Compositions, kits and methods for conducting fast polymerase chain reactions

Abstract

Compositions, kits, and methods for performing a rapid polymerase chain reaction (PCR) to amplify a target nucleic acid in a biological sample are disclosed. The method comprises the use of at least one hybridization stabilizer and / or the adjustment of the thermal cycle profile between the onset and proliferation phases of the amplification process. Also disclosed are methods of detecting target nucleic acids after amplification thereof, as well as reaction mixtures useful in the methods.

Description

[0001] This application is a divisional application of the invention patent application filed on January 5, 2021, with application number 202180008487.6 and entitled "Compositions, kits and methods for performing rapid polymerase chain reactions".

[0002] This application claims the benefit of Provisional Application No. 62 / 959,240, filed January 10, 2020; and U.S. Serial No. 62 / 968,259, filed January 31, 2020, pursuant to 35 USC § 119(e). The entire contents of the above-cited patents / patent applications are expressly incorporated herein by reference. Technical Field

[0003] This disclosure relates to polymerase chain reaction (PCR), and more particularly to compositions, kits, and methods for performing rapid polymerase chain reaction (PCR) to amplify target nucleic acids in biological samples. Background Technology

[0004] Polymerase chain reaction (PCR) is a widely accepted and practiced laboratory method used to replicate or amplify the concentration of nucleic acids (NAs), such as DNA, in a test tube. Replication / amplification occurs in an aqueous solution containing a predetermined concentration of DNA molecules. Then, predetermined amounts of polymerase, oligonucleotide primers, and triphosphates or substrates of four nucleic acids are added to the aqueous solution, followed by two thermal steps, called denaturation and annealing / extension.

[0005] During the first denaturation step, the DNA double helix in the aqueous solution is heated at a high temperature (such as between about 90-95°C), causing each strand of the double helix to separate from each other. During the second annealing / extension step, the denatured aqueous solution is cooled (such as to a temperature between about 60 and about 72°C), allowing oligonucleotide primers to ligate to the complementary nucleotide sequence of each denatured DNA strand, and the DNA double helix is ​​reformed by primer extension. More specifically, a thermostable polymerase, such as Taq polymerase, binds nucleotides to the primers linked to the complementary nucleotide sequences, forming two new DNA double helices where previously there was only one. Thus, with each completed cycle, the number of DNA molecules is doubled, resulting in... n After one cycle, the number of DNA molecules equals N0x2. n (where N0 is the initial copy number).

[0006] Although theoretically each of these steps takes only 3–30 seconds to complete, in practice, the duration of each thermal step is influenced by many different factors that increase the turnaround time (TAT) of the PCR reaction; these factors affect the heat transfer rate of heating or cooling the aqueous solution at a predetermined thermal cycling temperature. Variables that can affect the heating / cooling rate include (e.g., but not limited to) the volume of the solution, the concentration of the aqueous solution, the thermal conductivity of the container holding the nucleic acid in the aqueous solution, the thermal conductivity of the equipment holding the container, and the method of applying and removing heat, for example, by conduction or convection.

[0007] Conventional sloping rates, amplicon sizes, and oligomer denaturation temperatures are not optimal for all the desired characteristics of rapid and efficient PCR amplification. Other teams have disclosed certain modifications to PCR reagents and PCR thermal cycling profiles to facilitate faster PCR reactions (see, for example, US Patent Applications Nos. US 2010 / 0256062; US 2016 / 0289736; US 2018 / 0179581; and US 2019 / 0002954; International Patent Publication No. WO 2018 / 125835; and Wang et al.). Biotechniques (2005) 39:885-893); Farrar et al. ( Clinical Chemistry (2015) 61:145-153); Bustin ( Biomolecular Detection and Quantification (2017) 12:10-14); and Sundberg et al. ( Clinical Chemistry (2014) 60:1306-1313); however, the methods disclosed in the prior art do not provide turnaround time and target-specific signal generation (real-time PCR), which would be necessary for the commercialization of assays for infectious diseases, for example.

[0008] Therefore, there is a need in the art for new and improved PCR methods that achieve very rapid thermal cycling profiles and thus rapid turnaround times, while maintaining the sensitivity and selectivity of target-specific signal generation. This would make the method suitable for close-range patient testing using point-of-care (POC) diagnostic devices, particularly for time-critical assays. This disclosure relates to such new and improved PCR methods, as well as compositions, kits, and reaction mixtures for use therein. Summary of the Invention

[0009] Before explaining in detail at least one embodiment of the inventive concept through exemplary language and results, it should be understood that the application of the inventive concept is not limited to the details of the construction and arrangement of the components set forth in the following description. The inventive concept can have other embodiments, or can be practiced or implemented in various ways. Therefore, the language used herein is intended to be given the broadest possible scope and meaning; and the embodiments are meant to be exemplary—not exhaustive. Moreover, it should be understood that the wording and terminology used herein are for descriptive purposes and should not be considered limiting.

[0010] Unless otherwise defined herein, scientific and technical terms used in connection with the inventive concept of this disclosure shall have the meanings commonly understood by one of ordinary skill in the art. Furthermore, unless the context requires otherwise, singular terms shall include plural terms, and plural terms shall include singular terms. The foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in the various general and more specific references cited and discussed throughout this specification. The nomenclature and laboratory procedures and techniques used in conjunction with analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein are those well known and commonly used in the art. Standard techniques are used for chemical synthesis and chemical analysis.

[0011] All patents, published patent applications, and non-patent publications mentioned in this specification indicate the level of skill of a person skilled in the art to which the inventive concept of this disclosure pertains. All patents, published patent applications, and non-patent publications cited in any part of this application are expressly incorporated herein by reference in their entirety, to the extent that each individual patent or publication is specifically and individually indicated to be incorporated by reference.

[0012] In view of this disclosure, all the compositions and / or methods disclosed herein can be prepared and performed without excessive experimentation. Although the compositions and methods of the inventive concept have been described in particular embodiments, it will be apparent to those skilled in the art that variations may be applied to the compositions and / or methods described herein, as well as the steps or sequence of steps of said methods, without departing from the concept, spirit, and scope of the inventive concept. All such similar substitutions and modifications that are apparent to those skilled in the art are considered to be within the spirit, scope, and concept of the inventive concept as defined by the appended claims.

[0013] As used in accordance with this disclosure, unless otherwise instructed, the following terms shall be understood to have the following meanings: When used in conjunction with the term "comprising" in the claims and / or specification, the use of the terms "a" or "an" can mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." Therefore, the terms "a," "an," and "the" include plural indicators unless the context clearly indicates otherwise. Thus, for example, a reference to "a compound" can refer to one or more compounds, two or more compounds, three or more compounds, four or more compounds, or a greater number of compounds. The term "multiple" means "two or more."

[0014] The term "at least one / type" will be understood to include one / type and any quantity of more than one / type, including but not limited to 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 100 / type, etc. The term "at least one / type" may be extended to 100 or 1000 or more / types, depending on the term it is attached to; furthermore, a quantity of 100 / 1000 is not considered limiting, as higher limits can also produce satisfactory results. Furthermore, the term "at least one / type of X, Y, and Z" will be understood to include X alone, Y alone, and Z alone, as well as any combination of X, Y, and Z. The use of ordinal terms (i.e., "first," "second," "third," "fourth," etc.) is solely for the purpose of distinguishing two or more items and does not imply any order or sequence of importance of one item relative to another, or any order of addition.

[0015] The term "or" is used in claims to mean inclusive "and / or" unless explicitly stated to refer only to alternatives or unless the alternatives are mutually exclusive. For example, any of the following satisfy the condition "A or B": A is true (or exists) and B is false (or does not exist), A is false (or does not exist) and B is true (or exists), and both A and B are true (or exist).

[0016] As used herein, any reference to “one embodiment,” “an embodiment,” “some embodiments,” “one example,” “for example,” or “an example” means that a specific element, feature, structure, or characteristic described in connection with that embodiment is included in at least one embodiment. For example, the phrases “some embodiments” or “one example” appearing throughout the specification do not necessarily all refer to the same embodiment. Furthermore, all references to one or more embodiments or examples should be construed as non-limiting to the claims.

[0017] Throughout this application, the term "about" is used to indicate that a value includes inherent variations in the error of the composition / instrument / apparatus or method used to determine that value, or variations present among study subjects. For example, but not limitingly, when using the term "about," a specified value may differ from an indicated value by plus or minus 20%, or 15%, or 12%, or 11%, or 10%, or 9%, or 8%, or 7%, or 6%, or 5%, or 4%, or 3%, or 2%, or 1%, as such variations are applicable to performing the disclosed methods and are understood by those skilled in the art.

[0018] As used in this specification and claims, the terms “comprising” (and any form of inclusion, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of inclusion, such as “includes” and “include”), or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional unlisted elements or method steps.

[0019] As used herein, the term "or a combination thereof" refers to all permutations and combinations of the items listed preceding the term. For example, "A, B, C, or a combination thereof" is intended to include at least one of the following: A, B, C, AB, AC, BC, or ABC, and also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB if the order is significant in the particular context. Continuing with this example, explicitly included are combinations containing repetitions of one or more items or terms, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CABABB, and so on. Those skilled in the art will understand that, unless apparent from the context, there is generally no limit to the number of items or terms in any combination.

[0020] As used herein, the term "substantially" means that the event or situation subsequently described occurs completely or to a great extent or degree. For example, when relating to a specific event or situation, the term "substantially" means that the event or situation subsequently described occurs at least 80% of the time, or at least 85% of the time, or at least 90% of the time, or at least 95% of the time. For example, the term "substantially adjacent" could mean that two items are 100% adjacent to each other, or that two items are very close to each other but not 100% adjacent, or that a part of one of the two items is not 100% adjacent to the other item but is very close to it.

[0021] The terms "polynucleotide" and "nucleic acid" are used interchangeably. They refer to polymeric forms of nucleotides (deoxyribonucleotides or ribonucleotides, or analogs) of any length. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene segments, multiple loci (one locus) defined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure can be conferred before or after polymer assembly, if present. The sequence of the nucleotide may be broken down by non-nucleotide components. Polynucleotides can be further modified, such as by conjugation with labeled components. The terms “isolated nucleic acid” and “isolated polynucleotide” are used interchangeably; a nucleic acid or polynucleotide is considered “isolated” if: (1) it is not associated with all or part of a polynucleotide in which “isolated polynucleotide” is found in nature, (2) it is linked to a polynucleotide in which it is not linked, or (3) it is not present in nature as part of a larger sequence.

[0022] As used herein, the term "naturally occurring" refers to the fact that an object can be found in nature. For example, a polynucleotide or polypeptide sequence that exists in organisms (including viruses) that can be isolated from natural sources and has not been intentionally modified by humans or other means in a laboratory is naturally occurring. The term "naturally occurring" may be used interchangeably with the term "natural" herein.

[0023] The term "selective hybridization" as used herein refers to detectable and specific binding. Polynucleotides, oligonucleotides, and fragments thereof encoding peptides / peptides / proteins according to the present invention selectively hybridize with nucleic acid chains under hybridization and washing conditions that minimize an assessable amount of detectable binding with nonspecific nucleic acids. Selective hybridization conditions known in the art and discussed herein can be achieved using highly stringent conditions. Typically, the nucleic acid sequence homology between the polynucleotides, oligonucleotides, and fragments of the present invention and the target nucleic acid sequence will be at least 80%, and more generally, there will be increased homology of at least 85%, 90%, 95%, 99%, and 100%. Two amino acid sequences are homologous if there is partial or complete identity between them. For example, 85% homology means that 85% of the amino acids are identical when two sequences are aligned for a maximum match. Vacancies are allowed in maximum matches (in either of the matching sequences); a vacancy length of 5 or less is preferred (but not limiting), while 2 or less is more preferred (but not limiting). Alternatively, as used herein, two protein sequences (or polypeptide sequences of at least 30 amino acids derived from them) are homologous if, using the ALIGN procedure with a mutation data matrix and a vacancy penalty of 6 or more, they have an alignment score greater than 5 (in standard deviation units). See Dayhoff, MO, Atlas of Protein Sequence and Structure, pp. 101–110 (Vol. 5, National Biomedical Research Foundation (1972)) and Supplement 2 to this volume, pp. 1–10. More preferably, when using the ALIGN procedure for optimal alignment, two sequences or portions thereof are homologous if they share 50% or more of the same amino acids. The term “corresponding to” as used herein means that a polynucleotide sequence is wholly or partially homologous to a reference polynucleotide sequence (i.e., identical, non-evolutionarily related), or that a polypeptide sequence is identical to a reference polypeptide sequence. In contrast, the term “complementary to” as used herein means that a complementary sequence is wholly or partially homologous to a reference polynucleotide sequence. For illustrative purposes, the nucleotide sequence “TATAC” corresponds to the reference sequence “TATAC” and is complementary to the reference sequence “GTATA”.

[0024] The following terms are used to describe sequence relationships between two or more polynucleotide or amino acid sequences: “reference sequence,” “comparison window,” “sequence identity,” “percentage of sequence identity,” and “substantial identity.” A “reference sequence” is defined as the sequence used as the basis for sequence comparison; a reference sequence may be a subset of a larger sequence, for example, a segment of a full-length cDNA or gene sequence given in a sequence listing, or may contain the complete cDNA or gene sequence. Typically, a reference sequence is at least 18 nucleotides or 6 amino acids long, usually at least 24 nucleotides or 8 amino acids long, and frequently at least 48 nucleotides or 16 amino acids long. Because two polynucleotide or amino acid sequences can each (1) contain similar sequences (i.e., portions of complete polynucleotide or amino acid sequences) between the two molecules, and (2) can further contain dissimilar sequences between the two polynucleotide or amino acid sequences, sequence comparisons between two (or more) molecules are typically performed by comparing the sequences of the two molecules in a “comparison window” to identify and compare local regions with sequence similarity. As used herein, a “comparison window” refers to a conceptual segment of at least 18 consecutive nucleotide positions or 6 amino acids, wherein a polynucleotide sequence or amino acid sequence can be compared with a reference sequence of at least 18 consecutive nucleotides or 6 amino acids, and wherein for optimal alignment of the two sequences, the portion of the polynucleotide sequence within the comparison window may contain 20% or less of additions, deletions, substitutions, etc. (i.e., vacancies) compared with the reference sequence (which does not include additions or deletions). The optimal alignment of sequences within the comparison window can be achieved through the local homology algorithm of Smith and Waterman (Adv. Appl. Math., 2:482 (1981)), the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol., 48:443 (1970)), the similarity search method of Pearson and Lipman (Proc. Natl. Acad. Sci. (USA), 85:2444 (1988)), the computerized implementation of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package Release 7.0, (Genetics Computer Group, 575 Science Dr., Madison, Wis.), Geneworks, or the MacVector package), or by inspection, and the best alignment (i.e., the one that results in the highest percentage of homology within the comparison window) produced by each method is selected.

[0025] The term "sequence identity" means that two polynucleotide or amino acid sequences are identical within a comparison window (i.e., on a nucleotide-to-nucleotide or residue-to-residue basis). The term "sequence identity percentage" is calculated as follows: comparing two optimally aligned sequences within the comparison window, determining the number of positions in the two sequences containing the same nucleic acid bases (e.g., A, T, C, G, U, or I) or residues to produce a number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to produce the sequence identity percentage. As used herein, the term "substantial identity" refers to a characteristic of a polynucleotide or amino acid sequence in which, within a comparison window of at least 18 nucleotides (6 amino acids), often at least 24-48 nucleotides (8-16 amino acids), the polynucleotide or amino acid contains a sequence that has at least 85% sequence identity, such as at least 90% to 95%, or at least 99% sequence identity, compared to a reference sequence. This percentage of sequence identity is calculated by comparing the reference sequence within the comparison window with sequences that may include deletions or additions comprising 20% ​​or less of the total number of elements in the reference sequence. The reference sequence may be a subset of a larger sequence.

[0026] As used herein, the terms “analyte” or “variant” will be understood to refer to a variation of the normal or standard form or wild-type form of a molecule. For polypeptides or polynucleotides, analogs can be variations (polymorphisms), mutants, and / or naturally occurring or artificially modified forms of wild-type polynucleotides (including combinations thereof). Such analogs can have higher, full, intermediate, or lower activity than the normal form of the molecule, or no activity at all. Alternatively and / or in addition, for chemicals, analogs can be any structure having the desired functional groups (including alterations or substitutions in the core moiety), even if composed of different atomic or isomeric arrangements.

[0027] As used herein, the term “patient” includes both human and veterinary subjects. “Mammal” for therapeutic purposes means any animal classified as a mammal, including (but not limited to) humans, livestock and farm animals, non-human primates, and any other animal with mammary tissue.

[0028] Turning now to the inventive concept, a very rapid PCR method is disclosed, comprising the use of two unique features: the use of multiple thermal cycling profiles already adjusted based on the generated amplicon, and the use of a hybridization stabilizer in conjunction with primers or probes. This disclosed very rapid PCR method provides a rapid turnaround time while maintaining the sensitivity and selectivity of target-specific signal generation; therefore, the PCR method disclosed herein is suitable for close-range patient testing using point-of-care (POC) diagnostic devices, which is particularly valuable for time-critical assays.

[0029] Certain non-limiting embodiments of this disclosure relate to a method for amplifying a target nucleic acid in a biological sample. The method includes the steps of: (i) adding a thermostable polymerase, a nucleotide, and a pair of primers configured to amplify the target nucleic acid to the biological sample to produce an amplification mixture, wherein at least one of the primers contains a hybridization stabilizer; and (ii) amplifying the target nucleic acid by polymerase chain reaction, using a temperature cycling profile to thermally cycle the amplification mixture between at least a denaturation temperature and an extension temperature via a plurality of amplification cycles. Furthermore, the plurality of amplification cycles includes at least one initiation cycle and at least one proliferation cycle, and the thermal cycling profile of the initiation cycle differs from that of the proliferation cycle.

[0030] In some non-limiting embodiments, each initial cycle is completed within the following cycle times: each cycle is equal to or less than about 60 seconds, such as (but not limited to) equal to or less than about 55 seconds, equal to or less than about 50 seconds, equal to or less than about 45 seconds, equal to or less than about 40 seconds, equal to or less than about 35 seconds, equal to or less than about 30 seconds, equal to or less than about 25 seconds, equal to or less than about 20 seconds, equal to or less than about 19 seconds, equal to or less than about 18 seconds, equal to or less than about 17 seconds, etc. In addition, each proliferation cycle is completed within the following cycle times: equal to or less than about 30 seconds, such as (but not limited to) equal to or less than about 29 seconds, equal to or less than about 28 seconds, equal to or less than about 27 seconds, equal to or less than about 26 seconds, equal to or less than about 25 seconds, equal to or less than about 24 seconds, equal to or less than about 23 seconds, equal to or less than about 22 seconds, equal to or less than about 21 seconds, equal to or less than about 20 seconds, equal to or less than about 19 seconds, equal to or less than about 18 seconds, equal to or less than about 17 seconds, equal to or less than about 16 seconds, equal to or less than about 15 seconds, equal to or less than about 14 seconds, equal to or less than about 13 seconds, equal to or less than about 12 seconds, equal to or less than about 11 seconds, equal to or less than about 10 seconds, equal to or less than about 9 seconds, equal to or less than about 8 seconds, equal to or less than about 7 seconds, equal to or less than about 6 seconds, equal to or less than about 5 seconds, equal to or less than about 4 seconds, equal to or less than about 3 seconds, equal to or less than about 2 seconds, etc.

[0031] In some non-limiting embodiments, the thermal cycling profiles of the initiation and proliferation cycles differ from each other in at least one parameter. For example (but not limitingly), the thermal cycling profile of the proliferation cycle may have different denaturation temperature, denaturation duration / time, extension temperature, extension duration / time, sloping rate, and / or cycle completion time compared to the thermal cycling profile of the initiation cycle. The differences in the thermal cycling profiles may be at least one, at least two, at least three, at least four, at least five, or all six of these parameters.

[0032] The amplicon can have any melting / denaturation temperature and any length, provided that it can be generated by the methods disclosed herein. For example (but not limitingly), the amplicon can have a complete denaturation temperature of about 80°C, about 81°C, about 82°C, about 83°C, about 84°C, about 85°C, about 86°C, about 87°C, about 88°C, about 89°C, about 90°C, about 91°C, about 92°C, about 93°C, about 94°C, about 95°C, about 96°C, about 97°C, about 98°C, about 99°C, or higher. Furthermore, the amplicon can have a complete denaturation temperature falling within a range formed by any of the foregoing reference values ​​(e.g., but not limited to, the range from about 85°C to about 95°C, the range from about 85°C to about 92°C, etc.). Non-limiting examples of amplicon lengths that can be utilized according to this disclosure include, but are not limited to, lengths less than or equal to about 300 bp, less than or equal to about 290 bp, less than or equal to about 280 bp, less than or equal to about 270 bp, less than or equal to about 260 bp, less than or equal to about 250 bp, less than or equal to about 240 bp, less than or equal to about 230 bp, less than or equal to about 220 bp, less than or equal to about 210 bp, less than or equal to about 200 bp, less than or equal to about 195 bp, less than or equal to about 190 bp, less than or equal to about 185 bp, less than or equal to about 180 bp, less than or equal to about 175 bp, less than or equal to about 170 bp, less than or equal to about 165 bp, less than or equal to about 160 bp, less than or equal to about 155 bp, less than or equal to about 150 bp, less than or equal to about 145 bp, less than or equal to about 140 bp, and less than or equal to about 140 bp. bp, less than or equal to about 135 bp, less than or equal to about 130 bp, less than or equal to about 125 bp, less than or equal to about 120 bp, less than or equal to about 115 bp, less than or equal to about 110 bp, less than or equal to about 105 bp, less than or equal to about 100 bp or lower.

[0033] Hybridization stabilizers of any type known in the art or otherwise conceived herein may be utilized according to this disclosure. In some non-limiting embodiments, the hybridization stabilizer is contained in a tail at the 5' end of at least one of the primers, wherein the tail contains a sequence that is not complementary to the target nucleic acid. In one specific (but non-limiting) embodiment, the tail contains a sequence of G and / or C residues that are not complementary to the target nucleic acid. For example (but not limiting), the tail may contain a GC-rich tail of about 2 residues, about 3 residues, about 4 residues, about 5 residues, about 6 residues, about 7 residues, about 8 residues, about 9 residues, about 10 residues, about 11 residues, about 12 residues, about 13 residues, about 14 residues, about 15 residues, about 16 residues, about 17 residues, about 18 residues, about 19 residues, about 20 residues or more, and ranges between two of these values ​​(such as, but not limited to, a range of about 3 to about 6 residues). Furthermore, the GC-rich tail may contain only G and C residues, or the GC-rich tail may have a higher GC content than the remainder of the primer.

[0034] In another non-limiting embodiment, the hybridization stabilizer comprises at least one modified nucleotide present in at least one of the amplification primers. Any type of modified nucleotide known in the art that can function as a hybridization stabilizer can be utilized according to this disclosure. Non-limiting examples of chemically modified nucleotides that can be used as hybridization stabilizers include C5-propynyl-dC (pdC), C5-propynyl-dU (pdU), and / or locked nucleic acids (LNAs). For the use of pdU in probes, see, for example, U.S. Patent No. 8,198,423.

[0035] In addition to the different initiation and proliferation cycles present in the methods of this disclosure, multiple amplification cycles may also include a single activation cycle performed prior to the start of the first initiation cycle. The activation cycle includes a single hold step at a given temperature for an initial time period. The temperature of the activation cycle may be at least about 85°C, at least about 86°C, at least about 87°C, at least about 88°C, at least about 89°C, at least about 90°C, at least about 91°C, at least about 92°C, at least about 93°C, at least about 94°C, at least about 95°C, or higher, and this temperature may be held for at least about 15 seconds, at least about 30 seconds, at least about 45 seconds, at least about 1 minute, at least about 1.5 minutes, at least about 2 minutes, at least about 2.5 minutes, at least about 3 minutes, at least about 3.5 minutes, at least about 4 minutes, at least about 4.5 minutes, at least about 5 minutes, at least about 5.5 minutes, at least about 6 minutes, at least about 6.5 minutes, at least about 7 minutes, at least about 7.5 minutes, at least about 8 minutes, or longer. For example (but not limitingly), the activation cycle may include a single holding step of holding at a temperature greater than or equal to about 90°C for about 1 to about 5 minutes.

[0036] The thermal cycling profile of the initial cycle of the method disclosed herein may provide any temperature and time parameters, provided that the cycle functions according to the disclosure. For example, but not limitingly, the thermal cycling profile of at least one initial cycle may include about 80°C, about 81°C, about 82°C, about 83°C, about 84°C, about 85°C, about 86°C, about 87°C, about 88°C, about 89°C, about 90°C, about 91°C, about 92°C, about 93°C, about 94°C, about 95°C, about 96°C, about 97°C, about 98°C, about 99°C, about 100°C or higher, and a range of denaturation temperatures formed by any of the foregoing values ​​(such as, but not limited to, a range of about 90°C to about 100°C). Furthermore, the temperature can be maintained for approximately 1 second, approximately 2 seconds, approximately 3 seconds, approximately 4 seconds, approximately 5 seconds, approximately 6 seconds, approximately 7 seconds, approximately 8 seconds, approximately 9 seconds, approximately 10 seconds, approximately 11 seconds, approximately 12 seconds, approximately 13 seconds, approximately 14 seconds, approximately 15 seconds, approximately 16 seconds, approximately 17 seconds, approximately 18 seconds, approximately 19 seconds, approximately 20 seconds or more, as well as ranges formed by any of the above values ​​(such as, but not limited to, the range from approximately 2 to approximately 15 seconds). Similarly, the thermal cycling profile of at least one initial cycle may have a temperature range of about 50°C, about 51°C, about 52°C, about 53°C, about 54°C, about 55°C, about 56°C, about 57°C, about 58°C, about 59°C, about 60°C, about 61°C, about 62°C, about 63°C, about 64°C, about 65°C, about 66°C, about 67°C, about 68°C, about 69°C, about 70°C or higher, and an extended temperature range formed by any of the above values ​​(such as, but not limited to, the range from about 55°C to about 65°C). Furthermore, this temperature can be maintained for approximately 1 second, approximately 2 seconds, approximately 3 seconds, approximately 4 seconds, approximately 5 seconds, approximately 6 seconds, approximately 7 seconds, approximately 8 seconds, approximately 9 seconds, approximately 10 seconds, approximately 11 seconds, approximately 12 seconds, approximately 13 seconds, approximately 14 seconds, approximately 15 seconds, approximately 16 seconds, approximately 17 seconds, approximately 18 seconds, approximately 19 seconds, approximately 20 seconds, approximately 21 seconds, approximately 22 seconds, approximately 23 seconds, approximately 24 seconds, approximately 25 seconds, approximately 26 seconds, approximately 27 seconds, approximately 28 seconds, approximately 29 seconds, approximately 30 seconds, approximately 31 seconds, approximately 32 seconds, approximately 33 seconds, approximately 34 seconds, approximately 35 seconds, approximately 36 seconds, approximately 37 seconds, approximately 38 seconds, approximately 39 seconds, approximately 40 seconds or higher, and a range formed by any of the above values ​​(such as, but not limited to, a range from approximately 15 to approximately 30 seconds). Furthermore, the initial cycle can be repeated as many times as required to obtain the desired amplicon amplification level. For example, but not limited to, the method may include about 1 starting loop, about 2 starting loops, about 3 starting loops, about 4 starting loops, about 5 starting loops, about 6 starting loops, about 7 starting loops, about 8 starting loops, about 9 starting loops, about 10 starting loops, about 11 starting loops, about 12 starting loops, about 13 starting loops, about 14 starting loops, about 15 starting loops or more, and ranges formed by any of the above values ​​(such as, but not limited to, a range of about 3 to about 10 starting loops).

[0037] One of the optimization goals of the PCR method disclosed herein is to minimize the difference between the denaturation and extension temperatures of the proliferation cycle in order to increase the speed of assays while maintaining the sensitivity and specificity of the assays. For example, but not limitingly, the denaturation and extension temperatures in the at least one proliferation cycle differ from each other by about 35°C or less, about 34°C or less, about 33°C or less, about 32°C or less, about 31°C or less, about 30°C or less, about 29°C or less, about 28°C or less, about 27°C or less, about 26°C or less, about 25°C or less, about 24°C or less, about 23°C or less, about 22°C or less, about 21°C or less, about 20°C or less, about 19°C or less, about 18°C ​​or less, about 17°C or less, about 16°C or less, about 15°C or less, about 14°C or less, about 13°C or less, about 12°C or less, about 11°C or less, about 10°C or less or lower.

[0038] The thermal cycling profile of the proliferation cycle of the method disclosed herein may provide any temperature and time parameters, provided that the cycle functions in accordance with the disclosure. For example, but not limitingly, the thermal cycling profile of at least one proliferation cycle may include about 80°C, about 81°C, about 82°C, about 83°C, about 84°C, about 85°C, about 86°C, about 87°C, about 88°C, about 89°C, about 90°C, about 91°C, about 92°C, about 93°C, about 94°C, about 95°C, about 96°C, about 97°C, about 98°C, about 99°C, about 100°C or higher, and a denaturation temperature range formed by any of the foregoing values ​​(such as, but not limited to, a range from about 80°C to about 95°C, a range from about 85°C to about 95°C, etc.). In addition, the temperature can be maintained for about 1 second, about 2 seconds, about 3 seconds, about 4 seconds, about 5 seconds, about 6 seconds, about 7 seconds, about 8 seconds, about 9 seconds, about 10 seconds, about 11 seconds, about 12 seconds, about 13 seconds, about 14 seconds, about 15 seconds or more, as well as ranges formed by any of the above values ​​(such as, but not limited to, the range from about 1 to about 5 seconds). Similarly, the thermal cycling profile of at least one breeding cycle may have a temperature range of about 55°C, about 56°C, about 57°C, about 58°C, about 59°C, about 60°C, about 61°C, about 62°C, about 63°C, about 64°C, about 65°C, about 66°C, about 67°C, about 68°C, about 69°C, about 70°C, about 71°C, about 72°C, about 73°C, about 74°C, about 75°C, about 76°C, about 77°C, about 78°C, about 79°C, about 80°C or higher, and an extended temperature range formed by any of the above values ​​(such as, but not limited to, the range from about 60°C to about 75°C). Furthermore, this temperature can be maintained for approximately 1 second, approximately 2 seconds, approximately 3 seconds, approximately 4 seconds, approximately 5 seconds, approximately 6 seconds, approximately 7 seconds, approximately 8 seconds, approximately 9 seconds, approximately 10 seconds, approximately 11 seconds, approximately 12 seconds, approximately 13 seconds, approximately 14 seconds, approximately 15 seconds, approximately 16 seconds, approximately 17 seconds, approximately 18 seconds, approximately 19 seconds, approximately 20 seconds or higher, and ranges formed by any of the above values ​​(such as, but not limited to, a range from approximately 1 to approximately 15 seconds, a range from approximately 5 to approximately 10 seconds, etc.). Furthermore, the proliferation cycle can be repeated as many times as required to obtain the desired amplicon amplification level.For example, but not limitingly, the method may include approximately 10 proliferation cycles, approximately 15 proliferation cycles, approximately 20 proliferation cycles, approximately 25 proliferation cycles, approximately 26 proliferation cycles, approximately 27 proliferation cycles, approximately 28 proliferation cycles, approximately 29 proliferation cycles, approximately 30 proliferation cycles, approximately 31 proliferation cycles, approximately 32 proliferation cycles, approximately 33 proliferation cycles, approximately 34 proliferation cycles, approximately 35 proliferation cycles, approximately 36 proliferation cycles, approximately 37 proliferation cycles, and approximately 38 proliferation cycles. The number of cycles is approximately 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more, and ranges formed by any of the above values ​​(such as, but not limited to, a range of approximately 30 to approximately 45 initial cycles, a range of approximately 33 to approximately 40 proliferation cycles, etc.).

[0039] In some non-limiting embodiments, at least one primer used in the reaction comprises a detectable marker. Any detectable marker known in the art for PCR assays may be used according to this disclosure. In one non-limiting embodiment, the detectable marker is a fluorescent marker.

[0040] In some non-limiting embodiments, the entire amplification reaction (including all activation, initiation, and proliferation cycles) is carried out in less than about 25 minutes, such as (but not limited to) less than about 24 minutes, less than about 23 minutes, less than about 22 minutes, less than about 21 minutes, less than about 20 minutes, less than about 19 minutes, less than about 18 minutes, less than about 17 minutes, less than about 16 minutes, less than about 15 minutes, less than about 14 minutes or less, and any range between two of the above values ​​(i.e., the range from about 15 minutes to about 20 minutes, etc.).

[0041] Certain non-limiting embodiments of this disclosure relate to methods for detecting target nucleic acids in biological samples. The methods include either step (i) or (ii) described above, and step (iii) detecting the presence of amplified target nucleic acids using a probe.

[0042] In some non-limiting embodiments, the probe comprises at least one modified nucleotide. Any type of modified nucleotide known in the art that can function as a hybridization stabilizer may be utilized according to this disclosure. Non-limiting examples of chemically modified nucleotides that may be included in the probe include C5-propynyl-dC (pdC), C5-propynyl-dU (pdU), and / or locked nucleic acids (LNAs). Alternatively (and / or additionally), the probe may include at least one minor groove binding (MGB) moiety at its 3' end.

[0043] Certain non-limiting embodiments of this disclosure relate to a reaction mixture for performing a polymerase chain reaction (and particularly, but not limited to, any method described herein or otherwise considered) on a biological sample suspected of containing a target nucleic acid. The reaction mixture comprises at least one thermostable polymerase (which may be any thermostable polymerase well known in the art or described herein or otherwise considered); a nucleotide; and a pair of primers configured to amplify the target nucleic acid. At least one of the primers contains any hybridization stabilizer described herein or otherwise considered. In an optional embodiment, the reaction mixture may further contain at least one of any probes described herein or otherwise considered.

[0044] For example (but not limiting), the hybridization stabilizer may be contained in the 5' tail of at least one of the primers, wherein the tail contains a sequence that is not complementary to the target nucleic acid. In a specific (but not limiting) embodiment, the tail contains a sequence of G and / or C residues that are not complementary to the target nucleic acid. For example (but not limiting), the tail may contain a GC-rich tail of about 2 residues, about 3 residues, about 4 residues, about 5 residues, about 6 residues, about 7 residues, about 8 residues, about 9 residues, about 10 residues, about 11 residues, about 12 residues, about 13 residues, about 14 residues, about 15 residues, about 16 residues, about 17 residues, about 18 residues, about 19 residues, about 20 residues or more, and a range between two of these values ​​(such as, but not limited to, a range of about 3 to about 6 residues). Furthermore, the GC-rich tail may contain only G and C residues, or the GC-rich tail may have a higher GC content than the remainder of the primer.

[0045] In another non-limiting embodiment, the hybridization stabilizer comprises at least one modified nucleotide present in at least one of the amplification primers. Any type of modified nucleotide known in the art that can function as a hybridization stabilizer can be utilized according to this disclosure. Non-limiting examples of chemically modified nucleotides that can be used as hybridization stabilizers include C5-propynyl-dC (pdC), C5-propynyl-dU (pdU), and / or locked nucleic acids (LNAs). For the use of pdU in probes, see, for example, U.S. Patent No. 8,198,423.

[0046] In some non-limiting embodiments, at least one primer present in the reaction mixture comprises a detectable marker. Any detectable marker known in the art for PCR assays may be used according to this disclosure. In one non-limiting embodiment, the detectable marker is a fluorescent marker.

[0047] The amplicon containing the target nucleic acid can have any denaturation temperature and any length, provided that the amplicon can be generated by the methods disclosed herein. For example (but not limitingly), the amplicon can have a complete denaturation temperature of about 80°C, about 81°C, about 82°C, about 83°C, about 84°C, about 85°C, about 86°C, about 87°C, about 88°C, about 89°C, about 90°C, about 91°C, about 92°C, about 93°C, about 94°C, about 95°C, about 96°C, about 97°C, about 98°C, about 99°C, or higher. Furthermore, the amplicon can have a complete denaturation temperature falling within a range formed by any of the foregoing reference values ​​(such as, but not limited to, the range from about 85°C to about 95°C, the range from about 85°C to about 92°C, etc.). Non-limiting examples of amplicon length include, but are not limited to, less than or equal to about 300 bp, less than or equal to about 290 bp, less than or equal to about 280 bp, less than or equal to about 270 bp, less than or equal to about 260 bp, less than or equal to about 250 bp, less than or equal to about 240 bp, less than or equal to about 230 bp, less than or equal to about 220 bp, less than or equal to about 210 bp, less than or equal to about 200 bp, less than or equal to about 195 bp, less than or equal to about 190 bp, less than or equal to about 185 bp, less than or equal to about 180 bp, less than or equal to about 175 bp, less than or equal to about 170 bp, less than or equal to about 165 bp, less than or equal to about 160 bp, less than or equal to about 155 bp, less than or equal to about 150 bp, less than or equal to about 145 bp, less than or equal to about 140 bp, less than or equal to about 135 bp, and less than or equal to about 140 bp. bp, less than or equal to about 130 bp, less than or equal to about 125 bp, less than or equal to about 120 bp, less than or equal to about 115 bp, less than or equal to about 110 bp, less than or equal to about 105 bp, less than or equal to about 100 bp or lower.

[0048] In some non-limiting embodiments, the probe may, when present, contain at least one modified nucleotide. Any type of modified nucleotide known in the art that can function as a hybridization stabilizer may be utilized according to this disclosure. Non-limiting examples of chemically modified nucleotides that may be included in the probe include C5-propynyl-dC (pdC), C5-propynyl-dU (pdU), and / or locked nucleic acids (LNAs). Alternatively (and / or additionally), in some non-limiting embodiments, the probe may contain at least one minor groove binding (MGB) moiety at its 3' end.

[0049] In summary, this application relates to the following technical solutions: 1. A method for amplifying target nucleic acids in biological samples, the method comprising the following steps: (i) Adding a thermostable polymerase, nucleotides, and a pair of primers configured to amplify the target nucleic acid to the biological sample to produce an amplification mixture, wherein at least one of the primers contains a hybridization stabilizer; and (ii) The target nucleic acid is amplified by polymerase chain reaction by thermally cycling the amplification mixture between at least a denaturation temperature and an extension temperature via multiple amplification cycles, wherein the multiple amplification cycles include at least one initiation cycle and at least one proliferation cycle, and wherein the thermal cycling profile of the initiation cycle is different from that of the proliferation cycle. 2. The method of Project 1, wherein the thermal cycling profiles of the initiation cycle and the proliferation cycle differ from each other in that at least one of the denaturation temperature, denaturation duration, extension temperature, extension duration, slack rate, and cycle completion time. 3. The method of Project 1, wherein the amplicon has a complete denaturation temperature in the range of about 85°C to about 95°C. 4. The method of Project 1, wherein the amplicon has a length of less than or equal to about 100 bp. 5. The method of Project 1, wherein the hybridization stabilizer is contained in the tail of the 5' end of the primer, wherein the tail contains a sequence that is not complementary to the target nucleic acid. 6. The method of Project 1, wherein the hybridization stabilizer is contained in the tail at the 5' end of the primer, wherein the tail contains a sequence of G and / or C residues that are not complementary to the target nucleic acid. 7. The method of Project 1, wherein the hybridization stabilizer comprises at least one modified nucleotide present in the primer. 8. The method of Item 7, wherein the at least one modified nucleotide is C5-propynyl-dC (pdC) or C5-propynyl-dU (pdU). 9. The method of Item 7, wherein the at least one modified nucleotide is a locked nucleic acid (LNA). 10. The method of Project 1, wherein the plurality of amplification cycles further comprises a single activation cycle prior to the start cycle, wherein the activation cycle comprises a single hold step of holding at a temperature of at least about 90°C for about 1 to about 5 minutes. 11. The method of Project 1, wherein the target nucleic acid is RNA, and wherein the method comprises exposing the biological sample to reverse transcriptase prior to step (ii) to generate cDNA from the RNA target nucleic acid. 12. The method of Item 1, wherein the thermal cycling profile of the at least one initial cycle comprises a denaturation temperature in the range of about 90°C to about 100°C for about 2 to about 15 seconds, and an extended temperature in the range of about 55°C to about 65°C for about 15 to about 30 seconds. 13. The method of Item 12, wherein step (ii) comprises approximately 3 to approximately 10 initial loops. 14. The method of Project 1, wherein the denaturation and extension temperatures in the at least one proliferation cycle differ from each other by about 20°C or less. 15. The method of Item 1, wherein the thermal cycling profile of the at least one proliferation cycle comprises a denaturation temperature in the range of about 80°C to about 95°C for about 1 to about 5 seconds, and an extended temperature in the range of about 60°C to about 75°C for about 1 to about 15 seconds. 16. The method of Item 15, wherein step (ii) comprises about 30 to about 45 proliferation cycles. 17. The method of Project 1, wherein step (ii) is performed in less than approximately 20 minutes. 18. The method of Project 1, wherein step (ii) is performed in less than approximately 15 minutes. 19. A method for detecting target nucleic acids in biological samples, comprising the following steps: (i) Adding a thermostable polymerase, nucleotides and a pair of primers configured to amplify the target nucleic acid to the biological sample to produce an amplification mixture, wherein at least one of the primers contains a hybridization stabilizer; (ii) The target nucleic acid is amplified by polymerase chain reaction, by thermally cycling the amplification mixture through multiple amplification cycles between at least a denaturation temperature and an extension temperature, wherein the multiple amplification cycles include at least one initiation cycle and at least one proliferation cycle, and wherein the thermal cycling profile of the initiation cycle differs from that of the proliferation cycle; and (iii) Use probes to detect the presence of the amplified target nucleic acid. 20. The method of Item 19, wherein the probe comprises at least one modified nucleotide. 21. The method of Item 20, wherein the at least one modified nucleotide is C5-propynyl-dC (pdC) or C5-propynyl-dU (pdU). 22. The method of Item 20, wherein the at least one modified nucleotide is a locked nucleic acid (LNA). 23. The method of Item 19, wherein the probe comprises at least one small groove binding (MGB) portion at its 3' end. 24. A reaction mixture for performing a polymerase chain reaction on a biological sample suspected of containing a target nucleic acid, the reaction mixture comprising: a thermostable polymerase; a nucleotide; and a pair of primers configured to amplify the target nucleic acid, wherein at least one of the primers comprises a hybridization stabilizer. 25. The reaction mixture of item 24, wherein the hybridization stabilizer is contained in the tail of the 5' end of the primer, wherein the tail contains a sequence that is not complementary to the target nucleic acid. 26. The reaction mixture of item 24, wherein the hybridization stabilizer is contained in the tail of the 5' end of the primer, wherein the tail contains a sequence of G and / or C residues that are not complementary to the target nucleic acid. 27. The reaction mixture of item 24, wherein the hybridization stabilizer comprises at least one modified nucleotide present in the primer. 28. The reaction mixture of item 27, wherein the at least one modified nucleotide is C5-propynyl-dC (pdC) or C5-propynyl-dU (pdU). 29. The reaction mixture of item 27, wherein the at least one modified nucleotide is a locked nucleic acid (LNA). 30. The reaction mixture of item 24, wherein the amplicon of the target nucleic acid has a complete denaturation temperature in the range of about 85°C to about 95°C. 31. The method of item 1 or 2, wherein the amplicon has a complete denaturation temperature in the range of about 85°C to about 95°C. 32. The method of any one of items 1-3, wherein the amplicon has a length of less than or equal to about 100 bp. 33. The method of any one of items 1-4, wherein the hybridization stabilizer is contained in the tail of the 5' end of the primer, wherein the tail contains a sequence that is not complementary to the target nucleic acid. 34. The method of any one of items 1-5, wherein the hybridization stabilizer is contained in the tail of the 5' end of the primer, wherein the tail contains a sequence of G and / or C residues that are not complementary to the target nucleic acid. 35. The method of any one of items 1-4, wherein the hybridization stabilizer comprises at least one modified nucleotide present in the primer. 36. The method of Item 35, wherein the at least one modified nucleotide is C5-propynyl-dC (pdC) or C5-propynyl-dU (pdU). 37. The method of item 35, wherein the at least one modified nucleotide is a locked nucleic acid (LNA). 38. The method of any one of items 1-9, wherein the plurality of amplification cycles further comprises a single activation cycle prior to the start cycle, wherein the activation cycle comprises a single hold step of holding at a temperature of at least about 90°C for about 1 to about 5 minutes. 39. The method of any one of items 1-10, wherein the target nucleic acid is RNA, and wherein the method comprises exposing the biological sample to reverse transcriptase prior to step (ii) to generate cDNA from the RNA target nucleic acid. 40. The method of any one of items 1-11, wherein the thermal cycling profile of the at least one initial cycle comprises a denaturation temperature in the range of about 90°C to about 100°C held for about 2 to about 15 seconds, and an extended temperature in the range of about 55°C to about 65°C held for about 15 to about 30 seconds. 41. The method of Item 40, wherein step (ii) comprises approximately 3 to approximately 10 initial loops. 42. The method of any one of items 1-13, wherein the denaturation and extension temperatures in the at least one proliferation cycle differ from each other by about 20°C or less. 43. The method of any one of items 1-14, wherein the thermal cycling profile of the at least one proliferation cycle includes a denaturation temperature in the range of about 80°C to about 95°C for about 1 to about 5 seconds, and an extended temperature in the range of about 60°C to about 75°C for about 1 to about 15 seconds. 44. The method of Item 43, wherein step (ii) comprises about 30 to about 45 proliferation cycles. 45. The method of any one of items 1-16, wherein step (ii) is performed in less than about 20 minutes. 46. ​​The method of any one of items 1-17, wherein step (ii) is performed in less than about 15 minutes. 47. A reaction mixture comprising any one of items 24-29, wherein the amplicon of the target nucleic acid has a complete denaturation temperature in the range of about 85°C to about 95°C. Attached Figure Description

[0050] Figure 1 The construction of PCR primers and probes containing hybridization stabilizers according to this disclosure is illustrated by example.

[0051] Figure 2 Amplification diagram of PCR reactions using standard primers and primers with GC-tails, via a denaturing temperature gradient.

[0052] Figure 3Evaluation of Ct and dRn in PCR reactions using standard and GC-tailed primers, conducted at denaturing temperature gradients. The term "Ct" refers to the number of PCR cycles that reached the fluorescence threshold level, while the term "dRn" refers to the fluorescence reading normalized to a reference dye and subtracted from the baseline.

[0053] Figure 4 Examples of a PCR thermal cycling profile constructed according to this disclosure are included.

[0054] Figure 5 Includes melting curves used to determine the complete denaturation temperature of various HBV and HCV amplicones.

[0055] Figure 6 Amplification graphs of PCR reactions using standard and GC-tailed primers, annealed / amplified at temperature gradients and for different durations.

[0056] Figure 7 Evaluation of Ct and dRn in PCR reactions using standard and GC-tailed primers, annealed / amplified at temperature gradients and for different durations.

[0057] Figure 8 Amplification diagrams of PCR reactions using standard and GC-tailed primers under six different thermal cycling profiles.

[0058] Figure 9 Evaluation of Ct and dRn in PCR reactions using standard and GC-tailed primers under six different thermal cycling profiles. Detailed Implementation

[0059] Examples are provided below. However, it should be understood that the application of this disclosure is not limited to the specific experiments, results, and laboratory procedures disclosed herein. Rather, the examples are provided only as one of various implementations and are intended to be exemplary, not exhaustive.

[0060] Example 1: Overview of Sculpted PCR Utilization in Rapid PCR Typical PCR methods have an "overall profile," where all PCR cycles are identical (i.e., using the same time, the same temperature, and the same slope rate). No thermal profile is adjusted during the PCR process to match the changing nucleic acid types and concentrations. Therefore, the overall PCR profile is a trade-off between the needs and characteristics of each stage of PCR. Due to the lack of thermal profile adjustment, these PCR methods exhibit longer processing times and lower sensitivity than ultimately expected.

[0061] In contrast, the term "sculpted PCR profile" is coined herein to describe the PCR methods disclosed herein or otherwise considered. Sculpting methods allow modification of the thermal cycling profile to match the nucleic acid type and concentration at each stage of the PCR reaction. Thus, different time and temperature protocols are utilized during the PCR reaction. The sculpted PCR profile of this disclosure allows for individual optimization of different stages of the PCR reaction to provide the desired characteristics at each stage. Due to the ability to tune individual stages, the methods disclosed herein offer higher speed, higher specificity, and higher sensitivity than prior art methods.

[0062] A non-limiting implementation scheme for adjusting the PCR stage for rapid PCR conditions includes the following.

[0063] PCR amplification has at least two stages, and each of these stages is adjusted.

[0064] The first stage is initiation, which includes denaturation of the target genomic DNA, primer binding, and extension on the template. The initiation stage involves high-temperature denaturation (e.g., but not limited to 95°C for five (5) seconds), followed by low-temperature primer binding (e.g., but not limited to about 60°C) with a long extension time (e.g., but not limited to about 20 seconds). This stage involves repeating the high-temperature denaturation and low-temperature primer binding steps for about five (5) to about seven (7) cycles.

[0065] The second stage is proliferation, which involves efficient exponential amplification of the double-stranded amplicon, with probe degradation and detection occurring in later cycles. In this step, the difference between the denaturation and extension temperatures is minimized (e.g., but not limited to, a difference of about 20°C or less), so that the total cycle time can also be minimized. For example (but not limitingly), the denaturation temperature is determined by the Ta of the amplicon. 变性 Driven, where target T 变性 Within the range of approximately 85°C to approximately 90°C, with a target duration of approximately 2 seconds at this temperature; a high elongation temperature (T) is desired. 延伸 The target temperature is approximately 70°C, and the short extension time is approximately 10 seconds. 延伸 The optimization also utilizes the optimal extension rate of the polymerase (which is typically at around 70°C, 10°C higher than the temperature at which most PCRs are performed). This proliferation phase consists of approximately 40 cycles of repeated denaturation and extension steps.

[0066] Other optional steps may be performed prior to the initiation phase. For example (but not limitingly), an optional phase that may be performed prior to the initiation phase is the activation of the hot-start polymerase, which includes hot-start and the conversion of the inactive polymerase to its active form. This phase typically lasts from about one (1) to about five (5) minutes, is performed at about 90°C or above, and is a single event / cycle. This phase also includes antibody denaturation, aptamer disintegration, and / or removal of anhydride derivatives. If the polymerase used does not require the hot-start component, this optional activation phase may be omitted.

[0067] Another optional stage that can be performed before the initiation stage is a reverse transcription step. This step is required if the nucleic acid target is RNA rather than DNA, and therefore needs to be reverse transcribed into cDNA to provide a double-stranded target molecule for amplification in subsequent PCR reactions. The reverse transcription step involves the use of reverse transcriptase and is well known in the art; therefore, it is not considered necessary to describe it further.

[0068] To achieve the desired higher speed, specificity, and sensitivity for the methods of this disclosure, PCR profile optimization has several objectives. First, it should utilize the lowest possible T... 变性 and as high a T as possible 延伸 To minimize T during the proliferation phase 变性 and T 延伸 The temperature difference between them. Second, T should be minimized as much as possible. 变性 The time should be optimized to ideally provide only transient denaturation while still ensuring the entire PCR volume is adequately heated. Third, the Tg time should be minimized. 延伸 The time required for this reduction will ultimately be limited by the readout time of the fluorescence detection channel. Finally, a sufficiently high ramp rate is needed to ensure rapid temperature transitions; however, a sufficiently high ramp rate still needs to be below the maximum ramp rate to extend system life and improve system reliability and measurement consistency.

[0069] Example 2: Design of modified PCR primers for rapid PCR The rapid PCR method disclosed herein includes the use of two unique features: the use of multiple thermal cycling profiles already adjusted based on the amplicon (as discussed in Example 1 above), and the use of a hybridization stabilizer. Two non-limiting embodiments of the hybridization stabilizer that can be used according to this disclosure are described in this example—primers containing GC-rich tails and probes containing chemically modified nucleotides.

[0070] In this embodiment, a short 103 bp amplicon and a standard PCR primer sequence for initiation are used; however, each PCR primer includes a 5' non-complementary GC-rich tail to improve TL during the proliferation phase of the PCR reaction. m From Table 1 and Figure 1 As can be seen, adding a GC-rich tail to the 5' end of each primer makes T m The temperature increased by 9-11℃, reaching 71-75℃.

[0071] Similarly, this method also utilizes chemically modified detection probes. The term "BHQ+" stands for Enhanced Black Hole Quencher Probe (Biosearch Technologies, Novato, CA), and refers to the combination of chemically modified C and T residues (i.e., pdU and pdC modified nucleotides) used in the method of oligonucleotide synthesis in conjunction with the Biosearch BHQ quencher dye used for the probe; the BHQ+ probe synthesis modifies C to pdC and provides stability of 1°C per residue, while the BHQ+ probe synthesis modifies T to pdU and provides stability of 0.5°C per residue. As shown in Table 1, the BHQ+ detection probe comprises 9 pdU and 8 pdC, and therefore, the presence of modified bases enhances the stability of the probe's T... m Increase by 12.5°C to 75.5°C.

[0072] Table 1 Primer sequences (with GC-rich tails underlined) SEQ ID NO: Modification length <![CDATA[Core T m > <![CDATA[Modified T m > <![CDATA[ GCGCC TGGATGTGTCTGCGGCGTTTTATCAT]]> 1 5' GC-rich tail 26 66℃ 75℃ <![CDATA[ GGCGG GACAAACGGGGCAACATACCTT]]> 2 5' GC-rich tail 21 60℃ 71℃ ATCCTGCTGCTATGCCTCATCTT 3 9 pdU and 8 pdC 23 63℃ 75.5℃

[0073] Example 3: Optimization of denaturation temperature for rapid PCR Two different types of denaturation are required in rapid PCR reactions: (1) denaturation of the target DNA, allowing the initial primer to extend; and (2) denaturation of the amplicons during the proliferation phase. When selecting amplicons with low Tg... 变性 At the end of the slant phase, a temperature overshoot is allowed. This temperature overshoot ensures complete denaturation within a short time, as well as rapid and efficient amplification and detection. The temperature overshoot also ensures temperature uniformity within the PCR volume without causing irreversible thermal denaturation of the polymerase and allows for individual heating surfaces—thus requiring simpler, less expensive instruments. Furthermore, using a lower temperature overshoot reduces bubble formation and thus improves consistency.

[0074] For example, the HBV amplicon of SEQ ID NO:4 has a length of 216 bp and a T0 of 92°C. 变性 When the amplicon is truncated to the sequence of SEQ ID NO:5, the 82 bp sequence now has a T0 of 88°C. 变性 Then, primers and BHQ+ probes with GC-rich tails are generated as described in Example 2 above. These sequences are shown in Table 2. Note that in this specific (but not limiting) embodiment, the T of the BHQ+ probe... m It should be slightly higher than the primer.

[0075] Table 2 Primer sequences (with GC-rich tails underlined) SEQ ID NO: Modification length <![CDATA[Core T m > <![CDATA[Modified T m > <![CDATA[ GGCG AGACTCGTGGTGGACTTCTCTCA]]> 6 5' GC-rich tail 27 63℃ 69℃ <![CDATA[ GGC GGCATAGCAGCAGGATGCAGA]]> 7 5' GC-rich tail 24 64℃ 70℃ TCTGCGGCGTTTTATCATCTTCCTCTT 8 13 pdU and 7 pdC 27 63℃ 76.8℃ *The underlined part originates from the GC tail on the primer and is therefore not complementary to the HBV genome.

[0076] Therefore, there are methods for optimizing PCR profiles to take advantage of the capabilities of rapid PCR instruments. This optimized profile drives assay design features such as (but not limited to) amplicon length and primer and probe T. m This optimized profile then challenges the bioinformatics analysis of target sequences to define regions and sequences that meet the desired assay specificity and sensitivity and also support the assay design requirements of short amplicon assays.

[0077] Example 4: Optimization of denaturation temperature during the proliferation stage This embodiment relates to the application of the features described in the preceding embodiments. The objectives of this embodiment include: (1) developing a rapid PCR profile to allow sensitive and accurate DNA amplification within 20 minutes, and (2) designing a PCR profile that provides a sufficient safety margin to allow tolerance to assay and engineering variations without inducing unsustainable stress on the instrument.

[0078] To meet these objectives, and as described in detail below, the following steps are employed: (a) developing a two-stage PCR profile (i.e., initiation and proliferation phases) for DNA assays; (b) defining a minimum tolerable Tg. 变性 (c) Introduce primers with GC tails and BHQ+ probes to increase T during the proliferation phase and ensure effective amplicon denaturation for the shortest possible duration; m (d) Shorten the extension time while ensuring good signal generation; and (e) Validate linearity and detection limit (LoD) using the processed HBV target.

[0079] First, in order to optimize T 变性 Using temperature gradients to set the lowest possible T 变性 The desired outcome is to minimize T as much as possible. 变性 and T 退火 / 延伸 The difference between them. Using a denaturation temperature gradient of 83-95℃, optimal amplification was observed on the Fast QuantStudio 5 (Fast QS5) PCR system (ThermoFisher Scientific, Waltham, MA) with denaturation at 90℃ for 2 seconds followed by 70℃ for 10 seconds.

[0080] Profile optimization using a Fast QS5 instrument, HBV GC-tail primers, and denaturation temperature gradients involved the following experimental setup. HBV hybrid gBlock templates were utilized. Tests were performed at 10 consecutive dilutions. 41 copy / µL. PCR was run in a total reaction volume of 10 µL and included the following: 1 µL sample, FTD MMX (5x buffer and 25x ENZ4), and 500 nM primers HBV_FB_pm1_GC and HBV_FB_pm2_GC, and 100 nM probe HBV_FB_PR_FAM_BHQ+. A summary of the PCR used is shown in Table 3.

[0081] Table 3

[0082] The results observed at different denaturation temperatures are shown in Figure 2 The results showed that amplicons generated using standard primers had lower T values ​​than those generated using primers with GC tails. 变性 Furthermore, as the denaturation temperature increases, more templates with GC tails are denatured, resulting in the generation of more products. At 95°C, the performance of standard primers and GC-tailed primers is similar. Therefore, a set point of 90°C for denaturation is optimal for primers with GC tails.

[0083] In addition, such as Figure 3 As shown, when using denaturation temperatures of 88-95°C, the Ct values ​​of the standard primers and the primers with GC tails are similar; however, the fluorescence intensities are slightly different.

[0084] To help define the target T for each target amplification 变性 Measure the T values ​​of HCV and HBV amplicon lengths. 变性 In this experiment, HBV heterozygotes truncated to different lengths and HCV 5'UTR gBlock templates were used, along with the experimental determination of products generated using standard primers and GC tail primers. PCR was performed in a 20 µl total reaction volume with 1 µl of sample and a ThermoFisher 2X Power SYBR master mix and the primers outlined in Table 4. PCR overview is shown in [Table 4]. Figure 4 middle.

[0085] Table 4 template forward primer reverse primer HBV gBlock S_HBV_F FTD_HBV_R HBV STD HBV_FB_pm1_std FTD_HBV_R HBV GC HBV_FB_pm1_GC HBV_FB_pm2_GC HCV HCV_2.0_forward primer_1 HCV_Reverse Primer_1

[0086] Table 5 lists the various templates used and their T values. m and the complete denaturation temperature, while Figure 5 Displays various unlinking curves obtained using different templates.

[0087] Table 5

[0088] It can be seen that the T of the HBV amplicon in the 90 bp-227 bp range...变性 Relatively similar, with the range from 80℃ to 83℃ being only 3℃. HCV amplicon shows a wider T range. 变性 The range varies depending on the length (90 bp-280 bp, a range of 6°C from 82.5°C to 88°C) and is driven by higher GC content. These T 变性 This represents 50% denaturation; therefore, high-efficiency PCR requires higher temperatures to ensure complete denaturation. Therefore, it is recommended to measure the Ta of the target amplicon being measured. 变性 To define the minimum set point T for PCR profile 变性 .

[0089] Therefore, the above indicates that the GC content of the amplicon (HBV has a relatively normal GC content, while HCV has a high GC content) affects the assay performance.

[0090] Example 5: Optimization of Annealing / Amplification Temperature during the Proliferation Phase To optimize the annealing and amplification temperature gradients and durations, annealing / extension times of 5, 8, and 10 seconds were evaluated within the temperature range of 60°C–75°C, and compared with standard primers using the same probe and Fast QS5 instrument to primers with GC tails. The GC primers were found to function well at temperatures up to at least 75°C and for times as short as 5 seconds or even less. Minimizing the difference between the denaturation and annealing / extension temperatures (in this case, a 15°C difference between denaturation and annealing / extension temperatures: 90°C and 75°C, respectively) may have minimized the amount of time required to move between the two temperatures. In contrast, the standard primers failed to amplify or exhibited Ct delays at extension temperatures above 70°C. However, the fluorescence signal in the GC-tailed primers decreased slightly as the extension temperature increased to 72°C–75°C, suggesting that the thermal effects on fluorescence should be considered in certain cases.

[0091] The profile optimization of the annealing / amplification temperature gradient, using a Fast QS5 instrument and HBV GC tail primers, involved the same experimental setup as used to optimize the denaturation temperature, as described in Example 4 above. The PCR profile used is shown in Table 6.

[0092] Table 6

[0093] like Figure 6 As can be seen, primers with GC tails are feasible at higher annealing temperatures and shorter durations. In contrast, when the extension temperatures become 72°C and 75°C, standard primers fail to amplify or exhibit Ct delays. For example, as... Figure 7As shown, primers with GC tails produce similar Ct values ​​when extension temperatures are used in the range of 60°C–75°C. In contrast, standard primers fail to amplify or exhibit Ct delays when extension temperatures are increased to 72°C and 75°C. The fluorescence signal in the GC-tailed primers decreases slightly when the extension temperature is increased to 72°C–75°C, indicating that the thermal effect on fluorescence should be considered in certain situations.

[0094] Example 6: Optimization of Turnover Time In this embodiment, the turnaround time (TAT) of the various PCR profiles disclosed herein is compared with that of a standard overall rapid PCR reaction.

[0095] The experimental setup is as follows. HBV-hybrid gBlock templates were used. The test series was diluted 10⁻⁶ times. 6 1 copy / µl. PCR was run in a total reaction volume of 10 µl and included the following: 1 µl sample, FTD MMX (5x buffer and 25x ENZ4), and 500 nM primers (103 bp standard primers and 113 bp primers with GC tails HBV_FB_pm1_GC and HBV_FB_pm2_GC) and 100 nM probe HBV_FB_PR_FAM_BHQ+. Overviews of the various PCR methods used are shown in Table 7.

[0096] Table 7 step Overview #1 Overview #2 Overview #3 Overview #4 Overview #5 (Standard) Overview #6 Keep* 95°C / 1 minute 95°C / 1 minute 95°C / 1 minute 95°C / 1 minute 95°C / 1 minute 95°C / 1 minute Initial stage 5 cycles 5 cycles 5 cycles 5 cycles 40 cycles 5 cycles transsexual* 95°C / 10 seconds 95°C / 10 seconds 95°C / 10 seconds 95°C / 10 seconds 95°C / 3 seconds 95°C / 5 seconds Annealing / Amplification* 60°C / 20 seconds 60°C / 20 seconds 60°C / 20 seconds 60°C / 20 seconds 60°C / 30 seconds 60°C / 20 seconds Proliferation stage 35 cycles 35 cycles 34 loops 35 cycles 35 cycles transsexual* 95°C / 2 seconds 90°C / 2 seconds 90°C / 2 seconds 90°C / 2 seconds 90°C / 2 seconds Annealing / Amplification* 60°C / 10 seconds 72°C / 10 seconds 72°C / 10 seconds 72°C / 10 seconds 72°C / 8 seconds 1 loop 1 loop 90°C / 2 seconds 60°C / 10 seconds 60°C / 10 seconds Slope rate (4.82°C / s; 3.72°C / s) (4.82°C / s; 3.72°C / s) (4.82°C / s; 3.72°C / s) (4.82°C / s; 3.72°C / s) (4.82°C / s; 3.72°C / s) (4.82°C / s; 3.72°C / s) TAT 21 minutes and 26 seconds 16 minutes and 44 seconds 16 minutes and 49 seconds 16 minutes and 57 seconds 33 minutes and 56 seconds 15 minutes and 9 seconds *(Temperature / Time).

[0097] Figure 8-9 The results are shown from six different PCR profiles. The standard PCR profile is Profile 5; this profile consists of a single phase in which 40 identical cycles are performed. The standard PCR profile has a TAT of 33 minutes and 56 seconds. In contrast, Profiles 1-4 and 6 each consist of two phases (initiation and amplification phases), which differ in both denaturation temperature and time, and annealing / amplification temperature and time. Profiles 1-4 each use the same initiation phase (i.e., a denaturation step of 5 cycles at 95°C for 10 seconds, followed by an annealing / amplification step at 60°C for 20 seconds); Profile 6 is designed to be a “hot and fast” profile, and therefore has a similar initiation phase, except that the denaturation step time is reduced to 5 seconds.

[0098] Regarding the proliferation phases of profiles 1-4, profile #1 exhibited the largest gap between denaturation and annealing / amplification temperatures; this 35°C gap resulted in a peak TAT of 21 minutes and 26 seconds. When this gap between denaturation and annealing / amplification temperatures decreased to 18°C, the TAT decreased by almost 5 minutes (to 16 minutes and 44 seconds).

[0099] Profiles 3-4 were constructed to include a final readout step at 60°C to assess a slight decrease in fluorescence signal in primers with GC tails; data from these two profiles indicate that the slight decrease in fluorescence is a purely temperature effect and therefore solely due to thermal interference.

[0100] Finally, summary #6 was designed to demonstrate that the TAT of the methods disclosed herein could be further reduced to 15 minutes by running a “hot and fast” reaction, in which the time for the denaturation step in the initiation phase is halved and the annealing / amplification step in the proliferation phase is reduced from 10 seconds to 8 seconds.

[0101] Therefore, compositions and kits that fully satisfy the purposes and advantages described above, as well as methods of their production and use, have been provided according to this disclosure. Although this disclosure has been described in conjunction with the specific figures, experiments, results, and language set forth above, it will be apparent to those skilled in the art that many alternatives, modifications, and variations will be readily apparent. Therefore, it is intended to cover all such alternatives, modifications, and variations that fall within the spirit and broad scope of this disclosure.

Claims

1. A method of amplifying a target nucleic acid in a biological sample, the method comprising the steps of: (i) adding to the biological sample a thermostable polymerase, nucleotides, and a pair of primers configured for amplifying the target nucleic acid, to produce an amplification mixture, wherein at least one of the primers comprises a hybridization stabilizer; and (ii) amplifying the target nucleic acid by polymerase chain reaction by thermally cycling the amplification mixture between at least a denaturation temperature and an extension temperature through a plurality of amplification cycles, wherein the plurality of amplification cycles comprises at least one initiation cycle and at least one propagation cycle, and wherein the thermal cycling profile of the initiation cycle is different from the thermal cycling profile of the propagation cycle.

2. The method of claim 1, wherein the thermal cycling profiles of the initiation and propagation cycles differ from each other by at least one of the denaturation temperature, denaturation duration, the extension temperature, extension duration, ramp rate, and cycle completion time.

3. The method of claim 1, wherein the amplicon has a complete denaturation temperature in the range of about 85 °C to about 95 °C.

4. The method of claim 1, wherein the amplicon has a length of less than or equal to about 100 bp.

5. The method of claim 1, wherein the hybridization stabilizer comprises a tail at the 5' end of the primer, wherein the tail comprises a sequence that is not complementary to the target nucleic acid.

6. The method of claim 1, wherein the hybridization stabilizer comprises a tail at the 5' end of the primer, wherein the tail comprises a sequence of G and / or C residues that is not complementary to the target nucleic acid.

7. The method of claim 1, wherein the hybridization stabilizer comprises the presence of at least one modified nucleotide in the primer.

8. The method of claim 7, wherein the at least one modified nucleotide is C5-propynyl-dC (pdC) or C5-propynyl-dU (pdU).

9. The method of claim 7, wherein the at least one modified nucleotide is a locked nucleic acid (LNA).

10. The method of claim 1, wherein the plurality of amplification cycles further comprises a single activation cycle prior to beginning the initiation cycle, wherein the activation cycle comprises a single hold step at a temperature of at least about 90 °C for about 1 to about 5 minutes.

Images