pH to 6.5 ± 0.1 (using a pH meter for real-time monitoring), which can minimize the interference of ATPase activity; add ultrapure water to make the volume to 10 mL, vortex mix, and let it stand for 10 minutes to promote ion balance.

[0103] (5) The AMP content (unit: mg / 100 g) in the longissimus dorsi muscle extract of each individual pig was detected by high performance liquid chromatography (HPLC). The HPLC analysis was performed on an ACQUITY UPLCH-Class PLUS System (Waters). The chromatographic column was a Waters BEH C18 (1.7 μm, 2.1× 100 mm), the mobile phase was 0.05 mol / L KH2PO4 buffer (pH 6.0)-methanol (95:5, v / v), the flow rate was 0.2 mL / min (isocratic elution), the column temperature was 30°C, the detection wavelength was 254 nm, the injection volume was 2 μL, and the external standard method was used for quantification. The standard curve was required to meet the requirement of R² ≥ 0.999.

[0104] (6) The concentration data obtained from the HPLC system were converted from the original unit of µg / mL to mg / 100g using the following formula:

[0105]

[0106] Where C represents the content of AMP in 100 g of pork (mg / 100 g), and C0 represents the concentration of AMP measured by HPLC (µg / mL).

[0107] This study performed descriptive statistics on HPLC data for AMP in the longissimus dorsi muscle of three commercial pig breeds (Large White, Landrace, and Duroc). The sample size (N), mean, standard deviation (SD), extreme values ​​(Min-Max), and coefficient of variation (CV) were systematically calculated. The descriptive statistical results are shown in Table 1. As shown in the table, the mean 5'-adenylic acid (AMP) content (52.32 ± 0.57) in Duroc was significantly higher than that in Large White and Landrace, with the lowest coefficient of variation (13.7%). Inter-individual variability was minimal, suggesting a more stable AMP biosynthesis pathway in Duroc.

[0108] Table 1. Descriptive statistics of AMP content of three varieties (unit: mg / 100 g)

[0109]

[0110] Example 2

[0111] 1. Acquisition, quality control, and typing of pig whole-genome resequencing data

[0112] (1) DNA extraction: Ear tissue samples were collected from each individual of the three experimental pig groups in Example 1, and genomic DNA of each individual was extracted using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was between 1.8 and 2.0 and the A260 / 230 ratio was between 1.7 and 1.9.

[0113] (2) DNA sequencing: The concentration of DNA samples that meet the standards was diluted to 50 ng / μL, and the whole genome resequencing was completed using the BGI T7 sequencing platform (double-end 150 bp sequencing mode). The average sequencing depth of the samples reached 30×, and the raw sequencing data in fastq format were obtained. Clean reads were obtained through fastp (v0.23.0) quality control for subsequent analysis.

[0114] (3) Sequence alignment: The data obtained in step (2) were aligned with the Sscrofa11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.

[0115] (4) Variation detection: Use samtools (v1.10) to sort and convert the sam format files in step (3) into bam format files, then use Sambamba (v0.8.2) to remove PCR duplicate sequences in the bam format files, and finally use Graphtyper (v2.7.7) to detect genetic variations in all individual bam files to obtain population-level genotype data (vcf file).

[0116] (5) Variant quality control: samtools was used to perform quality control on the population-level genotype data obtained in step (4). For variant sites that met the conditions of "FILTER="PASS" and variant detection quality value GQ>20, high-quality detection sites were retained. Plink (v1.9) was further used to perform quality control on the population-level genotype data, excluding variant sites with minor allele frequency (MAF) less than 5% and samples with individual genotype call rate less than 80%. Finally, beagle (r1399) was used to perform self-filling on the genotypes to obtain high-quality genotype data.

[0117] After a series of treatments using the above methods, 1,928,103, 1,964,653, and 1,513,322 mutation sites (including SNPs and Indels) were obtained in Large White, Landrace, and Duroc, respectively.

[0118] 2. Genome-wide association study (GWAS) analysis and meta-analysis

[0119] (1) Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1) was used to perform genome-wide association analysis on phenotypic data corrected for confounding factors. Specifically:

[0120] ① Processing of phenotype: The present invention uses the lm() function in R language to perform simple linear regression, that is, gender and batch are put into the function, and the corrected residual is used as the phenotype of the final association analysis.

[0121] ② The univariate linear mixed model (ULMM) was used for statistical inference, and its mathematical expression is constructed as follows:

[0122] Where y represents the n-dimensional vector of the phenotype to be analyzed (quantitative trait or binary vector), which is the AMP content in this study; W represents a matrix consisting of a column of "1" (n × c dimensions); α represents the effect of the corresponding covariate and the intercept value vector (c dimension); x represents the vector of genotypes at the test site (n dimension); β represents the vector of effect sizes at the test site; u represents the mean of the phenotype to be analyzed, and the covariance-variance matrix is ​​λτ -1 K random effect vectors (n dimensions) of a multivariate normal distribution; ε indicates that the mean is 0, and the covariance-variance matrix is ​​τ -1 The remaining residual vector (n-dimensional) of In. In two n-ary normal distributions, n represents the number of phenotypes, τ -1 represents the variance of the residuals, λ represents the ratio of the variance of the random effect to the variance of the residuals, K represents the n×n kinship matrix, and In represents the n×n identity matrix. MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, the genome-wide significance threshold was set at 0.05 / N (Bonferroni correction), where N is the number of valid SNPs / indels.

[0123] (2) Using the results of the above GWAS analysis, a meta-analysis of AMP content in these three groups was performed using the METAL software according to conventional methods. The meta-analysis was performed based on the standard error weighting method (SCHEME STDERR).

[0124] The present invention is based on GWAS analysis ( Figure 1 ), a total of 14 representative SNP loci were obtained (including those obtained through meta-analysis). Their basic genetic parameter information is shown in Table 2. The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the SNP name for a locus was not available on the website, the SNP name was presented as "chromosome_position." Other important genetic parameter information for each representative locus can be obtained from the GWAS analysis results using GEMMA software, including chromosome location and position information, alleles, effect size, and P value (Wald test).

[0125] Table 2. Basic genetic parameter information of 14 representative SNP loci in pigs

[0126]

[0127] Note: The meta-analysis integrated genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.

[0128] 3. Analysis of AMP Content Phenotypes in Different Genotypes

[0129] The genotypes of the molecular marker sites displayed by each individual of the 497 pigs in the three groups were extracted from the sequencing files using Plink (v1.9). After counting the number of individuals of each genotype, the genotypes of these individuals were matched with their corresponding AMP content. Then, the summarise function in the dplyr package in R language was used to statistically analyze the differences in phenotypic distribution under different genotypes. The results are shown in Tables 3 and Figure 2 As shown in Figure 2. Among them, the P value is obtained from the variance test.

[0130] Table 3. Effects of various molecular marker sites on AMP content (unit: mg / 100g)

[0131]

[0132] 4. Heritability Analysis

[0133] Heritability is the most important basic genetic parameter in quantitative genetics and can be divided into broad-sense heritability, narrow-sense heritability and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h 2 ), which refers to the proportion of the variance of the quantitative trait's breeding value to the phenotypic variance. It is the additive effect after eliminating dominant and epistatic effects and is stably inherited across generations. This method estimates single-marker heritability based on the effect value (β) and its standard error (SE) for each locus in the GWAS result file from step 3 above, and takes their mean as the approximate narrow-sense heritability at the genome-wide level. The specific calculation formula is as follows:

[0134]

[0135] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.

[0136] As shown in Table 4 , the estimated heritability values ​​of different varieties were all at a medium level, roughly distributed between 0.352 and 0.354.

[0137] Table 4. Estimated heritability of AMP content in three populations (h 2 )

[0138]

[0139] Example 3

[0140] This example provides a method and process for detecting the SNP markers in Example 2. Specifically, the SNP markers 2_32536427, 9_6299793, and 18_41059384 are used as examples. The corresponding pig breeds are Duroc, Landrace, and Large White, respectively. The specific method is as follows:

[0141] 1. Primer Design

[0142] (1) The target fragment containing the SNP site significantly associated with AMP content in American Duroc pigs is a 578 bp nucleotide sequence on chromosome 2 (SEQ ID NO: 1). The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and their nucleic acid sequences are as follows:

[0143] Upstream primer primer-F1: 5′-GAGGTACCACGTCACACCAG-3′ (SEQ ID NO: 4);

[0144] Downstream primer primer-R1: 5′-GCCCCCAAACTGTCTCCTTT-3′ (SEQ ID NO: 5).

[0145] (2) The target fragment containing the SNP site significantly associated with the AMP content of American Landrace pigs is a 501 bp nucleotide sequence on chromosome 9 (SEQ ID NO: 2). The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and their nucleic acid sequences are as follows:

[0146] Upstream primer primer-F2: 5′-GCAGGGAAGCCAGGAATCTC-3′ (SEQ ID NO: 6);

[0147] Downstream primer: primer-R2: 5′-TGGTCTCAAGGCACCACATC-3′ (SEQ ID NO: 7).

[0148] (3) The target fragment containing the SNP site significantly associated with the AMP content of American Large White pigs is a 559 bp nucleotide sequence on chromosome 18 (SEQ ID NO: 3). The upstream and downstream primers for sequence amplification are primer-F3 and primer-R3. The nucleic acid sequence is as follows:

[0149] Upstream primer primer-F3: 5′-TGTCTTTCTCTGTCTGACTTCGT-3′ (SEQ ID NO: 8);

[0150] Downstream primer: primer-R3: 5′-GGGCAAAGTGCACTTTTTCTCT-3′ (SEQ ID NO: 9).

[0151] 2. PCR Amplification

[0152] To a 10 μL reaction system, add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2× Taq PCR StarMix with Loading Dye, and 0.3 μL each of the forward and reverse primers. PCR reaction conditions were: 94°C denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55-65°C for 30 s, and extension at 72°C for 45 s, with a final extension at 72°C for 5 min.

[0153] 3. DNA Sequencing

[0154] DNA sequencing: performed at Shenzhen BGI Genomics Co., Ltd., with both forward and reverse reactions of the gene fragments tested. The resulting sequence was compared with the NCBI genome sequence to identify the mutation at the corresponding SNP site.

[0155] SEQ ID NO:1 (chr2:32536149-32536727): GAGGTACCACGTCACACCAGCCAGAATGGCCATCATCAAAAAGTCTACAAACAATAAGTGCTCGAGAGGATATGGAGGAAAGGGAACCCTATTACACTGTTGGTGGGATTGTAAATTTGTGCAACCGTTGTGGAAAAC AGTATGGAGGTGCCTCAAAAACTAAAAATAGAATACATTTGATCTAGCAATCCCACTCCTGGGCTTCTATCCAGAGAAAACCATTACTTGCAAAGACACATGTACTCTAATGTTCATAGCAGCACTATTTGCAATAGC M(C / T)AAGACATGGAAGCAACCTAAATGTCCATCGACAGAGGAGTGGATCAAGAAGAGGTGGTACACATACACAGTGGAATATTACTCAGCCATTAAAAGGAAAGAAATACCGGCATTTGCAGCAACATGGATGGACCTAGAAATTATCATGCTAAGTGAAGTCAGCCATACAATGAGATACCAACATCAAATGCTTTCACTGACATTTGGAATCTGAAAAAAGAACAGAATGAACTTTGCAAAACAAATACTGACTCACAGACTTTGAAAAACTTATGGTCTCCAAAGGAGACAGTTTGGGGGC SEQ ID NO:2(chr9:6299570-6300071): GCAGGGAAGCCAGGAATCTCTTAGACTGGGGGGCCTACAGCAGTGCTTCTCAAACTAATATGCATACGACTCACCTTGGGTTGTGAGAGAATGCAGGTGTGGAGTCTGAGAATCTGCATTTCTAAAAGATTCTATGATTGCAGAAGCTACCGGTCTGTGGCCCCACTTTCTATGGACTTTTTAGATTTTCAGCAAGAGCCAGAGCAGTGCCAGAGCCCAGCA M(A / G) CGCAGAGAGGGGATGAGCCTGCTGTGACCACGGCAGGGCCAGTCCTCAGAGACGGACTTCTGGAAGATCCCTTTCTCCCAGTGGGGCTGCTGAATGGGTCCCAGCAGTGACTGGGGAGACAGGCAGTGATGGAGGCAGGACCAGCCAGGGCCTTCACAGCCTCACAGAAAAGGAGATGCGTTCCCCCTCAGCCCTGTCAGAGGAAGCTAAGTGCAGAGCTCTCGGAGAGAGAGCGATGCTCTCAAGGCCATGGCTTAAGATGTGGTGCCTTGAGACCA SEQ ID NO:3(chr18:41059110-41059669): TGTCTTTCTCTGTCTGACTTCGTTTAGTTTGCTAATCTCTATGTTGCTGCAAATGGCATCATTTCATTCTTCTTTATGGCTGAGTAATATTCCAGTGTATATATGTGTAACATCTTCTTTGTCCATTCATCTGTTG CCGGACATTTATGTTGTTTCCATTGTACCATGACGTTTTCGCTTATGGCCTGGAATACTCCCCCTATCTCTCAGAAGGATTCTGTGTATCTGTCTCTGGCCAGGTCAGATATCCTCACTGCCTTTCCATCTTGCCTG M(T / G) GCAAAATGAGTCTCCTCTGCATGTTCCTGTGGTCCAGGGTCACACATGCCATTGCGCTTTATCTTCCAATTGCTACGCATGCATCAGAATTTCTCACCCCTTATTTGTGAGATACTTATTAATTTCAGACACTTTTCTTATT TAAATTTATATCCCTAACACTTTGCACAGCTTCTGTGGATAGACAAATATTTGTTGTCTCAATATTTGTTGATGTGAATTTAGTGGAAAAAGAGAGATAGTAAAAGGAAGAAAGAAAGAAAAGAGAAAAAGTGCACTTTGCCC

[0156] Note: The M marked in the sequence is the mutation site, which is underlined (the mutated base in brackets is the allele mutation). The bold at the beginning and end of the sequence is the primer sequence binding position.

[0157] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A use of a SNP marker affecting pig AMP content in identifying pig or pork AMP content or meat quality related traits, screening pig breeds with high AMP content or excellent meat quality, or genetic breeding of pig AMP content or meat quality related traits, characterized in that The SNP markers include at least one of the following SNP markers: (I) The SNP site corresponds to the C>T mutation at position 32536427 on chromosome 2 of the international porcine genome version 11.1; (II) The SNP site corresponds to the T>G mutation at position 32536373 on chromosome 2 of the international porcine genome version 11.1; (III) The SNP site corresponds to the A>G mutation at position 136973141 on chromosome 6 of the international porcine genome version 11.1; (IV) The SNP site corresponds to the T>TACCACCACC mutation at position 133224163 on chromosome 6 of the international porcine genome version 11.1; (V) The SNP site corresponds to the G>A mutation at position 136598298 on chromosome 6 of the international porcine genome version 11.1; (VI) The SNP site corresponds to the G>A mutation at position 6299793 on chromosome 9 of the international porcine genome version 11.1; (VII) The SNP site corresponds to the T>G mutation at position 6280446 on chromosome 9 of the international porcine genome version 11.1; (VIII) The SNP site corresponds to the T>C mutation at position 6304526 on chromosome 9 of the international porcine genome version 11.1; (IX) The SNP site corresponds to the T>G mutation at position 41059384 on chromosome 18 of the international porcine genome version 11.1; (Ⅹ) The SNP site corresponds to the A>G mutation at position 73513150 on chromosome 16 of the international porcine genome version 11.1; (Ⅺ) The SNP site corresponds to the G>A mutation at position 6452450 on chromosome 9 of the international porcine genome version 11.1; (Ⅻ) The SNP site corresponds to the G>T mutation at position 6349025 on chromosome 9 of the international porcine genome version 11.1; (ⅩⅢ) The SNP site corresponds to the G>A mutation at position 6245852 on chromosome 9 of the international porcine genome version 11.1; (ⅩⅣ) The SNP site corresponds to the G>T mutation at position 6275369 on chromosome 9 of the international porcine genome version 11.

1.

2. The use according to claim 1, characterized in that: For (I), the nucleic acid sequence of the SNP marker is shown in SEQ ID NO: 1, wherein M in the sequence is T or C; For (VI), the nucleic acid sequence of the SNP marker is shown in SEQ ID NO: 2, wherein M in the sequence is A or G; For (IX), the nucleic acid sequence of the SNP marker is shown in SEQ ID NO: 3, wherein M in the sequence is G or T.

3. A primer combination for detecting SNP markers that affect pig AMP content in identifying pig or pork AMP content or meat quality related traits, screening pig breeds with high AMP content or excellent meat quality, or genetic breeding of pig AMP content or meat quality related traits, characterized in that The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, and the nucleotide sequences thereof are shown in SEQ ID NOs: 4-9.

4. A kit for detecting SNP markers that affect pig AMP content for use in identifying pig or pork AMP content or meat quality-related traits, screening pig breeds with high AMP content or excellent meat quality, or genetic breeding for pig AMP content or meat quality-related traits, characterized in that The kit comprises the primer combination described in claim 3.

5. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the SNP markers of the sows in the sow core group according to claim 1 or 2, and make corresponding selections based on the SNP markers: For (I), selecting from the core population of sows individuals with a C / C genotype at position 32536427 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating sows with a C / T genotype, so as to increase the frequency of the allele C at this site generation by generation; For (II), select from the core group of sows the T / T genotype at position 32536373 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminate the T / G genotype sows to increase the frequency of the T allele at this site generation by generation; For (III), selecting from the core group of sows those with the G / G or G / A genotype at position 136973141 on chromosome 6 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation; For (IV), select from the core group of sows the genotype of TACCACCACC / TACCACCACC or T / TACCACCACC at position 133224163 on chromosome 6 of the International Porcine Genome Version 11.1, and eliminate the genotype of T / T sows to increase the frequency of the allele TACCACCACC at this site generation by generation; For (V), selecting from the core population of sows those with the A / A or A / G genotype at position 136598298 on chromosome 6 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of allele A at this site generation by generation; For (VI), selecting from the core population of sows those with the A / A or G / A genotype at position 6299793 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of allele A at this site generation by generation; For (VII), selecting from the core population of sows those with the T / T or T / G genotype at position 6280446 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of the T allele at this site generation by generation; For (VIII), selecting from the core population of sows individuals with a T / T or C / T genotype at position 6304526 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating sows with a C / C genotype to increase the frequency of the T allele at this site generation by generation; For (IX), selecting from the core group of sows those with the G / G or T / G genotype at position 41059384 on chromosome 18 of the International Porcine Genome Version 11.1, and eliminating those with the T / T genotype to increase the frequency of the G allele at this position generation by generation; For (X), selecting from the core population of sows those with the G / G or A / G genotype at position 73513150 on chromosome 16 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation; For (XI), selecting from the core population of sows those with the G / G or G / A genotype at position 6452450 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation; For (XII), selecting from the core population of sows those with the T / T or T / G genotype at position 6349025 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of the allele T at this site generation by generation; For (XIII), selecting from the core population of sows those with the G / G or G / A genotype at position 6245852 on chromosome 9 of the International Porcine Genome Version 11.1, and eliminating those with the A / A genotype to increase the frequency of the allele G at this site generation by generation; For (XIV), select breeding pig individuals with T / T or T / G genotype at position 6275369 on chromosome 9 of the international porcine genome version 11.1 from the breeding pig core group, and eliminate breeding pig individuals with G / G genotype to increase the frequency of allele T at this site generation by generation.

6. A method for identifying AMP content or meat quality-related traits of pigs or pork, characterized in that The following steps are included: Determine the SNP marker of claim 1 or 2 of pig or pork, and judge the AMP content or meat quality-related traits of the pig or pork based on the SNP site of the SNP marker: For (I), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 32536427 on chromosome 2 of the International Porcine Genome Version 11.1, as follows: C / C genotype, C / T genotype; For (II), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 32536373 on chromosome 2 of the International Porcine Genome Version 11.1, which is: T / T genotype, T / G genotype; For (III), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 136973141 on chromosome 6 of the International Porcine Genome Version 11.1, which is: G / G genotype, G / A genotype and A / A genotype; For (IV), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 133224163 on chromosome 6 of the International Porcine Genome Version 11.1, which is: TACCACCACC / TACCACCACC genotype, T / TACCACCACC genotype and T / T genotype; For (V), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 136598298 on chromosome 6 of the International Porcine Genome Version 11.1, which is: A / A genotype, A / G genotype and G / G genotype; For (VI), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 6299793 on chromosome 9 of the International Porcine Genome Version 11.1, which is: A / A genotype, G / A genotype and G / G genotype; For (VII), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 6280446 on chromosome 9 of the International Porcine Genome Version 11.1, as follows: T / T genotype, T / G genotype, and G / G genotype; For (VIII), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 6304526 on chromosome 9 of the International Porcine Genome Version 11.1, as follows: T / T genotype, C / T genotype and C / C genotype; For (IX), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 41059384 on chromosome 18 of the International Porcine Genome Version 11.1, which is: G / G genotype, T / G genotype and T / T genotype; For (X), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 73513150 on chromosome 16 of the International Porcine Genome Version 11.1, which is: G / G genotype, A / G genotype and A / A genotype; For (XI), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 6452450 on chromosome 9 of the International Porcine Genome Version 11.1, as follows: G / G genotype, G / A genotype and A / A genotype; For (XII), the pigs or pork are ranked from high to low in AMP content or from good to bad in meat quality according to the genotype at position 6349025 on chromosome 9 of the International Porcine Genome Version 11.1, as follows: T / T genotype, T / G genotype and G / G genotype; For (XIII), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 6245852 on chromosome 9 of the International Porcine Genome Version 11.1, which is: G / G genotype, G / A genotype and A / A genotype; For (XIV), the AMP content of the pigs or pork is ranked from high to low or the meat quality traits are ranked from good to bad according to the genotype at position 6275369 on chromosome 9 of the International Porcine Genome Version 11.1, which are: T / T genotype, T / G genotype and G / G genotype.

7. Use of a SNP marker affecting porcine AMP content, a primer combination for detecting a SNP marker affecting porcine AMP content, or a kit for detecting a SNP marker affecting porcine AMP content in the field of gene editing or transgenics, characterized in that: The SNP marker is the SNP marker described in claim 1; The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, and the nucleotide sequence thereof is shown in SEQ ID NO:4-9; The kit comprises the above primer combination.

8. A method for establishing a new pig strain and / or new pig breed with improved pig AMP content or meat quality-related traits, characterized in that The following steps are included: Determine the SNP marker of claim 1 or 2 in a pig, and perform the following mutation based on the SNP marker: For (I), the genotype of the SNP marker is C / T in pigs, and the C / T genotype is mutated to C / C genotype by site-directed mutagenesis; For (II), the genotype of the SNP marker is T / G in pigs, and the T / G genotype is mutated to T / T genotype by site-directed mutagenesis; For (III), for pigs whose SNP marker genotype is G / A or A / A, the G / A or A / A genotype is mutated to the G / G genotype by site-directed mutagenesis; For (IV), for pigs whose SNP marker genotype is T / TACCACCACC or T / T, the T / TACCACCACC or T / T genotype is mutated to TACCACCACC / TACCACCACC genotype by site-directed mutagenesis; For (V), for pigs whose SNP marker genotype is A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype by site-directed mutagenesis; For (VI), for pigs whose SNP marker genotype is G / A or G / G, the G / A or G / G genotype is mutated to A / A genotype by site-directed mutagenesis; For (VII), for pigs whose SNP marker genotype is T / G or G / G, the T / G or G / G genotype is mutated to T / T genotype by site-directed mutagenesis; For (VIII), for pigs whose SNP marker genotype is C / C or C / T, the C / C or C / T genotype is mutated to T / T genotype by site-directed mutagenesis; For (IX), for pigs whose SNP marker genotype is T / G or T / T, the T / G or T / T genotype is mutated to a G / G genotype by site-directed mutagenesis; For (X), the genotype of the SNP marker is A / G or A / A in pigs, and the A / G or A / A genotype is mutated to G / G genotype by site-directed mutagenesis; For (XI), for pigs whose SNP marker genotype is G / A or A / A, the G / A or A / A genotype is mutated to a G / G genotype by site-directed mutagenesis; For (XII), for pigs whose SNP marker genotype is T / G or G / G, the T / G or G / G genotype is mutated to a T / T genotype by site-directed mutagenesis; For (XIII), for pigs whose SNP marker genotype is G / A or A / A, the G / A or A / A genotype is mutated to a G / G genotype by site-directed mutagenesis; For (XIV), in pigs whose SNP marker genotype is T / G or G / G, the T / G or G / G genotype is mutated to T / T genotype by site-directed mutagenesis.

9. The method for establishing a new pig strain and / or new pig breed with improved pig AMP content or meat quality-related traits according to claim 8, characterized in that: The mutation method is to use a transgenic method or a gene editing method to perform mutation.

Images