Application of Nrf2 coding gene in regulation and control of lung adenocarcinoma EMT and metastasis

Abstract

The invention provides an application of an Nrf2 coding gene in regulation and control of lung adenocarcinoma EMT and metastasis, relates to the technical field of biomedicine, and is technically characterized by providing an application of Nrf2 as a target in preparation of drugs for regulation and control of lung adenocarcinoma EMT and metastasis. Specific verification experiments prove that the occurrence of EMT can be promoted after Nrf2 is knocked down, the Nrf2 gene in an HCC827 cell strain is over-expressed in a lentivirus transshipment mode, it is proved that the occurrence of EMT can be inhibited by over-expression of Nrf2, and in order to research the mechanism of the Nrf2 gene, the Nrf2 gene in an A549 cell is knocked down, and the Nrf2 gene in the HCC827 cell strain is knocked down, so that the Nrf2 gene in the HCC827 cell strain is knocked down; the invention proves that the Nrf2 gene overexpression enhances cell ROS (reactive oxygen species), cell migration and infiltration capacity stimulated and induced by TGF-beta1, thereby proving that through the Nrf2 gene overexpression, the occurrence of TGF-induced EMT can be inhibited by lowering the ROS level, the invasion and metastasis capacity of tumor cells is weakened, the malignant progression of the tumor cells is inhibited, and an effective therapeutic target is provided for the treatment of lung adenocarcinoma.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of the Nrf2 encoding gene in regulating EMT and metastasis in lung adenocarcinoma. Background Technology

[0002] Lung cancer is a highly malignant tumor, ranking first and second in mortality and incidence among cancer types worldwide, respectively, making it one of the most pressing clinical problems to address. Non-small cell lung cancer (NSCLC) accounts for as much as 85% of NSCLC cases, with lung adenocarcinoma being a more common subtype. The presence of distant metastases in most NSCLC patients is a major cause of the high mortality rate. Therefore, exploring the molecular mechanisms of lung cancer cell invasion and metastasis, and identifying suitable targets to inhibit cancer cell metastasis, will be crucial for reducing lung cancer mortality.

[0003] Currently, the main treatment options for cancer metastasis include blocking epithelial-mesenchymal transition (EMT). EMT is an important pathway for cell metastasis, weakening the adhesion between cells in the epithelial state, thus giving them stronger metastatic potential. EMT is one of the main mechanisms promoting cancer cell invasion and metastasis, and is also a key initiation factor and critical condition for NSCLC metastasis, representing an important condition for cancer metastasis. Therefore, understanding the molecular mechanisms of EMT and metastasis in lung adenocarcinoma, and identifying biomarkers for lung adenocarcinoma metastasis, will help researchers conduct early detection and prognostic treatment of lung adenocarcinoma, and design corresponding drugs to more accurately target metastatic cancer cells in the body. Summary of the Invention

[0004] The purpose of this invention is to address the problem of the lack of suitable targets for the invasion and metastasis of lung adenocarcinoma cells in the prior art.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] Application of Nrf2 as a target in the preparation of drugs that regulate EMT and metastasis in lung adenocarcinoma.

[0007] Preferably, the drug inhibits the occurrence of EMT in lung adenocarcinoma cells by overexpressing Nrf2.

[0008] Preferably, overexpression of the Nrf2 gene inhibits TGF-induced EMT by downregulating ROS levels, thereby weakening the invasive and metastatic ability of tumor cells and inhibiting the malignant development of tumor cells.

[0009] This application also provides a drug for regulating EMT and metastasis in lung adenocarcinoma, the drug comprising at least one of a biological agent overexpressing Nrf2, an active compound, a synthetic small molecule compound, and a polypeptide.

[0010] Preferably, the drug also includes other medically acceptable adjuvants.

[0011] Compared with the prior art, this application has the following beneficial effects:

[0012] This application demonstrates through specific verification experiments that Nrf2 knockdown promotes EMT, and that overexpression of the Nrf2 gene in HCC827 cell line via lentiviral transfection inhibits EMT. To investigate the mechanism, this application first demonstrates that knockdown of the Nrf2 gene in A549 cells enhances TGF-β1-induced cellular ROS, cell migration, and invasion. This proves that overexpression of the Nrf2 gene can inhibit TGF-induced EMT by downregulating ROS levels, weakening the invasive and metastatic ability of tumor cells, inhibiting malignant progression of tumor cells, and providing an effective therapeutic target for the treatment of lung adenocarcinoma. Attached Figure Description

[0013] Figure 1 Construction and validation of Nrf2 knockdown A549 cell lines: (AC) Evaluation of the infection efficiency of A549 cells infected with Nrf2shRNA3 virus; (A) PCR observation of Nrf2 mRNA knockdown level changes (two-way ANOVA analysis; *P<0.05); (B) Protein collection after Nrf2 knockdown in A549 cells and detection of Nrf2 protein expression level changes by immunoblotting; (C) Quantitative analysis of immunoblotting results of proteins in Figure B (two-tailed t-test analysis, *p<0.05); (D) Morphological photography of shconA549 and shNrf2A549 cells under a bright field microscope 72 h after seeding in six-well plates (scale bar = 100 μm).

[0014] Figure 2Nrf2 knockdown in A549 cell line promotes EMT: (A) Western blotting showed that in the control and experimental groups, the expression of epithelial-mesenchymal material was downregulated and the expression of mesenchymal markers was upregulated in the Nrf2 knockdown group (shcon group was considered as the control group and shNrf2 group was considered as the experimental group); (B) Quantitative analysis of the immunoblotting results of the protein (two-tailed t-test analysis, *p<0.05); (C) Microscopic images of A549 cell plate scratch test (scale bar: 100μm); (D) Data analysis of the scratch test (two-tailed t-test analysis; ***p<0.001); (EG) Cell chambers stained with crystal violet, representative images of migration and invasion were selected (scale bar: 100μm), and then the cell number was counted and analyzed using ImageJ software (two-tailed t-test analysis, **p<0.01).

[0015] Figure 3 HCC827 cells inhibited EMT after Nrf2 overexpression: (A) Western blot results showed changes in the protein levels of Nrf2, E-cadherin, and N-cadherin after Nrf2 overexpression in HCC827 cells, where con represents the virus transfection control group and oe represents the Nrf2 overexpression group; (B) Effects on A Figure 3 (C) Quantitative analysis of protein expression (using two-tailed t-test, *p<0.05); (D) Cell motility image shown by cell plate scratch assay (scale bar: 100μm); (E) Quantitative analysis of scratch assay in Figure C (using two-tailed t-test, *p<0.05); (F) Crystal violet stained microscopic images of cell migration and invasion assays in the corresponding chambers of a 24-well plate 48h after the Transwell assay (scale bar: 100μm); (G) Quantitative graphs of HCC827 cell migration and invasion efficiency calculated in two groups after 48h, and cell counts and analysis were performed using ImageJ software (using two-tailed t-test, **p<0.01).

[0016] Figure 4Knockdown of Nrf2 in A549 cells enhances TGF-β1-induced cellular ROS: (AB) After A549 cells in logarithmic growth phase were seeded and adhered to six-well plates, they were stimulated with different concentrations of TGF-β1 (0-20 ng / mL) for 48 hours. Then, 400 μL of LCFH-DA immunofluorescence probe (green fluorescence) was added to each well and incubated for 30 min to ensure that the probe covered the cell layer. Subsequently, the green fluorescence was observed under an immunofluorescence microscope or cells were collected and the level and differences of intracellular ROS were statistically analyzed by flow cytometry (scale bar: 100 μm, statistical analysis was performed using two-way ANOVA; *P<0.05). 05); (CD) Log-phase Nrf2 knockdown A549 cells and knockdown negative control cells were seeded into six-well plates and incubated for adherence. After stimulation with 0 ng / mL and 10 ng / mL TGF-β1 for 48 hours, 400 μL of KA4075 ROS immunofluorescence probe (orange fluorescence) was added to each well and incubated for 30 min to ensure the probe covered the cell layer. Subsequently, the orange fluorescence was observed under an immunofluorescence microscope or cells were collected and the intracellular ROS level and differences were statistically analyzed by flow cytometry (scale bar: 100 μm, statistical analysis was performed using two-way ANOVA; **P<0.01; *P<0.05).

[0017] Figure 5 The enhanced migration and invasion abilities of A549 cells after Nrf2 knockdown induced by TGF-β1 stimulation: (A) Microscopic images of A549 cells in two groups after TGF-β1 stimulation using a plate scratch assay (scale bar: 100 μm); (B) Quantitative analysis of the area of ​​the plate scratch assay in Figure E (two-sided t-test analysis; **p<0.01, *p<0.05); (C) Microscopic images of A549 cells in two groups after TGF-β1 stimulation and Transwell cell migration and invasion assay 48 h after crystal violet staining (scale bar: 100 μm); (DE) Quantitative graphs of migration and invasion abilities of A549 cells in two groups after 48 h after the migration and invasion assay. Cell counts were performed and analyzed using ImageJ software (two-sided t-test analysis, **p<0.01).

[0018] Figure 6The antioxidant NAC can reduce cell motility after scavenging ROS: (A) Immunofluorescence probe staining of cells under a microscope, where the concentration of TGF-β1 was 10 ng / mL and NAC was 2.5 mmol / L (scale bar: 100 μm); (B) Flow cytometry quantitative analysis of ROS accumulation in Figure A (two-way ANOVA analysis; **P<0.01, *P<0.05); (C) Microscopic state of plate scratch test (scale bar: 100 μm); (D) Figure C Quantitative analysis of plate scratch test area (two-tailed t-test analysis; **p<0.01, *p<0.05). Detailed Implementation

[0019] The present invention will be further described in detail below with reference to specific embodiments.

[0020] This application provides the application of Nrf2 as a target in the preparation of drugs that regulate EMT and metastasis in lung adenocarcinoma. By overexpressing Nrf2, the occurrence of EMT in lung adenocarcinoma cells is inhibited. In one embodiment, overexpression of the Nrf2 gene inhibits TGF-induced EMT by downregulating ROS levels, thereby weakening the invasive and metastatic ability of tumor cells and inhibiting the malignant development of tumor cells.

[0021] In addition, this application also provides a drug for regulating EMT and metastasis in lung adenocarcinoma, the drug comprising at least one of a biological agent overexpressing Nrf2, an active compound, a synthetic small molecule compound, and a polypeptide.

[0022] The following description, in conjunction with specific verification experiments, illustrates the above content: Molecular biology experimental methods not specifically described in the following examples can be performed in accordance with the methods listed in J. Sambrook's "Molecular Cloning: A Laboratory Manual" (3rd Edition) or conventional methods in the field, or according to the kit and product instructions.

[0023] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0024] Experimental materials and their sources:

[0025]

[0026] Example 1: Construction and validation of Nrf2 knockdown A549 cell line

[0027] (1) Cancer cells A549 were seeded in 6-well culture plates. The control group was transfected with NC-shRNA, and the experimental groups were transfected with Nrf2-shRNA1 (106660-1), shRNA2 (106661-1), and shRNA3 (106662-2), respectively. The sequence of the shRNA targeting the Nrf2 gene is shown below:

[0028] shRNA1(106660-1):GCTCCTACTGTGATGTGAAAT;

[0029] shRNA2(106661-1):GCTCAGTCACCTGAAACTTCT;

[0030] shRNA3(106662-2):GCCATTGATGTTTCTGATCT;

[0031] The non-targeting shLuc negative control(CON313):TTCTCCGAACGTGTCACGT.

[0032] After transfection, the cells were placed in a cell culture incubator and incubated at 37°C for 16 hours. The culture medium was then replaced and the cells were cultured again. After 72 hours of culture, the infection efficiency was observed under a microscope. If the efficiency reached 80%, the cells were replaced with a culture medium containing puromycin for further culture and screening (the concentration was 2 μg / mL according to the instructions, but the concentration could be increased appropriately based on the screening results to ensure that uninfected cells were killed). After further culture with puromycin medium, the infection efficiency was observed. Once the efficiency reached 80%, the cells were passaged normally and preserved.

[0033] (2) Wash A549 cells stably transfected with Nrf2-shRNA once with PBS, digest with trypsin, pipette the cells with 1 mL of complete culture medium, mix well, and transfer to a 1.5 mL centrifuge tube; transfer the centrifuge tube to a centrifuge, centrifuge at 1500 rpm for 5 min, remove the culture medium, resuspend and wash the cells with 1 mL of PBS buffer, centrifuge again at 1500 rpm for 5 min, remove the supernatant; add 100 μL of RIPA lysis buffer with protease inhibitor PMSF, mix well, place on ice for 30 min, invert the centrifuge tube every 10 min to mix; place the centrifuge tube in a centrifuge, centrifuge at 12000 rpm at 4℃ for 10 min, and transfer the supernatant to a new centrifuge tube;

[0034] (3) Protein concentration was detected using the Beyotime BCA protein quantification kit, and loading buffer was added. Protein electrophoresis was performed on a 10% SDS-PAGE gel. After electrophoresis, the protein was transferred to a PVDF membrane by electroporation. After electroporation, the PVDF membrane was removed and placed in 5% skim milk powder. Nrf2 and β-actin primary antibodies were added and incubated overnight at 4°C. After primary antibody incubation, the membrane was washed with PBS for 3 hours and then incubated with secondary antibody on a shaker at room temperature for 1 hour. After incubation, the membrane was developed and exposed.

[0035] (4) RNA was extracted from A549 cells stably transfected with Nrf2-shRNA and detected by quantitative real-time PCR. The primer sequences for the Nrf2 gene are shown below:

[0036] Top Strand:

[0037] 5'-AGGTTGCCCACATTCCCAAA-3', SEQ ID NO.1

[0038] Bottom Strand:

[0039] 5'-ACGTAGCCGAAGAAAACCTCA-3', SEQ ID NO.2

[0040] The internal control uses GAPDH, and the primer sequence for the internal control is as follows:

[0041] Top Strand:

[0042] 5'-CATGAGAAGTATGACAACAGCC-3', SEQ ID NO.3

[0043] Bottom Strand:

[0044] 5'-TTCAGCTCAGGGATGACCTTG-3', SEQ ID NO.4

[0045] The quantitative fluorescence procedure was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 10 s, 45 cycles; 95℃ for 5 s, 65℃ for 1 min; gene quantification data were calculated using 2... -ΔΔCt Law.

[0046] Experimental results are as follows Figure 1 As shown, RT-PCR and Western blot experiments verified the Nrf2 knockdown efficiency of the virus. Figure 1A-1C; *p<0.05). The results showed that the Nrf2 knockdown effect was most significant in the Nrf2 shRNA group 3 compared to the lentiviral-infected shRNA negative control group. Subsequently, cells from both the Nrf2 shRNA group 3 and the viral-infected shRNA negative control group were continuously cultured in vitro, and morphological observation was performed using an inverted microscope. Figure 1 D), the results showed that the Nrf2 knockdown group cells became spindle-shaped and showed more stromal fibroblast morphology than the control group.

[0047] Example 2: Nrf2 knockdown in A549 cells promotes EMT.

[0048] (1) Take Nrf2 knockdown A549 cells in the logarithmic growth phase, collect cell supernatant for protein electrophoresis as in Example 1, transfer the cell to a membrane, add E-cadherin and N-cadherin primary antibodies, and incubate overnight at 4°C; after the primary antibody incubation is completed, wash the cells three times with PBS, add secondary antibody and incubate on a shaker at room temperature for 1 h; after the incubation is completed, perform development and exposure.

[0049] (2) Using a six-hole plate with 20×10 mm per hole. 4 Take the calculated cell suspension volume, add complete culture medium to prepare a fresh suspension, seed it into a six-well plate, gently shake the plate, observe under a microscope to ensure uniform cell distribution, and incubate at 37°C. After 2-3 days, when the adherent cells just cover the bottom of the dish, select the center of the uniformly grown cells, use a 200μL pipette tip, and starting from the top of the dish, draw a straight line to the corresponding bottom position, keeping the line as vertical as possible. Set up two replicates for each experimental well and perform the same operation. After drawing all the cells in this way, wash the cells that have slipped into the well with PBS to remove excess cells, add complete culture medium, take a picture immediately, and incubate at 37°C, recording the time and location of the picture. After 24 hours and 48 hours, respectively, remove the cells, wash away excess cells with PBS, add fresh culture medium, take a picture at the same location, and then process the data using ImageJ software.

[0050] (3) Dilute the matrix gel 1:8. Carefully and evenly spread 60 mL of the diluted matrix gel evenly on the bottom of the chamber, being careful to avoid air bubbles. Place the chamber with the gel in a 24-well plate and incubate at 37°C for 3 hours. After the matrix gel solidifies, remove it and aspirate any excess matrix gel that has not been fully spread. Only the invasion experimental group needs to be coated with matrix gel; the migration group does not need to be coated. Each experimental group should be replicated in 2 duplicates. Take logarithmic growth phase cells that have been starved for 12 hours in advance, digest them with trypsin, prepare a cell suspension, and count them using a counting chamber. According to the required number of wells, use 5 × 10⁻⁶ cells per well. 4Calculate the cell suspension volume using serum-free basal medium. Add 150 μL of the prepared cell suspension to each chamber, and then add 600 μL of serum-containing complete medium to the corresponding well below the chamber, ensuring the complete medium covers the bottom of the chamber. After culturing for 24-48 hours, remove the chambers and aspirate the liquid from the wells. Rinse the chambers three times with PBS. After washing, gently wipe away excess cells from the inside of the chambers with a cotton swab. Place the chambers in the wells and add 800 μL of paraformaldehyde for fixation for 30 min. After fixation, remove the chambers and rinse three times with PBS. Immerse the chambers in wells containing 800 μL of crystal violet staining solution and stain on a shaker for 3 min, then rinse. Repeat this process three times to complete the staining. Place the chambers in a ventilated area to air dry. After drying, photograph the chambers using a microscope, taking pictures from nine positions in each well: center, top, bottom, left, right, upper left, upper right, lower left, and lower right. Count the cells using ImageJ software.

[0051] Experimental results are as follows Figure 2 As shown, Western blot analysis revealed that the Nrf2 knockdown group exhibited upregulation of interstitial markers, indicating a more pronounced interstitial phenotype. Figure 2 A-2B; *p<0.05); Cell scratch assay showed that, compared with the control group, the scratch area of ​​cells in the shNrf2 knockdown group was significantly smaller, indicating that the cells in this group had higher motility. Figure 2 C-2D; ***p<0.001); Transwell assays showed that the shNrf2 experimental group cells transferred more cells in the chamber within the specified time. Figure 2 E-2G; **p<0.01).

[0052] In conclusion, the experiment demonstrates that Nrf2 knockdown in A549 cells promotes the cell's epithelial-mesenchymal transition capacity.

[0053] Example 3: Overexpression of Nrf2 in HCC827 cell line inhibits EMT.

[0054] (1) Lung adenocarcinoma cells HCC827 were seeded in 6-well culture plates and the Nrf2 gene (NFE2L2, NM-006164) was overexpressed via lentivirus. The control group was transfected with the empty vector GV341 (element sequence: Ubi-MCS-3FLAG-SV40-puromycin), and the experimental groups were transfected with Nrf2-GV341. The inserted Nrf2 gene sequence is shown in SEQ ID NO.5, where SEQ ID NO.6 and SEQ ID NO.7 are the vector sequence, and the remaining part is the insertion sequence.

[0055] After transfection, the cells were placed in a cell culture incubator and incubated at 37°C for 16 hours. The culture medium was then replaced and the cells were cultured again. After 72 hours of culture, the infection efficiency was observed under a microscope. If the efficiency reached 80%, the cells were replaced with a culture medium containing puromycin for further culture and screening (the concentration was 2 μg / mL according to the instructions, but the concentration could be increased appropriately based on the screening results to ensure that uninfected cells were killed). After further culture with puromycin medium, the infection efficiency was observed. Once the efficiency reached 80%, the cells were passaged normally and preserved.

[0056] (2) Take Nrf2-overexpressing HCC827 cells in the logarithmic growth phase, collect cell supernatant for protein electrophoresis as in Example 1, transfer to membrane, add Nrf2, E-cadherin and N-cadherin primary antibodies, and incubate overnight at 4°C; after the primary antibody incubation, wash three times with PBS, add secondary antibody and incubate on a shaker at room temperature for 1 h; after the incubation, perform development and exposure.

[0057] (3) In order to clarify whether HCC827 cells can affect the EMT process of lung adenocarcinoma cells after overexpressing Nrf2, cell plate scratch experiment, Transwel invasion and metastasis experiment were performed in this example according to Example 2.

[0058] Experimental results are as follows Figure 3 As shown, Western blotting experiments revealed that epithelial markers were significantly upregulated and stromal markers were downregulated in the overexpression group. Figure 3 A-3B; *p<0.05). Combined with the above A549 cell experimental results, it was concluded that cells with high Nrf2 expression exhibited enhanced epithelial properties and weakened mesenchymal activity, while cells with low Nrf2 expression exhibited weakened epithelial properties and enhanced mesenchymal activity; cell scratch assays showed that, compared to the control group, overexpression of Nrf2 also inhibited cell motility. Figure 3 C-3D; *p<0.05); Transwell assays showed that the invasive ability of the Nrf2 overexpression group was significantly reduced. Figure 3 E-3G; **p<0.01).

[0059] In conclusion, Nrf2 inhibits epithelial-mesenchymal transition in lung adenocarcinoma cells.

[0060] Example 4: Knockdown of Nrf2 in A549 cells enhances TGF-β1-induced cellular ROS.

[0061] Reactive oxygen species (ROS) play a crucial role in the development of non-small cell lung cancer (NSCLC). ROS are continuously generated and cleared in various cell types, and the oxidative stress in tumor cells is significantly higher than in normal cells. Cancer cells, due to their uncontrolled proliferation, have increased demands for nutrients and oxygen, leading to more vigorous metabolism. This induces a continuous increase in ROS concentration in the tumor microenvironment to meet the needs of cancer cells. Simultaneously, ROS have attracted widespread research interest in promoting tumor metastasis and endogenous tumor metastasis (EMT). Studies have shown that ROS can affect tumor EMT through crosstalk integrin signaling pathways and TGF-β1 signaling pathways; ROS may also act as second messengers to influence cell migration. These related mechanisms require further detailed exploration in the future.

[0062] Therefore, this embodiment demonstrates the application of Nrf2 in lung adenocarcinoma by verifying that knocking down Nrf2 in 549 cells enhances TGF-β1-induced cellular ROS. The steps are as follows:

[0063] (1) Take A549 cells in the logarithmic growth phase, digest them with trypsin to prepare a cell suspension, and then precipitate them at a concentration of 20 × 10⁻⁶. 4 Calculate the required number of cells per well, seed them into 6-well plates, seed each well with 2 mL of cell suspension, and set up 2 replicates for each experimental group. Set up a blank control group and a negative control group, and then incubate in a 37°C incubator (each group is set up in duplicate, one of which is used for fluorescence microscopy and the other for flow cytometry experiments).

[0064] (2) After 24 hours, the cells adhered normally to the culture medium. The cells were removed and washed twice with PBS. The required drug concentration was prepared and added to the new culture medium (TGF-β1, 0-20 ng / mL) to change the medium. The cells were then placed in an incubator and cultured for another 48 hours.

[0065] (3) After 48 hours, remove the sample, discard the waste liquid, wash twice with PBS, add 10 μM of DCFH-DA fluorescent probe (diluted with serum-free culture medium at a ratio of 1:1000) or 1 μL / mL of ROS 570 orange fluorescent probe (total ROS activity assay kit) to each well, dilute with serum-free culture medium, and incubate at 37°C in the dark for 30 min to ensure that the probe completely covers the cell layer.

[0066] (4) After incubation, wash the cells three times with serum-free culture medium and digest them into 1.5 mL EP tubes. Discard the supernatant, add 500 mL PBS and mix well. Collect the cells and use flow cytometry to analyze the level and difference of ROS in the cells. Take another group and observe the green or orange fluorescence under an immunofluorescence microscope.

[0067] Fluorescence microscopy revealed that, compared to the control group, a significant increase in green fluorescence signal was observed in A549 cells when the TGF-β1 concentration was 10 ng / mL. Figure 4 A). Further flow cytometry analysis showed that in the 10 ng / mL TGF-β1 stimulation group, the intracellular reactive oxygen species content of A549 cells was significantly increased ( Figure 4 B; *p<0.05). Therefore, in this embodiment, a TGF-β1 concentration of 10 ng / mL was selected as the subsequent experimental stimulation condition to stimulate the previously established stable Nrf2 knockdown cell line. Fluorescence microscopy revealed that, compared with the control group without TGF-β1, the orange-red fluorescence signal of the TGF-β1-stimulated cells was significantly enhanced (B; *p<0.05). Figure 4 C), and under the same concentration of stimulation, the fluorescence signal in the shNrf2 experimental group was significantly stronger than that in the shcon control group, and the ROS detection results by flow cytometry were also consistent. That is to say, TGF-β1 stimulation can upregulate the cellular ROS level, and Nrf2 knockdown can further enhance the accumulation of cellular ROS induced by TGF-β1 stimulation. Figure 4 D; **p<0.01, *p<0.05).

[0068] Example 5: Knockdown of Nrf2 in A549 cells enhances TGF-β1-induced cell migration and invasion.

[0069] To further confirm whether knocking down Nrf2 in lung adenocarcinoma cells could enhance TGF-β1-induced cell motility, migration, and invasion, cell plate scratch assay, Transwel invasion, and metastasis assay were performed in this example, referring to Example 2.

[0070] The results showed that A549 cells exhibited enhanced migration and invasion abilities after TGF-β1 stimulation, and compared to the non-knockdown group, the Nrf2 knockdown group showed significantly improved migration and invasion abilities after TGF-β1 stimulation. Figure 5 A-5E; **p<0.01, *p<0.05), these results suggest that Nrf2 knockdown can enhance TGF-β1-induced cell migration and invasion.

[0071] Example 6: Knockdown of Nrf2 in A549 cells promotes TGF-β1-induced cell migration by upregulating ROS levels.

[0072] To investigate whether the improvement in TGF-β1-induced cell migration ability of A549 cells after Nrf2 knockdown depends on the increase in intracellular ROS levels, this embodiment designed a method of stimulating A549 cells with Nrf2 knockdown and TGF-β1, followed by co-culturing with NAC. Immunofluorescence and flow cytometry were performed to analyze the changes in intracellular ROS levels before and after NAC co-culturing, as in Example 4. Cell scratch assays were performed to compare the changes in cell migration ability before and after NAC co-culturing, as in Example 2.

[0073] Immunofluorescence and flow cytometry analysis showed that co-culture with NAC significantly alleviated the increase in intracellular ROS levels in Nrf2 knockdown cells after TGF-β1 stimulation. Figure 6 A-6B; **p<0.01, *p<0.05). Cell scratch assays showed that A549 cells exhibited enhanced migration ability after stimulation with 10 ng / mL TGF-β1, and the enhanced migration ability was even more pronounced after Nrf2 knockdown followed by TGF-β1 stimulation. Subsequently, co-culturing with 2.5 mM NAC in cell culture medium significantly inhibited the TGF-β1-induced increase in cell migration in the Nrf2 knockdown group. Figure 6 C-6D; **p<0.01, *p<0.05). These results suggest that knockdown of Nrf2 in A549 cells promotes TGF-β1-induced cell migration by upregulating ROS levels.

[0074] Based on the above description, this application verified through specific experiments that Nrf2 knockdown promotes EMT, and that overexpression of the Nrf2 gene in HCC827 cell line via lentiviral transfection demonstrates that overexpression of Nrf2 inhibits EMT. To investigate the mechanism, this application first demonstrated that knockdown of the Nrf2 gene in A549 cells enhanced TGF-β1-induced cell ROS, cell migration, and invasion, thus proving that overexpression of the Nrf2 gene can inhibit TGF-induced EMT by downregulating ROS levels, weakening the invasive and metastatic ability of tumor cells, inhibiting malignant progression of tumor cells, and providing an effective therapeutic target for the treatment of lung adenocarcinoma.

Claims

1. Application of Nrf2 as a target in the preparation of drugs that regulate EMT and metastasis in lung adenocarcinoma.

2. The application of Nrf2 as a target in the preparation of drugs for regulating EMT and metastasis of lung adenocarcinoma according to claim 1, characterized in that: The drug inhibits the occurrence of EMT in lung adenocarcinoma cells by overexpressing Nrf2.

3. The application of Nrf2 as a target in the preparation of drugs for regulating EMT and metastasis of lung adenocarcinoma according to claim 2, characterized in that: Overexpression of the Nrf2 gene inhibits TGF-induced EMT by downregulating ROS levels, thereby weakening the invasive and metastatic ability of tumor cells and inhibiting the malignant development of tumor cells.

4. A drug for regulating EMT and metastasis in lung adenocarcinoma, characterized in that: The drug contains at least one of the following: a biological agent that overexpresses Nrf2, an active compound, a synthetic small molecule compound, or a polypeptide.

5. A drug for regulating EMT and metastasis in lung adenocarcinoma according to claim 4, characterized in that: The drug also includes other medically acceptable adjuvants.

Images