SNP variation and CAPS marker significantly related to tomato SlGGP1 gene expression quantity, detection primer and kit thereof, and application of SNP variation and CAPS marker

Abstract

The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to SNP variation and CAPS markers significantly related to tomato SlGGP1 gene expression quantity, a detection primer and a kit thereof, and applications of the SNP variation and CAPS markers and the detection primer and the kit. The SNP variation is located at the 42843506th basic group of a No.6 chromosome of a tomato Heinz 1706 reference genome, the basic group at the site is G or A, and the version number of the reference genome is SL4.0. The SNP variation located in the intron of the SlGGP1 gene is closely related to the expression level of the SlGGP1 gene, the genotype of the SNP variation is highly consistent with the phenotype of the content of ascorbic acid, and the SNP variation is developed into a universal molecular marker for evaluating the content of ascorbic acid. The method can quickly predict the ascorbic acid content of related materials from the genotype level and assist in judging the stress resistance of plants, and provides a target and a molecular tool for more efficiently selecting and cultivating tomato varieties with high ascorbic acid content.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to SNP variants, CAPS markers, detection primers and kits, and applications that are significantly associated with the expression level of the tomato SlGGP1 gene. Background Technology

[0002] L-ascorbic acid (AsA), also known as vitamin C (Vc), is an essential antioxidant in the metabolism of both plants and animals. A deficiency of AsA in the human body can lead to scurvy and other diseases. Furthermore, AsA plays a crucial role in preventing various diseases, including cancer and aging. Many animals can synthesize AsA themselves, but humans and some other primates cannot synthesize AsA in their bodies due to the lack of L-gulonolactone oxidase, a key enzyme in the AsA synthesis pathway. Therefore, they must obtain AsA from food. Fresh fruits and vegetables are the primary source of AsA for the human body.

[0003] Tomato (Solanum lycopersicum) belongs to the Solanaceae family and the Solanum genus. As a common, highly nutritious, and valuable economic crop, tomatoes are widely cultivated worldwide. Tomatoes are rich in ascorbic acid (AsA), an important source of vitamins in the diet. AsA plays a crucial role in plant growth and development. AsA can regulate the activity of various cell wall-related enzymes and participate in cell wall remodeling, directly affecting plant morphogenesis and structural stability by regulating cell wall stiffness and strength. AsA also participates in regulating physiological processes such as seed germination, root development, flowering, and senescence. Decreasing AsA content in tomato roots, leaves, flowers, and fruits will lead to delayed flowering, reduced fruit quantity, and decreased yield. AsA levels generally determine the quality and shelf life of tomatoes; regulating AsA accumulation helps improve the nutritional quality of tomato fruits. In addition, ascorbic acid and its metabolically related enzymes play an important role in scavenging reactive oxygen species (ROS), thus also playing an important role in plant resistance to environmental stress. AsA can capture superoxide anions (O3). 2- Asamin (AsA) contains reactive oxygen species (ROS) such as hydroxyl radicals (H2O2), maintaining intracellular redox balance, ensuring normal plant physiology and metabolism, and protecting the organism from ROS damage. Under normal conditions, AsA exists in its reduced state, but under stress conditions, AsA can be oxidized to dehydroascorbic acid (DHA), enhancing the plant's antioxidant capacity and protecting it from oxidative damage. AsA also participates in various stress adaptation signal transduction pathways, including interactions with hormones and ROS, regulating the expression of stress-related genes, and enhancing the plant's survival ability under abiotic stress. Therefore, regulating the level of AsA in plants through genetic modification is of great significance for enhancing the plant's ability to resist abiotic stress and improving crop yield and quality.

[0004] Improving the activity of rate-limiting enzymes controlling the synthesis of specific metabolites through genetic engineering breeding techniques can increase the content of target products in transgenic plants, which has become a major development trend in improving important agronomic traits. Traditional breeding mainly relies on direct phenotypic selection, which suffers from problems such as long screening cycles and low breeding efficiency. With the rapid development of molecular biology, molecular marker-assisted breeding technology has been widely used due to its advantages of being unrestricted by time and geographical factors and having an accurate, rapid, and efficient selection process. However, to date, only a few ascorbic acid metabolism genes in tomatoes have been cloned and identified, and research on AsA synthesis and metabolism in tomatoes is still limited. The development and application of molecular markers closely related to the ascorbic acid trait in tomatoes are rarely reported. Therefore, the development and identification of genes and molecular markers related to AsA biosynthesis and metabolism are of great significance for increasing AsA content, enhancing the nutritional value of tomatoes, and improving plant stress resistance. Summary of the Invention

[0005] To address the problems of existing technologies, this invention provides a SNP variant located in an intron of the SlGGP1 gene, which is closely related to the expression level of the tomato SlGGP1 gene, and its genotype shows high consistency with the ascorbic acid content phenotype. This variant can be developed into a universal molecular marker for assessing the ascorbic acid content of tomato germplasm, enabling rapid prediction of ascorbic acid content in related materials at the genotype level and assisting in the assessment of plant stress resistance. This provides a target and molecular tool for more efficient selection and breeding of tomato varieties with high ascorbic acid content. Therefore, this invention provides the SNP variant, a CAPS marker containing the SNP variant, detection primers or kits for detecting the CAPS marker, and their application in the detection of tomato ascorbic acid content or in genetic breeding to improve tomato ascorbic acid content.

[0006] To achieve the above objectives, the present invention is specifically implemented through the following technical solutions:

[0007] The first aspect of the present invention provides an SNP variant that is significantly associated with the expression level of the tomato SlGGP1 gene. The SNP variant is located at the 42843506th base on chromosome 6 of the tomato Heinz 1706 reference genome, and the base at this site is G or A. The version number of the reference genome is SL4.0.

[0008] A second aspect of the present invention provides a CAPS marker that is significantly associated with the expression level of the tomato SlGGP1 gene, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein R represents G or A.

[0009] A third aspect of the present invention provides a detection primer for detecting the CAPS marker that is significantly associated with the expression level of the tomato SlGGP1 gene as described above. The detection primer includes an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO.2-3, respectively.

[0010] A fourth aspect of the present invention provides a kit comprising the detection primers described above.

[0011] Furthermore, the kit also includes an MboII restriction endonuclease.

[0012] Furthermore, the kit also includes PCR amplification reagents, which include DNA polymerase, dNTPs, and buffer.

[0013] The fifth aspect of this invention provides the application of the SNP variants significantly associated with the expression level of the tomato SlGGP1 gene as described above, the CAPS markers significantly associated with the expression level of the tomato SlGGP1 gene as described above, the detection primers as described above, or the kits as described above in the detection of tomato ascorbic acid content or in genetic breeding to increase tomato ascorbic acid content.

[0014] The sixth aspect of this invention provides a method for detecting ascorbic acid content in tomatoes, comprising the following steps:

[0015] S1. Using tomato genomic DNA as a template, PCR amplification was performed using the detection primers shown in SEQ ID NO.2-3 to obtain the amplification product;

[0016] S2. The amplification product is digested with MboII restriction endonuclease to obtain the digested product;

[0017] S3. Perform gel electrophoresis on the enzyme digestion products, and predict the ascorbic acid content of the tomato material to be tested based on the distribution of electrophoretic bands; wherein, when only a 266bp electrophoretic band appears, the ascorbic acid content of the tomato material to be tested is high; when two electrophoretic bands of 120bp and 146bp appear simultaneously, the ascorbic acid content of the tomato material to be tested is low.

[0018] Further, the PCR amplification reaction system includes: 15.6 μL ddH2O, 2.0 μL 10×PCR Buffer, 0.4 μL dNTPs, 0.2 μL Taq DNA polymerase, 0.4 μL upstream primer, 0.4 μL downstream primer, and 1.0 μL genomic DNA; wherein the concentrations of dNTPs, upstream primer, and downstream primer are 10-20 mM, and the concentration of genomic DNA is 80-150 ng / μL; the amplification program includes: 95.0℃ pre-denaturation for 3 min; 95.0℃ denaturation for 30 s, 54.0℃ annealing for 30 s, 72.0℃ extension for 30 s, for 35 cycles; and 72.0℃ extension for 5 min.

[0019] Further, the reaction system for the enzyme digestion treatment includes: 5 μL of amplification product, 12 μL of ddH2O, 2 μL of 10×Buffer Tango, and 1 μL of MboII; wherein the enzyme activity of the MboII restriction endonuclease is 1-10 U / μL; the reaction conditions include: enzyme digestion at 37℃ for 15 min, and inactivation at 65℃ for 5 min.

[0020] Furthermore, the gel electrophoresis is agarose gel electrophoresis, and the concentration of the agarose gel is 3%.

[0021] The advantages and positive effects of this invention are as follows:

[0022] 1. The SNP variants provided by this invention and the CAPS markers developed based on these SNP variants are closely related to the expression level of the SlGGP1 gene in tomato. The expression levels of the SlGGP1 gene corresponding to different genotypes are significantly different. It is less restricted by genetic materials and has wide applicability in natural populations. Given the strong positive correlation between SlGGP1 gene expression level and ascorbic acid content, the aforementioned SNP variants can serve as universal molecular markers for assessing the ascorbic acid synthesis capacity and content of tomato germplasm. The molecular marker genotypes show high consistency with the ascorbic acid content phenotypes, achieving an accuracy of over 79% in identifying tomato ascorbic acid content. This facilitates the transformation of phenotypic judgment of ascorbic acid content levels into SNP variant genotype judgment, enabling rapid prediction of ascorbic acid content in related materials at the genotype level and assisting in the assessment of plant stress resistance. It provides a convenient, accurate, efficient, and high-throughput screening method for selecting tomato materials with high ascorbic acid content, significantly improving the screening efficiency of superior germplasm, accelerating the breeding process and efficiency of high AsA content germplasm innovation, and reducing the workload of subsequent field phenotypic identification.

[0023] 2. This invention enriches the genetic resources for ascorbic acid biosynthesis. The provided SNP variants and the CAPS markers developed based on these SNP variants can serve as molecular targets for genetic improvement of tomato ascorbic acid biosynthesis performance. This provides a rapid and effective molecular tool for increasing the ascorbic acid content of tomatoes and has important practical application value for improving and enhancing ascorbic acid biosynthesis and tomato stress resistance. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below.

[0025] Figure 1 This is a graph showing the association between genome-wide SNP variations and the expression level of the tomato SlGGP1 gene in an embodiment of the present invention.

[0026] Figure 2 This is an agarose gel electrophoresis image of the PCR amplification products of 24 tomato materials in Example 2 of this invention;

[0027] Figure 3 This is an agarose gel electrophoresis image of the PCR amplification products of 24 tomato materials after enzyme digestion in Example 24 of this invention. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0029] Based on the information contained in this application, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0030] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0031] To make the above-mentioned objectives, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0032] Ascorbic acid content is an important nutritional quality trait of tomatoes. Currently, the biosynthetic pathway of ascorbic acid (AsA) in higher plants is basically clear. The main pathway for ascorbic acid synthesis in tomatoes is the L-galactose pathway. GDP-l-galactose phosphorylase (GGP) is one of the key enzymes in the synthesis of ascorbic acid via the L-galactose pathway. GGP can catalyze the conversion of GDP-L-galactose to L-galactose-1-phosphate. Studies have shown (see references [1] “Wang Liyan. Cloning, expression and functional analysis of tomato GDP-L-galactosylphosphatase (GGP) gene [D]. Shandong Agricultural University, 2012.”, [2] “Yang Dongyue. Functional analysis of tomato GDP-L-galactosylphosphatase gene SlGGP-LIKE [D]. Shandong Agricultural University, 2017.”, [3] “Yuan Yulin. Study on the molecular mechanism of GGP gene in the regulation of fruit Vc content [D]. Northwest A&F University, 2017.”), the expression level of GGP gene is highly positively correlated with AsA content. Inhibiting the expression of tomato GGP gene (SlGGP) reduces the ascorbic acid content of tomatoes, while overexpressing SlGGP1 gene can increase the AsA content of fruits. Therefore, enhancing the expression level of SlGGP1 is an effective way to increase the AsA content of tomatoes.

[0033] One embodiment of the present invention provides an SNP variant that is significantly associated with the expression level of the tomato SlGGP1 gene. The SNP variant is located at the 42843506th base on chromosome 6 of the tomato Heinz 1706 reference genome, and the base at this site is G or A. The version number of the reference genome is SL4.0.

[0034] This invention uses the expression level of the tomato SlGGP gene as phenotypic data and high-quality SNP variants from tomato resequencing as genotypic data to perform genome-wide association analysis. The analysis revealed that a single SNP variant on an intron of the SlGGP gene is highly associated with the gene expression level and can serve as an auxiliary indicator of AsA synthesis levels. This SNP variant is located at base 42,843,506 on chromosome 6 of the tomato Heinz 1706 reference genome (SL4.0) and exhibits G / A polymorphism. Therefore, this SNP variant site has three allele genotypes: GG, AA, and GA. When the SNP allele is homozygous for "AA", the tomato plant shows high SlGGP1 expression, corresponding to strong AsA synthesis ability, indicating a high AsA content tomato material. When the SNP allele is homozygous for "GG", the tomato plant shows low SlGGP1 expression, corresponding to weak AsA synthesis ability, indicating a low AsA content tomato material. When the SNP allele is heterozygous for "GA", the tomato plant shows moderate SlGGP1 expression, corresponding to moderate AsA synthesis ability, indicating a moderate AsA content tomato material. Further correlation analysis between different genotypes and tomato AsA content phenotypes in the population sample revealed that the accuracy of predicting tomato AsA content using the above SNP variations is high, reaching over 79%, indicating a high degree of consistency between genotype and phenotype in natural population samples. Therefore, the SNP mutation sites provided by this invention are universal molecular markers, less limited by genetic materials, and have a wide range of applications. They can be used as detection targets, and their genotypes can serve as important reference standards for identifying the AsA content of tomatoes, enabling the prediction and effective differentiation of phenotypic traits of tomato materials at the genotype level. Furthermore, this gene plays a crucial role in enhancing AsA synthesis and can also serve as a molecular target for genetic breeding of tomatoes with high AsA content. By modifying the "GG" genotype to the "AA" genotype through gene editing and other methods, a rapid and effective approach is provided for the genetic improvement of AsA synthesis performance in tomatoes. The implementation of this invention provides new molecular markers for the efficient selection of tomato germplasm with high AsA content, enriches the genetic resources for AsA biosynthesis, and has significant practical application value for improving and enhancing AsA biosynthesis. Moreover, ascorbic acid content plays an important role in plant resistance to various abiotic stresses, and the implementation of this invention is also of great significance for improving the stress resistance of tomatoes.

[0035] The SNP variants of this invention can be developed into conventional molecular marker types in the art, such as competitive allele-specific PCR (KASP) markers or enzyme digestion amplification polymorphic sequence (CAPS) markers.

[0036] In a preferred embodiment, the present invention provides a CAPS marker that is significantly correlated with the expression level of the tomato SlGGP1 gene. The nucleotide sequence of the CAPS marker is shown in SEQ ID NO.1, where R represents G or A (the site is shown in bold). Specifically, it is shown below:

[0037] 5'-CCGGAAACTAGGGTAATGTCTTTTGGAGGTTAACTTGGTTATTGATTATGATCTGC AAGTGATATATAGCGTTGAACCAATTCTTACCTTAAGAGACTAAGGTTGACRAAGATGTAGTCATTTTATGTCTTACTATTACATAGTAAATTGATGTTATGTAGTGTTTAAATTGAACTAGCGTTTTTTGTCGGTGTGGCAAATTTGAAATGAGTGTTGTGCTATTGCTCAGCGCTTGCTTTTCAAGTTGTTGCTTTGGAGACTTAC-3' (see SEQ ID NO. 1).

[0038] The SNP variant located at position 42,843,506 of chromosome 6 in the tomato Heinz 1706 reference genome (SL4.0) provided by this invention is associated with the MboII restriction endonuclease recognition site. When the SNP variant is a G base, it can be recognized and cleaved by the MboII restriction endonuclease, while when it is an A base, it cannot be recognized by the enzyme. Therefore, this invention converts the SNP variant into a Capture Amplified Polymorphic Sequence (CAPS) marker and places the SNP variant in the middle of the CAPS marker sequence. The genotype of the SNP variant can be quickly determined by whether the CAPS marker can be cleaved by the MboII restriction endonuclease. Specifically, when the CAPS marker is not digested (appearing as 266bp), the SNP genotype is homozygous "AA", indicating a tomato material with high AsA content. When the CAPS marker is digested into two bands of 120bp and 146bp, the SNP genotype is homozygous "GG", indicating a tomato material with low AsA content. When the CAPS marker is digested into three bands of 266bp, 120bp, and 146bp, the SNP genotype is heterozygous "GA", indicating a tomato material with average AsA content.

[0039] This invention transforms SNP genotyping into determining the band size after CAPS marker digestion. This genotyping method is simple and rapid, suitable for large-scale, high-throughput screening at any stage of the breeding process, such as tomato seeds or seedlings. It efficiently and accurately predicts the phenotypic traits of tomato materials, significantly improving the screening efficiency for superior germplasm, accelerating the breeding process for high AsA-content germplasm innovation, and reducing the workload of later field phenotypic identification. The implementation of this invention effectively solves the related drawbacks of conventional breeding methods, including difficulty in determining the AsA content of plants, inability to effectively distinguish between heterozygous and homozygous materials, and the significant environmental influence on phenotypic assessment.

[0040] In practice, the expression level of SlGGP1 is based on the general level of this gene expression in tomato plants in this field. This "high" or "low" is relative; the expression level relative to this general level helps determine the AsA content. Higher SlGGP1 expression indicates a stronger AsA synthesis capacity in tomatoes, resulting in a higher AsA content accumulated in the tomato plant, and vice versa.

[0041] Based on statistics from natural tomato population transcriptome sequencing data, when SlGGP1 expression level is expressed as fragments per kilobase of million mapped reads (FPKM), the criteria for judging its expression level are roughly as follows: when the SlGGP1 expression level FPKM value is greater than 300, it is considered that SlGGP1 expression level is high and the AsA content of the tested tomato plants is high; when the SlGGP1 expression level FPKM value is less than 200, it is considered that SlGGP1 expression level is low and the AsA content of the tested tomato plants is low; when the SlGGP1 expression level FPKM value is between 200 and 300, it is considered that SlGGP1 expression level is moderate and the AsA content of the tested tomato plants is moderate.

[0042] Another embodiment of the present invention provides a detection primer for detecting the CAPS marker as described above, the detection primer comprising an upstream primer (SlGGP1-F) and a downstream primer (SlGGP1-R), the nucleotide sequences of which are shown in SEQ ID NO. 2-3, respectively; specifically as follows:

[0043] SlGGP1-F: 5'-CCGGAAACTAGGGTAATGTC-3' (see SEQ ID NO. 2);

[0044] SlGGP1-R: 5'-GTAAGTCTCCAAAGCAACAAC-3' (see SEQ ID NO.3).

[0045] This invention uses the genomic DNA of the tomato material to be tested as a template, and performs PCR amplification using the detection primers designed above. After sequencing or enzyme digestion, the distribution of electrophoretic bands can be observed to effectively obtain the base information of SNP variant sites in CAPS markers. The primer amplification has high specificity and good genotyping effect.

[0046] Another embodiment of the present invention provides a kit comprising the detection primers described above.

[0047] The advantages of the kit over existing technologies are the same as those of the detection primers described above, and will not be repeated here.

[0048] Optionally, the kit may also include an MboII restriction endonuclease.

[0049] Optionally, the kit may also include PCR amplification reagents. The present invention does not have any special limitation on the source of the PCR amplification reagents, and conventional commercially available products in the art can be used.

[0050] In a typical implementation, the PCR amplification reagents include DNA polymerase, dNTPs, and buffer. This invention does not impose specific limitations on the total amount of PCR amplification reagents and primers used in the kit; the amounts can be set according to the standard requirements of the kit. Generally, the preferred concentrations of the upstream primer, downstream primer, and dNTPs in the kit are 10-20 mM, and the DNA polymerase concentration is typically 1-10 U / μL, which is usually the stock solution concentration.

[0051] Another embodiment of the present invention provides the application of the SNP variants, CAPS markers, detection primers, or kits as described above that are significantly associated with the expression level of the tomato SlGGP1 gene in the detection of tomato ascorbic acid content or in genetic breeding to increase tomato ascorbic acid content.

[0052] Based on the same inventive concept as described above, this invention also provides a method for detecting ascorbic acid content in tomatoes, comprising the following steps:

[0053] S1. Using tomato genomic DNA as a template, PCR amplification was performed using the detection primers shown in SEQ ID NO.2-3 to obtain the amplification product;

[0054] S2. The amplification product is digested with MboII restriction endonuclease to obtain the digested product;

[0055] S3. Perform gel electrophoresis on the enzyme digestion products and predict the ascorbic acid content of the tomato to be tested based on the distribution of electrophoretic bands; wherein, when only a 266bp electrophoretic band appears, the ascorbic acid content of the tomato to be tested is high; when two electrophoretic bands of 120bp and 146bp appear simultaneously, the ascorbic acid content of the tomato to be tested is low.

[0056] This invention requires only three steps: conventional PCR amplification, enzyme digestion, and electrophoresis to detect the band distribution of the products. It can intuitively determine the AsA content phenotype of the tomato material to be tested at the genotype level, which is beneficial for rapidly screening tomato varieties with high AsA content. Moreover, it has the advantages of good accuracy, low cost, and high throughput.

[0057] This invention does not specifically limit the method for extracting genomic DNA from the tomato material to be tested; any commonly used genomic DNA extraction method or kit in the art can be used, such as the CTAB extraction method. Fresh, tender tomato leaves are preferably used as the tomato material for genomic DNA extraction.

[0058] Optionally, the PCR amplification reaction system, in 20 μL increments, comprises: 15.6 μL ddH2O, 2.0 μL 10×PCRBuffer, 0.4 μL dNTPs, 0.2 μL Taq DNA polymerase, 0.4 μL upstream primer, 0.4 μL downstream primer, and 1.0 μL genomic DNA; wherein the concentrations of dNTPs, upstream primer, and downstream primer are 10-20 mM, and the concentration of genomic DNA is 80-150 ng / μL; the amplification program includes: 95.0℃ pre-denaturation for 3 min; 95.0℃ denaturation for 30 s, 54.0℃ annealing for 30 s, 72.0℃ extension for 30 s, for 35 cycles; and 72.0℃ extension for 5 min.

[0059] Optionally, the reaction system for the enzyme digestion treatment includes: 5 μL of amplification product, 12 μL of ddH2O, 2 μL of 10×Buffer Tango, and 1 μL of MboII, wherein the enzyme activity of the MboII restriction endonuclease is 1-10 U / μL; the reaction conditions include: enzyme digestion at 37℃ for 15 min, and inactivation at 65℃ for 5 min.

[0060] After obtaining the enzyme digestion product, the present invention preferably performs agarose gel electrophoresis to detect the enzyme digestion product, and the concentration of the agarose gel used is preferably 3%. The present invention does not have any special limitations on the source of the agarose gel; conventional commercially available products are acceptable. The present invention does not have special requirements for the electrophoresis process; it is performed according to the conventional agarose gel electrophoresis operating procedures in the art.

[0061] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0062] Germplasm resources and tomato transcriptome (RNA-seq) data: The research on tomato germplasm resources used in the following examples has been published in the literature "Zhu G, Wang S, Huang Z et al. Rewiring of the fruit metabolome in tomato breeding. Cell, 2018, 172:249-261". The relevant germplasm resources are available to the public from the applicant and may only be used to replicate the experiments of this invention and not for other purposes. The tomato transcriptome data also comes from this literature, and the corresponding data is openly shared in the NCBI database, with gene numbers SRP045767, PRJNA353161, PRJEB5226–PRJEB522, PRJEB5253, and PRJNA396272.

[0063] Reference genome: The tomato reference genome used in the following examples is the genome of tomato variety Heinz1706, version number SL4.0, which can be accessed openly in the Sol Genomics Network database. Download URL: https: / / solgenomics.net / organism / Solanum_lycopersicum / genome.

[0064] 1. Genome-wide association analysis based on the expression level of the tomato SlGGP1 gene

[0065] Based on 401 published RNA-seq data from tomato peel populations, raw reads were filtered using Fastp software to remove reads containing adapters, low-quality reads, and reads with a high number of N bases. The resulting clean reads were then aligned to the tomato Heinz 1706 reference genome (version SL4.0) using Hisat2 software. Subsequently, they were converted into compressed and sorted BAM files using SAMtools software. Based on the BAM files, gene expression levels were quantified using featureCounts software. Gene expression levels were expressed as fragments per kilobase of million mapped reads (FPKM) to eliminate differences in gene expression levels caused by gene length and sequencing depth.

[0066] The SlGGP1 gene expression level (FPKM) obtained from the analysis was used as phenotypic data. High-quality SNP variants with a minimum allele frequency (MAF) > 0.05 and a missing ratio < 10% were extracted as genotypic data. Genome-wide association analysis (eGWAS) was performed using a mixed linear model in EMMAX software. The number of effective SNPs was calculated using GEC software, and a threshold was determined based on Bonferroni correction α / n (α = 1, n = number of effective SNPs). Results are shown below. Figure 1 The left figure is a Manhattan plot, with the x-axis representing chromosome name and the y-axis representing the P-value of the correlation between SNP variation and SlGGP1 gene expression level, expressed as -log10(P). The red dashed line represents the threshold, and the red arrow points to the lead SNP. The right figure is a quantile-quantile plot (QQ plot), with the x-axis representing the expected -log10(P) value and the y-axis representing the observed -log10(P) value. The figures show that the SlGGP1 expression level on chromosome 6 is significantly correlated with multiple SNP sites.

[0067] According to eGWAS analysis, a significant SNP variant was found at position 42,843,506 of chromosome 6 in the tomato Heinz 1706 reference genome (SL4.0), located in an intron of the SlGGP1 gene. This variant represents a G->A allele variation compared to the reference genome, indicating a G / A polymorphism at this site. Therefore, three alleles exist: GG, AA, and GA. For tomato materials with high SlGGP1 expression levels, the allele at this SNP site is "AA"; for tomato materials with low SlGGP1 expression levels, the allele is "GG"; and for tomato materials with moderate SlGGP1 expression levels, the allele is "GA".

[0068] For example, a partial nucleotide sequence of the SlGGP1 gene containing the SNP site of the present invention is shown in SEQ ID NO.1, where the R base (shaded and bolded part) is the SNP site, wherein R = G or A, specifically located at the 108th base of the sequence shown in SEQ ID NO.1.

[0069]

[0070] Existing research indicates a strong positive correlation between SlGGP1 gene expression levels and AsA content. There are four main AsA synthesis pathways in plants, with the L-galactose pathway (Smirnoff-Wheeler pathway) being the first discovered and is widely recognized as the most important. The GGP gene in this pathway encodes GDP-L-galactose phosphorylase, a core gene regulating AsA content in plants, converting GDP-L-galactose to L-galactose-1-phosphate. Overexpression of the kiwifruit GGP gene in Arabidopsis significantly increases AsA content; while mutation of the SlGGP1 gene in tomato significantly reduces AsA content, overexpression of the SlGGP1 gene in tomato increases fruit AsA content. Therefore, this invention uses the SlGGP1 gene expression level as an important indicator of AsA synthesis level. The correlation between the expression level of the SlGGP1 gene in tomato and the AsA content of tomato plants was as follows: at the same growth stage, an SlGGP1 gene expression level FPKM value greater than 300 indicated a high AsA content; an FPKM value less than 200 indicated a low AsA content; and an FPKM value between 200 and 300 indicated a moderate AsA content. Therefore, functional molecular markers were developed targeting SNP variations in the introns of the SlGGP1 gene. The "GG" genotype indicates tomato materials with low SlGGP1 expression levels and low AsA content; the "AA" genotype indicates tomato materials with high SlGGP1 expression levels and high AsA content; and the heterozygous genotype "GA" indicates tomato materials with moderate SlGGP1 expression levels and moderate AsA content.

[0071] 2. Development of molecular markers and primer design for detection based on SNP variations in SlGGP1 gene introns

[0072] The MboII restriction endonuclease recognizes the "GAAGA" sequence. Compared to the reference genome, the SNP variant site obtained in this invention can be recognized and cleaved by the MboII restriction endonuclease before mutation (base sequence "GAAGA"), but cannot be recognized by the MboII restriction endonuclease after mutation (base sequence "AAAGA"). Therefore, it can be converted into a Capture-on-Profile (CAPS) marker. CAPS detection primers for detecting this SNP variant were designed based on the SlGGP1 gene sequence. The nucleotide sequences of the upstream primer (F) and downstream primer (R) are shown below:

[0073] SlGGP1-F: 5'-CCGGAAACTAGGGTAATGTC-3' (see SEQ ID NO. 2);

[0074] SlGGP1-R: 5'-GTAAGTCTCCAAAGCAACAAC-3' (see SEQ ID NO.3).

[0075] The sequence of the target gene fragment amplified by SlGGP1-F and SlGGP1-R is shown in SEQ ID NO.1. The target fragment was digested with enzymes and then separated by 3% agarose gel electrophoresis. When only one specific band of 266 bp appeared, the tested tomato material was identified as a homozygous material with a high SlGGP1 expression level (correspondingly high AsA content) and the "AA" genotype. When two specific bands of 120 bp and 146 bp appeared, it was identified as a homozygous material with a low SlGGP1 expression level (correspondingly low AsA content) and the "GG" genotype. When three bands of 266 bp, 120 bp, and 146 bp appeared simultaneously, it was identified as a heterozygous material with a moderate SlGGP1 expression level (correspondingly moderate AsA content) and the "AG" genotype.

[0076] This invention transforms the determination of SNP locus genotype into the determination of the size of the enzyme digestion bands of the amplification product. Uncut tomato materials are identified as high AsA materials, while cut materials are identified as low AsA materials. The results are intuitive, simple, and efficient, making it suitable for high-throughput screening.

[0077] 3. CAPS marker validation at the natural population level

[0078] Genotyping of 24 GWAS tomato materials was performed using the obtained CAPS marker detection primers, and the AsA content was predicted based on the identification results. Table 1 shows the SlGGP1 expression level of the 24 tomato materials based on transcriptome data.

[0079] Table 1. Expression levels of SlGGP1 in 124 tomato samples

[0080] Extremely low tomato material SlGGP1 expression level (FPKM) Extremely high tomato material SlGGP1 expression level (FPKM) TS-301 107.73 TS-129 316.28 TS-18 111.87 TS-56 316.86 TS-21 117.68 TS-302 317.54 TS-4 120.18 TS-26 319.73 TS-164 121.82 TS-154 334.33 TS-241 123.45 TS-27 353.68 TS-285 125.75 TS-249 362.67 TS-568 128.25 TS-222 368.89 TS-75 129.28 TS-63 369.38 TS-650 130.48 TS-65 370.07 TS-574 132.98 TS-528 384.62 TS-209 135.91 TS-240 386.41

[0081] The steps for genotyping tomato materials using CAPS marker detection primers are as follows:

[0082] (1) Tomato genomic DNA was used as a template at a concentration of 80-150 ng / μL. PCR amplification was performed using SlGGP1-F and SlGGP1-R. The total volume of the PCR reaction system was 20 μL, including: 15.6 μL ddH2O, 2.0 μL 10×PCRBuffer, 0.4 μL dNTPs (10 mM), 0.2 μL Taq DNA polymerase (5 U / μL), 0.4 μL upstream primer (10 mM), 0.4 μL downstream primer (10 mM), and 1.0 μL genomic DNA (as template). The PCR reaction was performed on a Bio-Rad S1000 PCR instrument manufactured in the United States. The PCR amplification program was as follows: 95.0℃ pre-denaturation for 3 min; 95.0℃ denaturation for 30 s, 54.0℃ annealing for 30 s, 72.0℃ extension for 30 s, for 35 cycles; 72.0℃ extension for 5 min, and storage at 4℃.

[0083] The amplification products were detected by 3% agarose gel electrophoresis, and the results are shown in the figure. Figure 1 In this diagram, lane 1 represents the molecular weight marker Maker (M), lanes 2-13 represent tomato materials with low (L) actual phenotypic expression levels of SlGGP1, from left to right: TS-301, TS-18, TS-21, TS-4, TS-164, TS-241, TS-285, TS-568, TS-75, TS-650, TS-574, and TS-209, and lanes 14-25 represent tomato materials with high (H) actual phenotypic expression levels of SlGGP1, from left to right: TS-129, TS-56, TS-302, TS-26, TS-154, TS-27, TS-249, TS-222, TS-63, TS-65, TS-528, and TS-240. As can be seen from the figure, all tomato materials were able to amplify a 266bp target band. The amplified target fragment band was bright and uniform, consistent with the theoretical size and sequence information, indicating that the primers had good specificity.

[0084] (2) The amplified 266bp target band was digested with FastDigest MboII (IIs grade) restriction endonuclease (purchased from Thermo Scientific, 50 reactions). The digestion system was prepared according to the instructions, including: 5 μL of PCR amplification product, 12 μL of ddH2O, 2 μL of 10×Buffer Tango, and 1 μL of MboII. The digestion was carried out at 37℃ for 15 min, followed by inactivation at 65℃ for 5 min.

[0085] (3) The enzyme digestion products were separated by 3% agarose gel electrophoresis. The results are shown in the figure. Figure 3In this diagram, lane 1 represents the molecular weight marker Maker (M), lanes 2-13 represent tomato materials with low (L) actual phenotypic expression levels of SlGGP1, from left to right: TS-301, TS-18, TS-21, TS-4, TS-164, TS-241, TS-285, TS-568, TS-75, TS-650, TS-574, and TS-209, and lanes 14-25 represent tomato materials with high (H) actual phenotypic expression levels of SlGGP1, from left to right: TS-129, TS-56, TS-302, TS-26, TS-154, TS-27, TS-249, TS-222, TS-63, TS-65, TS-528, and TS-240. If the 266bp band is not digested by enzymes, the tomato material is considered to have a high AsA content; if the 266bp band is completely digested into two bands of 120bp and 146bp, or has three bands of 266bp, 120bp and 146bp, the material is considered to have a moderate or low AsA content.

[0086] The AsA content of 24 tomato materials in Table 1 was statistically analyzed and compared with the results of CAPS marker detection, as shown in Table 2. In the CAPS marker judgment column, H represents homozygous materials with high SlGGP1 expression levels, H / L represents heterozygous materials with moderate SlGGP1 expression levels, and L represents homozygous materials with low SlGGP1 expression levels. It is evident that the accuracy of this marker can reach 79%, effectively distinguishing tomato materials with high and low AsA content, and the correlation between genotype analysis and actual phenotype is high, demonstrating good accuracy.

[0087] Table 2. Correlation analysis of CAPS markers and AsA content related to SlGGP1 expression levels in natural populations.

[0088]

[0089] The above results indicate that the SNP variants provided by this invention, as well as the CAPS markers and detection methods developed based on these SNP variants, can be used to identify the ascorbic acid content in tomatoes. This facilitates the transformation of phenotypic judgment of ascorbic acid content levels into judgment of the genotype of SNP variant sites in CAPS markers. It enables rapid prediction of ascorbic acid content in related materials at the genotype level and assists in judging plant stress resistance. This provides a convenient, accurate, efficient, and high-throughput screening method for tomato materials with high ascorbic acid content, which is beneficial for reducing the scale of later tomato planting, greatly improving breeding efficiency, and accelerating the breeding process.

[0090] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A SNP variant significantly associated with the expression level of the tomato SlGGP1 gene, characterized in that, The SNP variant is located at base 42843506 on chromosome 6 of the tomato Heinz 1706 reference genome, and the base at this site is either G or A. The version number of the reference genome is SL4.

0.

2. A CAPS marker significantly associated with the expression level of the tomato SlGGP1 gene, characterized in that, The nucleotide sequence of the CAPS label is shown in SEQ ID NO.1, where R represents G or A.

3. A detection primer, characterized in that, The detection primers for detecting the CAPS markers that are significantly associated with the expression level of the tomato SlGGP1 gene as described in claim 2 include an upstream primer and a downstream primer, the nucleotide sequences of which are shown in SEQ ID NO. 2-3, respectively.

4. A reagent kit, characterized in that, The kit includes the detection primers as described in claim 3.

5. The reagent kit according to claim 4, characterized in that, The kit also includes MboII restriction endonuclease.

6. The reagent kit according to claim 4, characterized in that, The kit also includes PCR amplification reagents, which include DNA polymerase, dNTPs, and buffer.

7. The application of the SNP variants significantly associated with the expression level of the tomato SlGGP1 gene as described in claim 1, the CAPS markers significantly associated with the expression level of the tomato SlGGP1 gene as described in claim 2, the detection primers as described in claim 3, or the kits as described in any one of claims 4-6 in the detection of tomato ascorbic acid content or in genetic breeding to improve tomato ascorbic acid content.

8. A method for detecting ascorbic acid content in tomatoes, characterized in that, Includes the following steps: S1. Using tomato genomic DNA as a template, PCR amplification is performed using the detection primers as described in claim 3 to obtain the amplification product; S2. The amplification product is digested with MboII restriction endonuclease to obtain the digested product; S3. Perform gel electrophoresis on the enzyme digestion products, and predict the ascorbic acid content of the tomato material to be tested based on the distribution of electrophoretic bands; wherein, when only a 266bp electrophoretic band appears, the ascorbic acid content of the tomato material to be tested is high; when two electrophoretic bands of 120bp and 146bp appear simultaneously, the ascorbic acid content of the tomato material to be tested is low.

9. The method for detecting ascorbic acid content in tomatoes according to claim 8, characterized in that, The PCR amplification reaction system includes: 15.6 μL ddH2O, 2.0 μL 10×PCR Buffer, 0.4 μL dNTPs, 0.2 μL Taq DNA polymerase, 0.4 μL upstream primer, 0.4 μL downstream primer, and 1.0 μL genomic DNA; wherein the concentrations of dNTPs, upstream primer, and downstream primer are 10-20 mM, and the concentration of genomic DNA is 80-150 ng / μL; The amplification program included: 95.0℃ pre-denaturation for 3 min; 95.0℃ denaturation for 30 s, 54.0℃ annealing for 30 s, 72.0℃ extension for 30 s, for 35 cycles; and 72.0℃ extension for 5 min.

10. The method for detecting ascorbic acid content in tomatoes according to claim 8, characterized in that, The reaction system for the enzyme digestion treatment includes: 5 μL of amplification product, 12 μL of ddH2O, 2 μL of 10×Buffer Tango, and 1 μL of MboII; wherein the enzyme activity of MboII restriction endonuclease is 1-10 U / μL; The reaction conditions included: enzyme digestion at 37℃ for 15 min, followed by inactivation at 65℃ for 5 min.

Images