Method for realizing fixed-point integration of full-length exogenous DNA fragment by using long single-stranded DNA

Abstract

The invention belongs to the technical field of animal genome editing, and particularly relates to a method for realizing fixed-point integration of full-length exogenous DNA fragments by using long single-stranded DNA. The technical problem to be solved by the invention is to provide a method for efficiently realizing site-specific integration of an exogenous full-length gene in a mammal genome. According to the technical scheme, the method for realizing fixed-point integration of the full-length exogenous DNA fragment by using the long single-stranded DNA comprises the following steps: converting a mixture of sgRNA, Cas9mRNA and / or Cas9 protein of a long single-stranded exogenous gene and guiding Cas9 to cut an integration site into recipient cells; the exogenous gene long single strand comprises a 5'homologous arm and a 3 'homologous arm which are arranged on the upstream and downstream of an sgRNA guide cleavage site, a full-length exogenous DNA fragment sequence arranged between the 5' homologous arm and the 3 'homologous arm, and related matching original parts required by expression of the full-length exogenous DNA fragment sequence.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of animal genome editing, and particularly relates to a method for realizing full-length exogenous DNA fragment site-directed integration by using long single-stranded DNA. BACKGROUND

[0002] Pigs are similar to humans in anatomy, physiology and biochemistry, and pig models are considered to be promising transformation models in biomedical research and development. Gene editing technology is a key technical means for breeding genome precise editing pig models or strains.

[0003] Existing gene editing technologies mainly include: 1. using site-specific nucleases (ZFN, TALEN, CRISPR / Cas9, etc.) to perform site-directed cleavage on a target site of a genome to form a double-strand break (DSB), and using a cell repair mechanism for the DSB to realize site-directed mutation of the genome; 2. during cell repair of the DSB, introducing short single-stranded DNA or long double-stranded DNA containing homologous sequences as a template to realize mutation sequence or exogenous gene knock-in through a “homology-directed repair” (HDR) mechanism; 3. through a CRISPR-based base editor, performing a deamination reaction on a specific base at a specific site of a genome to realize conversion of the specific base; and 4. by introducing a reverse transcriptase into a Cas9 (H840D) molecule and introducing an RNA single-stranded sequence as a reverse transcription template at the 3' end of an sgRNA, a mutation sequence or an inserted exogenous short fragment is introduced at a specific site of a genome through a reverse transcription reaction, i.e. “Prime Edition” technology. The above-mentioned technical methods effectively solve the problems of specific knock-out of a target gene, specific editing of a single or several bases, and knock-in of a short exogenous gene fragment, but have not effectively solved the problem of high-efficiency site-directed integration of a long sequence and a functionally complete exogenous gene or DNA fragment in a genome. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a method capable of efficiently realizing site-directed integration of an exogenous full-length gene in a mammalian genome.

[0005] The technical solution of the present application is a method for realizing high-efficiency site-directed integration of a full-length exogenous DNA fragment by using long single-stranded DNA, comprising the following steps: transforming a mixture of a full-length exogenous DNA fragment long single strand, sgRNA for guiding cleavage of an integration site of Cas9, Cas9 mRNA and / or Cas9 protein into a recipient cell; the full-length exogenous DNA fragment long single strand comprises 5' homologous arms and 3' homologous arms upstream and downstream of a cleavage site guided by the sgRNA, and at least one coding sequence of a polypeptide or a protein between the 5' homologous arms and the 3' homologous arms.

[0006] Further, in order to drive the expression of the full-length exogenous DNA fragment, a promoter can be arranged upstream of the coding sequence of the polypeptide or protein.

[0007] In particular, in order to realize the independent expression of the full-length exogenous DNA fragment, at least one polyA can be arranged downstream of the coding sequence of the polypeptide or protein.

[0008] In particular, the structure of the long single strand of the exogenous gene is: 5' homologous arm-promoter-at least one coding sequence of polypeptide or protein-polyA-3' homologous arm.

[0009] Further, the length of the 5' homologous arm and the 3' homologous arm is 500-1000 bp.

[0010] Further, two or more coding sequences of polypeptide or protein are connected by a self-cleavage peptide.

[0011] Specifically, the self-cleavage peptide is Fp2A, P2A, T2A or E2A.

[0012] The promoter is an EF1α promoter or other promoters that can drive gene expression according to the needs.

[0013] In particular, the final concentration of each of the mixture of the long single strand of the full-length exogenous DNA fragment, the sgRNA for guiding Cas9 to cut the integration site and the Cas9 mRNA is 10-20 ng / μL, 5-20 ng / μL and 10-20 ng / μL.

[0014] Preferably, the final concentration of each of the mixture of the long single strand of the full-length exogenous DNA fragment, the sgRNA for guiding Cas9 to cut the integration site and the Cas9 mRNA is 10 ng / μL, 10 ng / μL and 20 ng / μL.

[0015] Specifically, the recipient cell is a pig early embryonic cell.

[0016] More specifically, the pig early embryo is an embryo at the 4-cell stage or before.

[0017] The application also provides a method for preparing a transgenic pig into which human CD46 and THBD genes are knocked in downstream of the GGTA1 gene promoter of the pig, comprising the following steps:

[0018] S1, determining the integration site of the CD46 and THBD genes, designing sgRNA for guiding Cas9 to cut the integration site, and preparing the sgRNA;

[0019] S2, preparing Cas9 mRNA or Cas9 protein;

[0020] S3, preparing a long single strand of 5' homologous arm-promoter-CD46-THBD-polyA-3' homologous arm; the homologous arm is the sequence on both sides of the integration site;

[0021] S4, introducing a mixture of sgRNA, long single strand, Cas9 mRNA and / or Cas9 protein into pig early embryo cells;

[0022] S5, implanting the pig early embryo treated in step S4 into the oviduct of a recipient sow to make the recipient sow pregnant;

[0023] S6, the pregnant recipient sow gives birth to piglets after the gestation period, obtaining a transgenic pig in which human CD46 and THBD genes are knocked into the downstream of the pig GGTA1 gene promoter.

[0024] In particular, in step S1, the integration site is upstream of the start codon of the pig GGTA1 gene.

[0025] More specifically, in step S1, the nucleotide sequence of sgRNA is shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0026] In step S3, CD46 and THBD are connected by a self-cleaving peptide.

[0027] Specifically, the self-cleaving peptide is Fp2A, P2A, T2A or E2A.

[0028] In step S3, the promoter is EF1α promoter.

[0029] Further, in step S3, the length of the 5' homologous arm and the 3' homologous arm is 500-1000 bp.

[0030] In particular, the polyA is at least 1 and is selected from SV40pA or / and BGHpA.

[0031] Preferably, the nucleotide sequence of the long single strand of 5' homologous arm-promoter-CD46-THBD-polyA-3' homologous arm is shown in SEQ ID NO. 1.

[0032] Preferably, in step S4, the final concentration of each of the mixture of long single strand, sgRNA guiding Cas9 to cut the integration site and Cas9 mRNA is 10-20 ng / μL, 5-20 ng / μL and 10-20 ng / μL.

[0033] Preferably, in step S4, the final concentration of each of the mixture of long single strand, sgRNA guiding Cas9 to cut the integration site and Cas9 mRNA is 10 ng / μL, 10 ng / μL and 20 ng / μL.

[0034] More specifically, in step S4, the pig early embryo cells are 4-cell stage and before embryo cells.

[0035] The application also provides a kit for preparing a transgenic pig into which human CD46 and THBD genes are knocked in downstream of a pig GGTA 1 gene promoter, comprising: sgRNA for guiding Cas9 to cut an integration site and a long single strand of 5' homologous arm-promoter-CD46-THBD-polyA-3' homologous arm.

[0036] In particular, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0037] Preferably, the nucleotide sequence of the long single strand of 5' homologous arm-promoter-CD46-THBD-polyA-3' homologous arm is shown in SEQ ID NO. 1.

[0038] Further, the kit further comprises Cas9 mRNA and / or Cas9 protein.

[0039] The application also provides a method for preparing a transgenic pig model expressing humanized GJB2 c.235delC, comprising the following steps:

[0040] S1, determining an integration site of GJB2 c.235delC, designing sgRNA for guiding Cas9 to cut the integration site, and preparing the sgRNA;

[0041] S2, preparing Cas9 mRNA or Cas9 protein;

[0042] S3, preparing a long single strand of 5' homologous arm-hGJB2 c.235delC coding sequence-polyA-3' homologous arm; the homologous arms are sequences on both sides of the integration site;

[0043] S4, introducing a mixture of the sgRNA, the long single strand, the Cas9 mRNA and / or the Cas9 protein into pig early embryo cells;

[0044] S5, transplanting the pig early embryo treated in step S4 into the oviduct of a recipient sow to make the recipient sow pregnant;

[0045] S6, the pregnant recipient sow gives birth to a piglet after the gestation period is completed, to obtain a transgenic pig model expressing humanized GJB2 c.235delC.

[0046] Specifically, in step S1, the integration site is upstream of the start codon of the GJB2 gene.

[0047] The nucleotide sequence of the sgRNA is shown as SEQ ID NO. 5.

[0048] Further, the length of the 5' homologous arm and the 3' homologous arm is 500-1000 bp.

[0049] In particular, the polyA is at least 1 and is selected from SV40pA or / and BGHpA.

[0050] The nucleotide sequence of the 5' homologous arm-hGJB2 c.235delC coding sequence-polyA-3' homologous arm is shown as SEQ ID NO. 2.

[0051] Preferably, in step S4, the final concentration of each of the long single strand, sgRNA for guiding Cas9 to cut the integration site and Cas9 mRNA in the mixture is 10-20 ng / μL, 5-20 ng / μL and 10-20 ng / μL.

[0052] Preferably, in step S4, the final concentration of each of the long single strand, sgRNA for guiding Cas9 to cut the integration site and Cas9 mRNA in the mixture is 10 ng / μL, 10 ng / μL and 20 ng / μL.

[0053] More specifically, in step S4, the porcine early embryonic cells are embryonic cells at the 4-cell stage and before.

[0054] The application also provides a kit for preparing a pig model expressing a humanized GJB2 c.235delC transgene, comprising: sgRNA for guiding Cas9 to cut an integration site and a long single strand of 5' homologous arm-hGJB2 c.235delC coding sequence-polyA-3' homologous arm.

[0055] In particular, the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 5.

[0056] Preferably, the nucleotide sequence of the long single strand of 5' homologous arm-hGJB2 c.235delC coding sequence-polyA-3' homologous arm is shown as SEQ ID NO. 2.

[0057] Further, the kit further comprises Cas9 mRNA and / or Cas9 protein.

[0058] The present application provides a method for site-specific integration of full-length exogenous DNA fragments, which designs sgRNA for integration site; selects the sequence on both sides of the integration site as homologous arms, designs the target gene between the homologous arms, and prepares long single-stranded DNA; and realizes efficient site-specific integration of full-length exogenous DNA fragments in multiple embodiments by using the site-specific cleavage principle of Cas9. Based on the foregoing method, the present application further provides a method for knocking in human CD46 and THBD genes downstream of the pig GGTA1 gene promoter to realize a model for expressing human CD46 and THBD in pigs. In the model, humanized CD46 and THBD are integrated upstream of the start codon of the pig GGTA1 gene, and the expression of the GGTA1 gene causing strong rejection in organ transplantation is blocked by polyA, which provides convenience for using the pig model as a donor for organ transplantation in the subsequent; and a promoter is further fused upstream of the exogenous gene to improve the expression amount of the exogenous gene. The present application also provides a preparation method of a humanized GJB2 c.235delC transgenic pig model, which contains a complete coding sequence of the deafness-causing mutation gene with the highest incidence in the Chinese population, and can provide a key animal model for gene editing treatment of such diseases. The present application uses unit point cutting to integrate a single or multiple exogenous genes into the genome, and the integration efficiency is much higher than that of gene site-specific integration based on full-length exogenous DNA double-stranded DNA template or double-site cutting; the integration rate is as high as 90% or more. In order to meet different purposes in the subsequent use, when preparing the long single-stranded DNA by the method of the present application, other suitable sites on the genome can be selected for integration of the exogenous gene; a suitable promoter can also be selected to regulate the expression of the exogenous gene according to the need; and whether to block the expression of the gene downstream of the integration site can also be selected according to the need. The present application provides a new method for site-specific integration of full-length exogenous DNA fragments in the animal genome, which has a good application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0059] Figure 1 , the structure diagram of pig GGTA1 gene. The box represents exon, in which the gray color represents non-coding sequence and the blue color represents coding sequence; the black line represents intron; the thin line arrow represents the transcription direction; and ATG represents the start codon.

[0060] Figure 2 , 2 The expression of mCherry in cells after co-transfecting PK15 cells with two candidate sgRNAs and Cas9 for 24 h.

[0061] Figure 3 , the sequencing results of the target site after co-transfecting PK15 cells with two candidate sgRNAs and Cas9 for 48 h. The black arrow represents the sgRNA sequence; the orange horizontal line represents the PAM sequence; and the red arrow represents the cleavage position.

[0062] Figure 4 Figure 1. Diagram of the template plasmid for knocking in human CD46 and THBD at the start codon of the pig GGTA1 gene while knocking out endogenous GGTA1.

[0063] Figure 5 Figure 2. Diagram of the principle of knocking in human CD46 and THBD at the start codon of the pig GGTA1 gene while knocking out endogenous GGTA1 using long single-stranded DNA as a template. The boxes represent exons, with gray representing non-coding sequences and blue representing coding sequences; black lines represent introns; thin-line arrows represent transcription directions, and scissors represent sgRNA cleavage sites; ATG represents the start codon; and the red cross represents blocking the expression of downstream genes.

[0064] Figure 6 Figure 3. Diagram of the principle of knocking in human CD46 and THBD at the start codon of the pig GGTA1 gene while knocking out endogenous GGTA1 using double-stranded plasmid as a template.

[0065] Figure 7 Figure 4. Gel electrophoresis diagram of the PCR amplification product of the knock-in fragment of the pig GGTA1 gene edited F0 generation obtained using double-stranded plasmid as a template. wt is the negative control; and PC is the template plasmid positive control.

[0066] Figure 8 Figure 5. Gel electrophoresis diagram of the PCR amplification product of the GGTA1 cleavage site of the pig GGTA1 gene edited F0 generation obtained using double-stranded plasmid as a template. wt is the negative control; and PC is the template plasmid positive control.

[0067] Figure 9 Figure 6. Sequencing alignment results of the PCR amplification product of the GGTA1 cleavage site of the pig GGTA1 gene edited F0 generation obtained using double-stranded plasmid as a template. The red box represents the sgRNA sequence; and the orange horizontal line represents the PAM sequence.

[0068] Figure 10 Figure 7. Gel electrophoresis diagram of the PCR amplification product of the knock-in target fragment of the first-litter pig GGTA1 gene edited F0 generation obtained using long single-stranded DNA as a template. wt is the negative control; and PC is the template plasmid positive control.

[0069] Figure 11 Figure 8. Gel electrophoresis diagram of the PCR amplification product of the knock-in target fragment of the second-litter pig GGTA1 gene edited F0 generation obtained using long single-stranded DNA as a template. wt is the negative control; and PC is the template plasmid positive control.

[0070] Figure 12Diagram of the porcine GJB2 gene structure. Boxes represent exons, with gray representing non-coding sequences and blue representing coding sequences. Black lines represent introns. Thin arrows indicate the direction of transcription.

[0071] Figure 13 Design of sgRNA sites upstream of the porcine GJB2 start codon. The red box indicates the candidate sgRNA sites screened in this case, and the yellow shading indicates the start position of the coding sequence.

[0072] Figure 14 、 3 The expression of mCherry in PK15 cells 24 hours after the candidate sgRNAs were co-transfected with Cas9.

[0073] Figure 15 、 3 Target site sequencing results 48 hours after PK15 cells were transfected with Cas9 and the candidate sgRNAs. Black arrows indicate the sgRNA sequences; red arrows indicate the locations where cleavage occurred.

[0074] Figure 16 , full-length plasmid template structure diagram for preparation of hGJB2 c.235delC humanized pig model.

[0075] Figure 17 Schematic diagram of the knockout of endogenous GJB2 using a long single-stranded DNA template to knock in hGJB2 c.235delC upstream of the porcine GJB2 gene start codon. Boxes represent exons, with gray representing non-coding sequences and blue representing coding sequences; black lines represent introns; thin arrows indicate the direction of transcription, and scissors indicate the sgRNA cleavage site; red crosses indicate the blockade of downstream gene expression.

[0076] Figure 18 Gel electrophoresis of the PCR amplification product of the F0 generation target fragment of porcine hGJB2 c.235delC knock-in using long single-stranded DNA as a template. wt is a negative control; PC is a template plasmid positive control. DETAILED DESCRIPTION

[0077] In order to realize the site-specific integration of the full-length exogenous DNA fragment, the applicant considers using the Cas9 and HDR mechanism in combination. The sgRNA is designed for the integration site, the Cas9 protein is guided to play a role, and the target gene located between the homologous arms is integrated into the genome by using the homologous arms. Those skilled in the art can understand that the full-length exogenous DNA fragment in the present application refers to a DNA fragment with a certain complete function and a long sequence. The length of such a fragment is generally greater than 300 bp, so that the existing conventional single-stranded DNA synthesis technology cannot synthesize the single-stranded DNA fragment thereof. The full-length exogenous DNA fragment in the present application refers to a DNA fragment with a certain complete function and a long sequence. The length of such a fragment is generally greater than 300 bp, so that the existing conventional single-stranded DNA synthesis technology cannot synthesize the single-stranded DNA fragment thereof. The DNA fragment with a certain complete function and a long sequence includes but is not limited to a coding sequence encoding at least one protein or polypeptide; the coding sequence can be a complete fragment of genomic DNA or cDNA, or a region of one or more exons; or a DNA fragment with other functions.

[0078] It is found by constructing two model pigs that, by using long single-stranded DNA containing a full-length exogenous DNA fragment sequence and homologous arms on both sides of the integration site as a HDR template, and by using site-specific nuclease to specifically cut at a specific site of the genome, the efficient site-specific integration of the full-length exogenous DNA fragment can be realized by the HDR mechanism. However, the integration cannot be realized by using double-stranded DNA as a template.

[0079] The method of the present application can also realize the integration of at least two exogenous genes, and the multiple exogenous genes can be linked by a self-cleavage peptide. The 5' and 3' ends of the multiple tandem exogenous genes are connected to homologous arms.

[0080] Further, if it is desired to block the expression of the gene downstream of the integration site, at least one polyA sequence can also be fused to the 3' end of the exogenous gene.

[0081] In addition, a promoter can also be fused to the 5' end of the exogenous gene. The promoter that can drive gene expression can be selected according to the needs, such as a promoter that can improve the expression level of the exogenous gene, a spatiotemporal specific promoter that can regulate the expression site or timing of the exogenous gene, an inducible promoter, etc. Of course, the promoter can also not be fused to the 5' end of the exogenous gene, and the exogenous gene can also be directly integrated downstream of the promoter of the genome to realize the expression of the exogenous gene. The method of the present application can realize the site-specific integration of a long exogenous DNA fragment of more than 300 bp, especially the site-specific integration of a long exogenous DNA fragment of more than 500 bp.

[0082] In one embodiment of the present application, an exogenous gene fragment (knock-in fragment length of about 5 kbp) expressing human CD46 and THBD coding sequences is precisely inserted upstream of the start codon of the GGTA1 gene of the pig, the expression of human CD46 and THBD in the pig is achieved, and the expression of the pig GGTA1 gene is blocked by a polyA sequence, thereby obtaining a transgenic pig with human CD46 and THBD genes knocked in downstream of the pig GGTA1 gene promoter. At the same time, a promoter (EF1a promoter) is also fused upstream of the human CD46 and THBD coding sequences to enhance the expression of human CD46 and THBD. Human CD46 (also known as membrane cofactor protein, MCP) is a key regulatory protein of the complement system. Human THBD (Thrombomodulin, thrombomodulin) is a transmembrane receptor protein expressed by endothelial cells, which plays a key role in coagulation, complement regulation and disease diagnosis. The start codon of the coding sequence of the pig GGTA1 gene is located in exon 3, and the encoded protein is an antigen widely expressed on the surface of pig cells, while the human body has natural anti-aGal antibodies, which, when combined, trigger complement activation, leading to hyperacute rejection. By designing sgRNA sites upstream of the start codon to generate double-strand breaks (DSBs), a long single-strand DNA template (lssDNA) containing homologous sequences (HA) of about 1000 bp on both sides of the DSB site is used for precise integration at the target site, achieving humanization expression of CD46 and THBD in pigs, and blocking the expression of endogenous GGTA1 in pigs by the polyA sequence at the 3' end of the lssDNA, thereby knocking out the pig GGTA1 gene. The transgenic pig with human CD46 and THBD genes knocked in downstream of the pig GGTA1 gene promoter obtained in this way not only can highly express human CD46 and THBD, but also can effectively reduce the rejection reaction when used as a donor for organ transplantation. In this embodiment, a double-stranded DNA template was also used for control experiments, and the results showed that using a double-stranded plasmid as a HDR template made it difficult to achieve the knock-in of a large exogenous gene fragment in the pig genome, and using a long single-strand DNA as a template significantly improved the efficiency of large exogenous gene fragment integration (91.7% / 0%).

[0083] In another embodiment, human GJB2 c.235delC coding sequence is inserted upstream of the start codon of the pig GJB2, and the expression of the pig GJB2 gene is blocked by the polyA sequence at the end of the inserted fragment to prepare a humanized GJB2 c.235delC pig model, which also achieved a high efficiency.

[0084] The present application is further specifically described below by way of examples.

[0085] Example 1 Preparation of a transgenic pig with human CD46 and THBD genes knocked in downstream of the pig GGTA1 gene promoter

[0086] 1. Screening of sgRNA sites

[0087] 1) Using online website (https: / / crispor.gi.ucsc.edu / ), two sgRNA sites with high scores were designed and selected for activity verification upstream of the start codon of pig GGTA1: Figure 1

[0088] pGGTA1-KI-sgRNA1: 5-GTCACTCTCCCACATCTCGG-TGG-3 (SEQ ID NO. 3);

[0089] pGGTA1-KI-sgRNA2: 5-TAGATTAAATACACCCAGAG-TGG-3 (SEQ ID NO. 4).

[0090] 2) After synthesis of sgRNA sequence, subclone to U6-sgRNA-mCherry in vitro expression vector through BsaI enzyme cutting site, after sequencing verification, use kit (TIANGEN, DP108) to extract endotoxin-free sgRNA expression plasmid and Cas9 expression plasmid (Addgene #44758).

[0091] 3) Use the method of electroporation (NEPA GENE, NEPA21) to co-transfect PK15 cells (porcine kidney cell line) with sgRNA expression plasmid and Cas9 plasmid at a ratio of 1:2 of mol concentration, and observe the number of cells expressing mCherry under a fluorescence microscope 24h after transfection to determine the transfection efficiency.

[0092] 4) After 48h of transfection, collect cells, extract genomic DNA, amplify sgRNA site sequence, and determine whether the target site is cleaved by Sanger sequencing. Select sgRNA with higher activity for preparation of gene edited pigs. The PCR amplification primers of the target site of PK15 cells after 48h of transfection are as follows:

[0093] pGGTA1-sgR(614bp)-F: AAGGACCAGGGTATATTTTTCTTTGAGGAT;

[0094] pGGTA1-sgR(614bp)-R: AAGCTGGTGACTTGGCTGATAACTAGGA.

[0095] PCR amplification and sequencing of target site Figure 2 ) showed that both sgRNA sites were active Figure 3 ​), pGGTA1-KI-sgRNA1 was selected for the preparation of a genetically edited pig model.

[0096] 3. Preparation of sgRNA

[0097] 1) Synthesize two complementary oligo DNA (oligo DNA) containing sgRNA recognition sequences (Note: After the two complementary single-stranded DNA is annealed into double-stranded DNA, the ends are complementary to the enzyme-digested subcloning site on the sgRNA in vitro transcription plasmid; the sgRNA in vitro transcription plasmid used in this case is pUC57kan-T7-gRNA (Addgene #115520, the enzyme-digested site for subcloning is BsaI);

[0098] 2) Take 1 OD of each synthesized single-stranded oligo DNA, dissolve in deionized water at a concentration of 0.2 μg / μL, and store for later use by aliquoting 20 μL / tube;

[0099] 3) Mix equal volumes of each complementary single-stranded oligo DNA solution and mix thoroughly, then incubate in a water bath containing 1 L tap water at 95°C for 10 min to denature the two complementary single-stranded oligo DNAs into single-stranded state;

[0100] 4) Turn off the water bath power and let it cool naturally to allow the complementary single-stranded oligo DNA to anneal into double-stranded state;

[0101] 5) Use BsaI to fully digest the sgRNA in vitro transcription vector plasmid pUC57Kan-T7-gRNA, and recover the linear plasmid fragment;

[0102] 6) Use T4 DNA ligase to ligate the double-stranded DNA obtained in step 4) with the linear plasmid fragment obtained in step 5) to obtain a recombinant plasmid;

[0103] 7) Transform the competent bacteria with the ligation product of step 6), pick kanamycin-resistant colonies, and amplify the culture to obtain a resistant bacterial solution;

[0104] 8) Extract the recombinant plasmid from the resistant bacterial solution and verify by sequencing;

[0105] 9) Use endonuclease DraI to fully digest the plasmid obtained in step 8) that has been verified by sequencing to achieve complete and full linearization of the recombinant plasmid;

[0106] 10) Obtain DNA precipitate by steps of proteinase K digestion, phenol:chloroform extraction, sodium acetate neutralization, ice ethanol precipitation, ice bath, and frozen centrifugation to purify the linear plasmid DNA and remove RNase contamination;

[0107] 11) Wash the DNA pellet thoroughly with 70% ethanol without RNase, then dissolve the DNA pellet with RNase-free deionized water;

[0108] 12) Take 1 μg purified linear plasmid from step 11) as template, use MEGAshortscript™ T7 Transciption Kit (invitrogen, AM1354) to perform in vitro transcription, obtain sgRNA (see the kit manual for detailed operation steps).

[0109] 13) Use MEGAClear Transcription Clean-Up Kit (invitrogen, AM1908) to purify the in vitro transcription product obtained in step 12), and store it in 5-10 μL / tube according to the concentration size (see the kit manual for detailed operation steps).

[0110] 3. Preparation of Cas9 mRNA

[0111] 1) Preparation of transcription template: use Age I endonuclease to fully (overnight) digest plasmid pST1374-N-NLS-flag-linker-Cas9 (Addgene #44758) to linearize it, and the remaining steps are the same as the preparation of sgRNA in vitro transcription template.

[0112] 2) In vitro transcription: use mMESSAGE mMACHINE T7 Ultra kit to transcribe Cas9 mRNA, and see the kit manual for detailed experimental steps. After transcription, add 1 μL Turbo DNase to the system, and incubate at 37°C for 15 min to remove residual template DNA.

[0113] 3) Tailing: add the following reagents to the T7 Ultra Reaction system in order: T7 Ultra Reaction 20 μL, 5x E-PAP Buffer 20 μL, MnCl2 10 μL, ATP 10 μL, water 36 μL. After mixing, take 2.5 μL mix as a control; add 4 μL E-PAP enzyme, mix, and incubate at 37°C for 45 min.

[0114] 4) Purification of mRNA: The template was adjusted to 100 μL with NFW water; 350 μL of RLT Buffer was added and mixed well; 250 μL of anhydrous ethanol was added and mixed well; the mixture was transferred to the column provided in the kit, centrifuged at ≥ 8000 g for 15 s; the waste liquid in the collection tube was discarded, 500 μL of Buffer RPE was added, centrifuged at ≥ 8000 g for 15 s; the above steps were repeated; the column was transferred to a new 2 mL collection tube and spun for 1 min; the column was placed in a 1.5 mL centrifuge tube, 40 μL of RFW was added, and centrifuged at ≥ 8000 g for 1 min; 2 μL was taken to measure the concentration, and the mRNA solution was divided into RNase-free EP tubes according to the volume of 1-5 μL / tube according to the concentration, and the divided mRNA solution was stored in a -80°C refrigerator; 1 tube of mRNA was electrophoresed, and the mRNA before tailing was used as a control to detect the quality and tailing effect of the mRNA (the band position of the mRNA after tailing should be slightly delayed compared to the mRNA before tailing). Before use, dilute the Cas9 mRNA to 20 ng / μL.

[0115] 4. Preparation of long single-stranded DNA

[0116] 1) First, artificially synthesize a full-length double-stranded DNA fragment consisting of the following parts: EF1α promoter-human CD46 CDs sequence-Fp2A-human THBD CDs sequence-SV40 pA-BGH pA (the double-stranded plasmid template sequence is the same as the long single-stranded DNA template sequence, and the nucleotide sequence is shown in SEQ ID NO. 1, positions 1051-5792). According to the high-activity sgRNA targeted cleavage site selected, insert a homologous arm sequence (HA) of about 1000 bp at each end of the fragment, and then insert a T7 promoter at the end of the 5' or 3' homologous arm to obtain a complete 5HA-EF1α-hCD46-Fp2A-hTHBD-SV40 pA-BGH pA-3HA-T7 as shown in SEQ ID NO. 1. Connect it to the backbone plasmid pCI (Invitrogen) to obtain the vector pCI-5HA-EF1α-hCD46-Fp2A-hTHBD-SV40 pA-BGH pA-3HA-T7, and the structure is shown in Figure 4 At the same time, use the double-stranded of the vector as a template to transcribe mRNA in vitro, and then reverse transcribe to obtain a long single-stranded template.

[0117] SEQ ID NO. 1 is ECFT-KI-lssDNA; 5HA at 1-1032, EF1a promoter at 1051-2232, hCD46 coding sequence at 2258-3433, Fp2A sequence at 3434-3511, hTHBD coding sequence at 3512-5239, SV40 polyA sequence at 5245-5567, BGHpA sequence at 5568-5792, 3HA at 5817-6905;

[0118] caatgaggcttggatcccgcgttgctgtggctctggtgtaggccggtggctacagctccgattcgacccctagcctgggaacctccatatgccgcgggagcggccct

[0119] aaaaagacaaaagaccaaaaaaaaaaaaaaacaaaaaacccacaaaatgttgggaatcagtcctctactagtattatgttattgtcaagttttccttttatgtctgttaatatt

[0120] tgcgttctagatgtaggtgctctgatatcgtgtgcatatatgttaaccaatgttatgtcttcctctggtattgatccctttgttattatgtaatgccctactttatcttttgttacattct

[0121] ttgtttatgagtattgctgatatgtggctagctgccacacttttcttgtcctttccatttacaataaatatctttctatctccacccaaattaaagtactccgcaacctgttattcca

[0122] cccagcatcccttccctcttcaactacaatttcatgcagcgatcaagaaatacgaatgtaccgactgtttgccacttgtgtgggtgcattggggaaaagctgggtgggaa

[0123] gtggcagagcctagattataaaggaccagggtgagagttcccattgtggctcagctgaaatgaatctgactagcatccatgaggacgaaggtttgatccctggcctca

[0124] atcagtgggttaaggatctggcgttgctgtccgtgagttgtggtgtagttcgcagacaaggcgtggacttagtgtggctgtggctgtggcataggctagtggctacagct

[0125] ctgattcgacccctagcctgggaatctctatatgctgtgagtgtggccctaaaatttaaatgaaattaaataaaggaccagggtatatttttctttgaggataaggtacatag

[0126] tcagtatatcagggacagtagacctaggaaacggatgcttcctctagtctgtgatgcgaggtggggcatctgagttgggggcggctggagcccttagggaccattaac

[0127] taaacccgtcactctcccacatcgaattcggtacctctagagctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggg

[0128] gtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatat

[0129] aagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggc

[0130] CCTTGCgtgccttgaattacttccacgcccctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggag

[0131] CCCCTTCGCCTCgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagc

[0132] CATTtaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcg

[0133] ACGGGGCCCgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctct

[0134] GGTgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctg

[0135] CTGCAGGGAGCTCAAaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgt

[0136] GACTCCACGGAGTACCggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttcccc

[0137] acactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtg

[0138] gttcaaagtttttttcttccatttcaggtgtcgtgagtggtaccacgcgtcgaccgccaccatggagcctcccggccgccgcgagtgtccctttccttcctggcgctttcct

[0139] gggttgcttctggcggccatggtgttgctgctgtactccttctccgatgcctgtgaggagccaccaacatttgaagctatggagctcattggtaaaccaaaaccctactat

[0140] gagattggtgaacgagtagattataagtgtaaaaaaggatacttctatatacctcctcttgccacccatactatttgtgatcggaatcatacatggctacctgtctcagatga

[0141] cgcctgttatagagaaacatgtccatatatacgggatcctttaaatggccaagcagtccctgcaaatgggacttacgagtttggttatcagatgcactttatttgtaatgag

[0142] ggttattacttaattggtgaagaaattctatattgtgaacttaaaggatcagtagcaatttggagcggtaagcccccaatatgtgaaaaggttttgtgtacaccacctccaaa

[0143] aataaaaaatggaaaacacacctttagtgaagtagaagtatttgagtatcttgatgcagtaacttatagttgtgatcctgcacctggaccagatccattttcacttattggag

[0144] agagcacgatttattgtggtgacaattcagtgtggagtcgtgctgctccagagtgtaaagtggtcaaatgtcgatttccagtagtcgaaaatggaaaacagatatcagga

[0145] tttggaaaaaaattttactacaaagcaacagttatgtttgaatgcgataagggtttttacctcgatggcagcgacacaattgtctgtgacagtaacagtacttgggatcccc

[0146] cagttccaaagtgtcttaaagtgctgcctccatctagtacaaaacctccagctttgagtcattcagtgtcgacttcttccactacaaaatctccagcgtccagtgcctcagg

[0147] tcctaggcctacttacaagcctccagtctcaaattatccaggatatcctaaacctgaggaaggaatacttgacagtttggatgtttgggtcattgctgtgattgttattgccat

[0148] agttgttggagttgcagtaatttgtgttgtcccgtacagatatcttcaaaggaggaagaagaaaggcacatacctaactgatgagacccacagagaagtaaaatttactt

[0149] ctctccgccgcaagcgcggaagcggagccacgaacttctctctgttaaagcaagcaggagatgttgaagaaaaccccgggcctatgcttggggtcctggtccttggc

[0150] gcgctggccctggccggcctggggttccccgcacccgcagagccgcagccgggtggcagccagtgcgtcgagcacgactgcttcgcgctctacccgggccccg

[0151] CGACCTTCCC TCAATGCCAG TCAGATCTGC GACGGACTGC GGGGCCACCT AATGACAGT GCCTCCTCGG TGGCTGCCGA TGTCAITTCCTTGCTACTGAACGGCGACG

[0152] GCGGCGTTGGCCGCCGGCGCCTCTGGATCGGCCTGCAGCTGCCACCCGGCTGC GGCACCCC AAGCGCCTCGGGCCCCTGC GCGGCTTCCAGTGGGTTACGGGA

[0153] GACAACAACACCAGCTATAGCAGGTGGGCACGGCTCGACCTCAATGGGGCTCCCCTCTGC GGCCCCTGTGTGCCTGTCTCCGCTGCTGAGGCCACTGTGCCCA

[0154] GCGAGCCGATCTGGGAGGAGCAGCAGTGC GAAGTGAAGGCCGATGGCTTCCTCTGCGAGTTCCACTTCCCAGCCACCTGCAGGC CACTGGCTGTGGAGCCC GGC

[0155] CCCGC GCTGCCGCCGTCTCGATCACCTACGGCACCCC GTTCGC GGC CCGCGGAGCGGACTTCCAGGC GCTGCCGGTGGGCAGCTCCGCCGC GGTGGCTCCCCTC

[0156] GGCTTACAGCTAATGTGCACC GC CCGCCC GGA GCGGTCCAG GGGC ACTGGGCCAGGGAGGC GCCGGGC GCTTGGGACTGCAGCGTGGAGAACGGCGGCTGC

[0157] GAGCACGC GTGCAATGC GATCCCTGGGGCTCCCCGCTGCCAGTGCCCAGCCGGCGCCGC CCTGCAGGCAGACGGGC GCTCCTGC ACCGC ATCCGCGACGC AGT

[0158] CCTGCAACGACCTCTGCGAGC ACTTCTGC GTTCCCAACCCCGACCAGCCGGCTCCTACTCGTG CATGTGCGAGACCGGCTACC GGCTGGCGGCCGACCAACACC

[0159] GGTGC GAGGACGTGGATGACTGC AT ACTGGAGCCCAGTCCGTGTCCGCAGCGCTGTGTCAACACACAGGTTGCTTCGAGTGCCACTGCTACCTTAAC TACGACCT

[0160] GGTGGACGGCGAGTGTGTGGAGCCC GTGGACCCGTGCTTCAGAGCCA ACTGC GAGTACCAGTGCCAGCCCCTGAACCAAAC T AGCTACCTCTGC GTCTGC GCCGA

[0161] GGGCTTCGCGCCCATTCCCCACGAGCCGCACAGGTGCCAGATGTTTTGCAACCAGACTGCCTGTCCAGCCGACTGC GACCCCAACACCCAGGCTAGCTGTGAGTGC

[0162] CCTGAAGGCTACATCCTGGACGACGGTTT CATCTGCACGGACATCGACGAGTGC GAAAACGGCGGCTTCTGCTCCGGG GTGTGCCACAACCTCCCCG GTACCTTCGA

[0163] GTG CATCTGCGGGCCCGACTCGGCCCTTGCCCGCCACATTGGCACC GACTGTGACTCCGGCAAGGTGGACGGTGGCGACAGCGGCTCTGGCGAGCCCCCGCCCA

[0164] GCCC GACGCCC GGCTCCACCTTGACTCCTCCGGCCGTGGGGCTCGTGCATTCGGCTTGCTCATAGG CATCTCCATCGCGAGCCTGTGCCTGGTG GTGGCGCTTTTGG

[0165] Cgctcctctg ccacctgcgc aagaagcagg gcgccgccag ggccaagatg gagtacaagt gcgcggccct tccaaggagg tagtgctgca gcacgtgcgg ac

[0166] Cgagcggacg ccgcagagac tctgaactag tcgcgatgaa taataaaact tgcagatctg cgactctaga ggatctgcga ctctagagga tcataatcag ccata

[0167] Ccacattttg tagaggtttt acttgcttta aaaaaacctc ccacacctcc ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt taacttgttt attgcagctt ataatgg

[0168] Ttacaaataa agcaatagca tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat gtctggatcc catca

[0169] Agctgatccg gaacctgtgc cttctagttg ccagccatct gttgtttgcc cctccccgtg ccttccttga ccctggaagg tgccactccc actgtccttt cctaataaaa t

[0170] Gaggaaattg catcgcattg tctgagtagg tgtcattcta ttctgggggg tgggtggggc aggacagcaa gggggaggat tgggaagaca atagcaggca tgctg

[0171] Gggatgcggt gggctctatg gacgcgttgt acacgtcgtt taaaccggtg gaccttggga tcagtcagga tgcttcccct ttgagcctca aaatggcctt agtatccttc

[0172] ccaacccagacggccctgtcagttcattgacttggctaatttgccagtgtaggcctatgcaaattaaggtagaacgcactccttagcgctcgttgactattcatcaactttt

[0173] ccttttagaaaagatattggtataagcacttcttaaaaaaccatattccactctgggtgtatttaatctaattttcccttctccttttcttttcccaggagaaaataatgaatgtcaa

[0174] aggaagagtggttctgtcaatgctgcttgtctcaactgtaatggttgtgttttgggaatacatcaacaggtaattatgaaacatgatgaaatgatgttgatgaaagtctcctct

[0175] aatctcctagttatcagccaagtcaccagcttgcattaaaagtaggattcactgacaccgtaaagaaagcattccagagagttgccgttgtggctcaggggcagcaaac

[0176] ccaattaggatccaagaggaggtgggtttgatccctggccttgctctttggcttaaggatccggcattgccgtgacctgtggtgtaggttgcagatgcagttcggatctg

[0177] gcattgctgtggctgtggcgtaggctggtggcttcagctccagtttgacccctagcctgggaacttccatatcccacacttgcggccctaaaaagcaaagaaagaaag

[0178] aaaatattctacccttcctgtatccctgagcccttaaataccgtctttaaagtcattagatcttcaagtaccttccagctaattaattatcttccttcctgccatgttgccattgtc

[0179] ctgatttttatacctctgcagttctgggtaggctagagccagaaataataaggtcatgttaagaccaagatataatattaaattatttatatgaccagatatggaagttacctt

[0180] gagaactttcagacaggaattccatgagaaatacaccctgatttttgcaatcctaaaatatttgcagagtttaaaggaacaactcaagttgttgacttttgctgcaaaacacactgagtcgc.

[0181] 2) Select a restriction enzyme site downstream of the long single-stranded DNA template sequence to fully linearize the plasmid (note: the selected restriction enzyme site cannot cut the long single-stranded DNA template sequence or the T7 promoter sequence);

[0182] 3) Purification of linear plasmid DNA and removal of RNase contamination by proteinase K digestion, phenol:chloroform extraction, sodium acetate neutralization, ice-ethanol precipitation, ice bath, and refrigerated centrifugation to precipitate linear DNA fragments;

[0183] 4) Wash the DNA pellet thoroughly with RNase-free 70% ethanol, and then dissolve the DNA pellet with RNase-free deionized water;

[0184] 5) Take 1 μg of linear template plasmid DNA and perform in vitro transcription using the MEGAshortscript™ T7 Transciption Kit (Invitrogen, AM1354) to obtain complementary RNA of the long single-stranded template (see the kit instructions for detailed experimental steps);

[0185] 6) Take 1 μg of complementary RNA of the long single-stranded template and synthesize complementary DNA by reverse transcription using a primer complementary to the 3' end sequence of the complementary RNA and the complementary RNA as a reverse transcription template using the reverse transcription kit PrimeScript™ II 1st Strand cDNA Synthesis Kit (TAKARA, 6210A) to obtain an RNA-DNA hybrid double-stranded product (see the kit instructions for details);

[0186] 7) adding RNAase H to the reaction product of step 6) to specifically digest the RNA in the RNA-DNA hybrid double strand to obtain a long single-stranded DNA;

[0187] 8) Recover long single-strand DNA with QIAquick PCR Purification Kit, elute long single-strand DNA with RNase-free deionized water, measure concentration, and then aliquot and store for later use.

[0188] 4) Acquisition of porcine early embryos, microinjection of CRISPR preparation, and transplantation

[0189] 1) Acquisition of porcine early embryos

[0190] (1) Select 3-5 healthy mature female pigs in estrus, mate them with healthy mature male pigs to serve as embryo donor pigs, and prepare another healthy mature female pig in estrus as a recipient pig;

[0191] (2) 24-36 hours after mating of the donor pig, use isoflurane to achieve general anesthesia of the donor pig through a respirator, and bind the pig to a V-shaped operating table;

[0192] (3) After routine cleaning and disinfection of the pig's abdomen, make an incision of 5-8 cm in size along the midline of the abdomen between the last two pairs of teats;

[0193] (4) Take out the pig's ovary, oviduct, and part of the uterus, at which time the ovulation point on the surface of the pig's ovary can be seen, indicating that the pig has ovulated;

[0194] (5) Insert a glass catheter with a diameter of 4-6 mm and blunted ends into the oviduct through the oviductal umbrella;

[0195] (6) Use a syringe to extract about 20 mL of flushing medium (PBS + 1% fetal bovine serum) that has been incubated at 38°C in a water bath, connect the syringe containing the flushing medium to the oviduct lumen through an intravenous infusion needle (with one end inserted into the oviduct lumen through the junction of the oviduct and uterus, and the other end connected to the syringe);

[0196] (7) Inject the flushing medium into the oviduct through the syringe, and collect the flushing medium flowing through the oviduct and out of the glass catheter inserted into the oviductal umbrella in a sterile 50 mL centrifuge tube;

[0197] (8) Transfer the collected flushing medium into a sterile culture dish with a diameter of 9 cm, and pick up the embryos under a stereomicroscope, at which time the embryos picked up are generally at the 1-cell or 2-cell stage;

[0198] (9) Place the picked-up porcine embryos in a droplet of culture medium that has been incubated and balanced in a culture incubator, and then incubate the embryos in paraffin oil on top (the porcine embryo culture medium used in this case is PZM-3, the formula of which is described in the literature Biology of Reproduction, 2002, 66:112);

[0199] 2) Microinjection of pig early embryos:

[0200] The mixture solution of sgRNA, Cas9 mRNA and DNA template was injected into the cytoplasm of pig early embryos by using a microinjector. For details, see Hogan et al. Manipulating Mouse Embryo Manipulation Manual, Cold Spring Harbor Laboratory Press, 1994, Second Edition.

[0201] The injected substances were divided into experimental and control groups. The traditional method for achieving precise knock-in of large fragments of exogenous genes at target sites in pigs is to use a double-stranded plasmid as a template to achieve homologous sequence-mediated repair, but the efficiency is very low. In this experiment, the same sgRNA was used to cut the pig GGTA1 target site, and a double-stranded plasmid (pCI-5HA-EF1a-hCD46-Fp2A-hTHBD-SV40pA-BGHpA-3HA-T7) was used as a template to achieve the purpose of fragment knock-in. The scheme for the control experiment group was as follows: when injecting embryos, the long single-stranded DNA template was replaced with purified double-stranded plasmid during embryo microinjection. The control group was injected with Cas9 mRNA (20 ng / μL) / double-stranded plasmid template (10 ng / μL) / pGGTA1-KI-sgRNA1 (10 ng / μL). The experimental group was injected with Cas9 mRNA (20 ng / μL) / ECFT-KI-lssDNA (10 ng / μL) / pGGTA1-KI-sgRNA1 (10 ng / μL).

[0202] 3) Pig embryo transfer

[0203] (1) Anesthetize and restrain the recipient sow in the same way as the embryo is obtained, make an incision in the abdominal cavity, remove the ovary, oviduct and part of the uterus;

[0204] (2) Connect the embryo retrieval pipette (USA, Agtech Company) with a 1 mL syringe, and pre-absorb a section of air in the embryo retrieval pipette;

[0205] (3) Under a stereomicroscope, use the connected syringe to absorb 20-30 injected embryos in the culture solution into the embryo retrieval pipette (note: a section of air is absorbed before the liquid section where the embryos are located, and another section of liquid is absorbed before the air to prevent contamination);

[0206] (4) Insert the embryo retrieval pipette containing the embryos into the oviduct of the recipient sow through the umbrella portion, and push the syringe to guide the embryos into the oviduct;

[0207] (5) Put the uterus, oviduct and ovary of the recipient pig back into the abdomen, and successively suture the peritoneum, muscle, fascia and skin, and perform routine disinfection treatment on the wound; the pregnant recipient sow can give birth to piglets after the gestation period is over.

[0208] By comparing the gene editing efficiency of the offspring, the effectiveness of the long single-stranded DNA template in realizing the precise integration of large exogenous gene fragments in pigs through unit point cutting was verified, and the integration principle is shown in Figure 5 and Figure 6 .

[0209] A total of 77 embryos were injected in the control group, which were transplanted into 4 recipient sows (in which the number of embryos transplanted was 19, 16, 15 and 27, respectively), and 2 of the recipient sows gave birth to 2 litters of 7 F0 generation founder pigs after pregnancy. Ear tissue was taken to extract genomic DNA, and 2 pairs of specific PCR primers were designed for amplifying the genomic DNA (using wt and template plasmid as controls) (see Table 1 for primers), and the gel electrophoresis results of the PCR products showed that the 7 offspring had no specific bands as expected ( Figure 7 ), indicating that the double-stranded plasmid template failed to achieve the knock-in of the target gene fragment into the F0 generation genome. Further amplification of the genomic DNA of the 7 offspring using PCR primers at both ends of the target cutting site of the pig GGTA1 showed that all individuals had bands as expected ( Figure 8 ), and sequencing analysis of the PCR products showed that the GGTA1 target site was cleaved in 6 of the 7 offspring ( Figure 9 ), confirming the high activity of the sgRNA site in the embryos. This also shows that the sgRNA can guide the cleavage of the target site upstream of the start codon of GGTA1, but the double-stranded plasmid cannot be integrated into the cleavage site.

[0210] Table 1 PCR primers for genetic identification of pig GGTA1 gene editing F0 generation using double-stranded plasmid as template

[0211] Primer name Sequence CD46-THBD-F( Figure 7 mid F1) CAGTGCCTCAGGTCCTAGGCCTACTTACAA CD46-THBD-R Figure 7 R1) TGTCTCCCGTAACCCACTGGAAGCC THBD-F Figure 7 mid F2) ATGCTTGGGGTCCTGGTCCTT THBD-R Figure 7 R2) ATTAGCTGTAAGCCGAGGGGAGCC

[0212] The experimental group transplanted 59 microinjected embryos into 4 recipient sows (the number of embryos transplanted was 11, 16, 15 and 17 respectively), of which 2 pregnant donors gave birth to 2 litters of 12 F0 generation first-generation pigs. The genomic DNA was extracted from the ear tissue, and the genome of the 6 F0 generations in the first litter was amplified using the two pairs of primers in Table 2. These two pairs of primers were only used to preliminarily screen whether the target fragment might have been knocked into the F0 generation genome. If the expected band could be amplified, the integrity and position of the fragment insertion would be further identified. The gel electrophoresis results showed that there was a band of the expected size, and the Sanger sequencing results of the PCR product were completely consistent with the template sequence. Multiple pairs of primers were designed for the entire knock-in template sequence to amplify the target sequence and identify the F0 generation genotype. The gel electrophoresis results of the PCR product showed that 11 of the 12 F0 generations had specific bands that met the expectations, and the sequencing results of the PCR product were consistent with the template sequence ( Figure 10 , Figure 11 ).

[0213] The experimental results of this experiment showed that, based on the same cleavage site, the site-specific integration of the full-length exogenous DNA fragment could not be achieved using the double-stranded plasmid as the HDR template, while the site-specific integration of the full-length exogenous DNA fragment could be efficiently achieved using the long single-stranded DNA as the template (the integration rate could be as high as 91.7%) (Table 3).

[0214] Table 2 PCR primers for genetic identification of the F0 generation of porcine GGTA1 gene editing obtained using long single-stranded DNA as template

[0215] Primer name Sequence F1 GGGAATCAGTCCTCTACTAGTATTATGTTATTGTC R1 CAGTACACGACATCACTTTCCCAGTTTA F2 AAGGTACATAGTCAGTATATCAGGGACAGTAGACC R2 GGCTAGAGACTTATCGAAAGCAGCG F3 CTCGTGCTTGAGTTGAGGCCTG R3 ACCATGGCCGCCAGAAGCAA F4 AGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTG R4 AGAGAGAAGTTCGTGGCTCCGCTT F5 CTTCAAAGGAGGAAGAAGAAAGGCACA R5 TCCAGTATGCAGTCATCCACGTCCT F6 CTGCAACGACCTCTGCGAGCACTT R6 TTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGT F7 CCCTTCCAAGGAGGTAGTGCTGCA R7 GGGTTGGGAAGGATACTAAGGCCA F8 GACAGCAAGGGGGAGGATTGGGAA R8 GGAATCTCCAAGGCGTCGTAGTTTC

[0216] Table 3 Comparison of gene editing efficiency between the experimental group and the control group

[0217] Group Number of F0 generation Number of KI individuals KI efficiency Control group (double-stranded plasmid template) 7 0 0％ Experimental group (long single-stranded DNA template) 12 11 91.7％

[0218] Example 2 Preparation of humanized GJB2 c.235delC transgenic pig model

[0219] In this example, the human GJB2c.235delC coding sequence was inserted upstream of the porcine GJB2 start codon using a long single-stranded DNA template through sgRNA single-site cutting. The polyA sequence at the end of the inserted fragment was used to block the expression of the porcine GJB2 gene to prepare a humanized GJB2c.235delC pig model.

[0220] Using the online website, the porcine GJB2 start codon upstream ( Figure 12 ) designed and selected three sgRNA sites for activity verification ( Figure 13 ). The sgRNA in vitro transcription vector was constructed according to the description of Example 1, and the target site was PCR amplified and sequenced after co-transfection with the Cas9 expression vector into PK15 cells (Figure 14 ), the results showed that pGJB2-235delc-sgRNA3 had the most obvious overlapping peak at the target cleavage site ( Figure 15 ), and this site was selected for the preparation of a gene-edited pig model.

[0221] Candidate sgRNA targeting pGJB2 target site:

[0222] pGJB2-235delc-sgRNA1: TTGCAGCGCAGACCGTCCGG-AGG;

[0223] pGJB2-235delc-sgRNA2: AGACCGTCCGGAGGAGAAGA-TGG;

[0224] pGJB2-235delc-sgRNA3: AGTCCATCTTCTCCTCCGGA-CGG (SEQ ID NO. 5).

[0225] The target site was amplified by PCR in PK15 cells 48 h after transfection using the following primers: pGJB2-5fs-F: GAGTCATCGAGCACGTTTGGCC and pGJB2-5fs-R: TTGCAGACGAAGTCGGCCTG.

[0226] The long single-stranded DNA template and double-stranded DNA template were prepared according to Example 1. First, a full-length double-stranded DNA fragment was artificially synthesized: hGJB2c.235delC coding sequence-SV40pA-BGHpA-BGHpA (the double-stranded plasmid template sequence was the same as the long single-stranded DNA template sequence, and the nucleotide sequence was the same as the long single-stranded DNA template sequence).

[0227] (as shown in SEQ ID NO.2, 1105-2580), according to the selected high-activity sgRNA targeting cleavage site, a homology arm sequence (HA) of about 1000 bp was inserted at each end of this fragment, and then a T7 promoter was inserted at the 5' end or the 3' end of the homology arm to obtain the complete 5HA-hGJB2 c.235delC coding sequence-SV40pA-BGHpA-BGHpA-3HA as shown in SEQ ID NO.2, which was ligated to the backbone pCI to obtain the vector pCI-5HA-hGJB2 c.235delC coding sequence-SV40pA-BGHpA-BGHpA-3HA, with a structure as shown Figure 16 At the same time, the double-stranded portion of the vector is used as a template to be transcribed into mRNA in vitro, and then reverse transcribed to obtain a long single-stranded template.

[0228]

[0229] With the long single-stranded DNA template above, by unit point cutting, the cell is expected to achieve hGJB2 c.235delC knock-in at the target site of the pig GJB2 gene through homologous sequence-mediated DNA repair (HDR), while blocking the expression of the endogenous GJB2 gene of the pig. Figure 17

[0230] Meanwhile, refer to Example 1 for Cas9 mRNA preparation, acquisition of pig early embryos, microinjection of CRISPR preparation, and transplantation.

[0231] The Cas9 mRNA (20 ng / μL) / hGJB2 c.235delC long single-stranded template (10 ng / μL) / pGJB2-235KI-sgRNA3 (10 ng / μL) mixture was injected. A total of 39 embryos were injected and transplanted into 2 recipient sows (19 and 20), and 2 litters of 12 F0 generation founder pigs were born after the 2 recipients were pregnant. Ear tissue was taken to extract genomic DNA, and 3 pairs of specific PCR primers (Table 4) were designed for the sequence of the knock-in target fragment to amplify the genomic DNA (wt and template plasmid were used as controls for amplification). The gel electrophoresis results of the PCR products showed that 5 offspring had specific bands as expected ( Figure 18 ), and the Sanger sequencing of the PCR products was consistent with the sequence of the knock-in template, indicating that 5 of the 12 F0 generation individuals achieved precise knock-in of the hGJB2 c.235delC coding sequence, with a knock-in efficiency of 42%, further proving that sgRNA unit point cutting can achieve precise knock-in of large exogenous genes and efficiently obtain a gene-edited pig model.

[0232] Table 4 Primers for genetic identification of F0 generation hGJB2 c.235delC knock-in pigs using long single-stranded DNA as a template

[0233] Primer name Sequence F1 CACGTCCCAGCGCTTCCAAGAT R1 TGATGAGTTTGGACAAACCACAACTAGA F2 GGAAGAGGTTTCACGCTGCCTG R2 TCGCAGATCCTCTAGAGTCGCAGAT F3 GCAGTGTCTGGAATTTGCATCCTG R3 GACACCACGACCATGAAAACCGTA

[0234] As can be seen from the two examples, using long single-stranded DNA as a template and unit point cutting by sgRNA can achieve efficient precise editing of large animal (pig) genomes based on HDR; through this method, the expected precise insertion is achieved in this case; while using conventional double-stranded plasmid as a template and unit point cutting, no gene editing event occurs at the same gene site, proving the effectiveness and feasibility of the technology used in this invention; at the same time, it provides a new solution for the case where there is no high-activity sgRNA site near the gene target site.​

Claims

1. A method for achieving site-specific integration of full-length exogenous DNA fragments using long single-stranded DNA, characterized in that: The method comprises the following steps: transforming a mixture of a full-length exogenous DNA fragment, a long single-stranded strand, sgRNA guiding Cas9 to cut an integration site, Cas9 mRNA and / or Cas9 protein into a recipient cell; the full-length exogenous DNA fragment includes a 5' homology arm and a 3' homology arm upstream and downstream of the sgRNA-guided cutting site, and a coding sequence of at least one polypeptide or protein located between the 5' homology arm and the 3' homology arm.

2. The method of claim 1, wherein: Includes at least one of the following features: 1) A promoter is provided upstream of the coding sequence of the polypeptide or protein; 2) In order to achieve independent expression of the long single-stranded full-length exogenous DNA fragment, at least one polyA is placed downstream of the coding sequence of the polypeptide or protein; 3) The length of the 5' homology arm and the 3' homology arm is 500 to 1000 bp; 4) The final concentrations of the mixture of the full-length exogenous DNA fragment, the sgRNA that guides Cas9 to cut the integration site, and the Cas9 mRNA are 10-20 ng / μL, 5-20 ng / μL, and 10-20 ng / μL, respectively; 5) The recipient cells are porcine early embryonic cells.

3. The method of claim 2, wherein: The structure of the long single-stranded full-length exogenous DNA fragment is: 5' homology arm-promoter-at least one polypeptide or protein coding sequence-polyA-3' homology arm; Alternatively, two or more polypeptide or protein coding sequences are linked via a self-cleaving peptide.

4. The method of claim 3, wherein: Includes at least one of the following features: 1) The promoter is the EF1α promoter; 2) the self-cleaving peptide is Fp2A, P2A, T2A or E2A; 3) The final concentrations of the mixture of the full-length exogenous DNA fragment, the sgRNA that guides Cas9 to cut the integration site, and the Cas9 mRNA are 10 ng / μL, 10 ng / μL, and 20 ng / μL, respectively; 4) Early pig embryos are embryos at the 4-cell stage and earlier.

5. A method for the production of a transgenic pig having human CD46 and THBD genes knocked in downstream of the pig GGTA 1 gene promoter, characterized in that: The steps include: S1. Determine the integration sites of the CD46 and THBD genes, design sgRNAs that guide Cas9 to cleave the integration sites, and prepare sgRNAs. S2, preparing Cas9 mRNA or Cas9 protein; S3. Prepare a long single strand of 5' homology arm-promoter-CD46-THBD-polyA-3' homology arm; the homology arm is the sequence on both sides of the integration site; S4, introducing a mixture of sgRNA, long single-stranded RNA, Cas9 mRNA and / or Cas9 protein into early porcine embryonic cells; S5, transplanting the pig early embryo processed in step S4 into the oviduct of a recipient sow to make the recipient sow pregnant; S6. The pregnant recipient sow gave birth to piglets after the gestation period was complete, and transgenic pigs were obtained in which human CD46 and THBD genes were knocked into the downstream of the pig GGTA 1 gene promoter.

6. A method of preparing a humanized GJB2 c.235delC transgenic pig model, characterized by: The steps include: S1. Determine the integration site of GJB2 c.235delC, design sgRNA to guide Cas9 to cleave the integration site, and prepare sgRNA; S2, preparing Cas9 mRNA or Cas9 protein; S3, preparing a long single strand of 5' homologous arm-hGJB2 c.235delC coding sequence-polyA-3' homologous arm; the homologous arms are sequences on both sides of the integration site; S4, introducing a mixture of sgRNA, long single strand, Cas9 mRNA and / or Cas9 protein into pig early embryo cells; S5, transplanting the pig early embryo treated in step S4 into the oviduct of a recipient sow to make the recipient sow pregnant; S6, the pregnant recipient sow gives birth to piglets after the gestation period, and a humanized GJB2 c.235delC transgenic pig model is obtained.

7. The method of claim 5, wherein: At least one of the following features is included: 1) In step S1, the integration site is upstream of the start codon of the pig GGTA1 gene; 2) In step S1, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 3 or SEQ ID NO. 4; 3) In step S3, CD46 and THBD are connected by a self-cleaving peptide.

8. The method of claim 7, wherein: The self-cleaving peptide is Fp2A, P2A, T2A or E2A; or, in step S3, the promoter is an EF1α promoter.

9. The method of claim 8, wherein: The nucleotide sequence of the long single strand of 5' homologous arm-promoter-CD46-THBD-polyA-3' homologous arm is shown in SEQ ID NO.

1.

10. The method of claim 6, wherein: The nucleotide sequence of the sgRNA in step S1 is shown in SEQ ID NO. 5; or, the nucleotide sequence of the 5' homologous arm-hGJB2 c.235delC coding sequence-polyA-3' homologous arm in step S3 is shown in SEQ ID NO. 2; or, the integration site in step S1 is upstream of the start codon of the GJB2 gene.

11. The method of claim 5 or 6, wherein: At least one of the following features is included: 1) In step S3, the length of the 5' homologous arm and the 3' homologous arm is 500-1000 bp; 2) The polyA is at least 1 and is selected from SV40pA or / and BGHpA; 3) In step S4, the final concentration of each of the long single strand, sgRNA for guiding Cas9 to cut the integration site, and Cas9 mRNA in the mixture is 10-20 ng / μL, 5-20 ng / μL, and 10-20 ng / μL; 4) In step S4, the pig early embryo cells are embryo cells at the 4-cell stage or before.

12. The method of claim 11, wherein: The final concentration of each of the long single strand, sgRNA for guiding Cas9 to cut the integration site, and Cas9 mRNA in the mixture is 10 ng / μL, 10 ng / μL, and 20 ng / μL.

13. A kit for making a transgenic pig model, characterized by: It is the following kit A or kit B; The kit A is a kit for preparing a transgenic pig with human CD46 and THBD genes knocked in downstream of the pig GGTA1 gene promoter, comprising: sgRNA for guiding Cas9 to cut the integration site and a long single strand of 5' homologous arm-promoter-CD46-THBD-polyA-3' homologous arm; The kit B is a kit for preparing a humanized GJB2 c.235delC transgenic pig model, comprising: a long single strand of sgRNA and 5' homologous arm-hGJB2 c.235delC coding sequence-polyA-3' homologous arm guiding Cas9 to cut the integration site.

14. The kit of claim 13, wherein: At least one of the following characteristics: 1) In the kit A, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 3 or SEQ ID NO. 4; 2) In the kit A, the nucleotide sequence of the long single strand of 5' homologous arm-promoter-CD46-THBD-polyA-3' homologous arm is shown in SEQ ID NO. 1; 3) In the kit A, the kit further comprises Cas9 mRNA and / or Cas9 protein; 4) In the kit B, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 5; 5) In the kit B, the nucleotide sequence of the long single strand of 5' homologous arm-hGJB2 c.235delC coding sequence-polyA-3' homologous arm is shown in SEQ ID NO. 2; 6) In the kit B, the kit further comprises Cas9 mRNA and / or Cas9 protein.

Images