Wheat ta ppkl1 mutant and application

Abstract

The present application relates to the technical field of plant genetic engineering, and particularly to a wheat TaPPKL1 mutant and application. The wheat TaPPKL1 mutant includes TaPPKL1-5A, TaPPKL1-5B and TaPPKL1-5D; the amino acid sequence of the TaPPKL1-5A is shown as SEQ ID NO:1, the amino acid sequence of the TaPPKL1-5B is shown as SEQ ID NO:2, and the amino acid sequence of the TaPPKL1-5D is shown as SEQ ID NO:3. The wheat TaPPKL1 mutant obtained by the present application can be used for breeding of a new wheat variety with dwarf, increased grain length and width, and has an important role in improving and modifying wheat crop germplasm resources.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and in particular to a wheat TaPPKL1 mutant and application thereof. BACKGROUND

[0002] Wheat (Triticum aestivum L. Triticum aestivum As one of the most important food crops in the world, the yield of wheat (Triticum aestivum L.

[0003] At present, the genes or pathways that have been mined to regulate the plant height, grain shape and grain weight of wheat mainly include Rht1 and its alleles or homologous genes, G protein signaling pathway (GS3), mitogen-activated protein kinase (MAPK) signaling pathway (SMG1) and plant hormones (such as BRs, IAA, CTK, etc.), however, the corresponding regulatory network is still relatively weak. SUMMARY

[0004] The present application aims to provide a wheat TaPPKL1 mutant and application thereof.

[0005] To achieve the above-mentioned purpose, the present application provides the following technical scheme:

[0006] In a first aspect of the present application, a wheat TaPPKL1 mutant is provided, wherein the wheat TaPPKL1 gene mutant includes TaPPKL1-5A, TaPPKL1-5B and TaPPKL1-5D.

[0007] The amino acid sequence of the TaPPKL1-5A is shown as SEQ ID NO: 1, the amino acid sequence of the TaPPKL1-5B is shown as SEQ ID NO: 2, and the amino acid sequence of the TaPPKL1-5D is shown as SEQ ID NO: 3.

[0008] In some embodiments, the wheat TaPPKL1 mutant of the present application is caused by deletion, addition, truncation, substitution, etc. of the gene sequence of the three homologous copies of TaPPKL1 gene (TaPPKL1-5A, TaPPKL1-5B, TaPPKL1-5D) of wheat.

[0009] In some embodiments, the wheat TaPPKL1 mutant of the present application can be obtained by gene editing of the wheat TaPPKL1 gene.

[0010] In some embodiments, the wheat TaPPKL1 mutant of the present application can be obtained by CRISPR-based gene editing technology. Site-specific nuclease can induce double-strand break (DSB) at the target site of the genomic sequence, which is then repaired by the natural process of homologous recombination (HR) or non-homologous end joining (NHEJ), thereby causing deletion, addition, truncation, substitution, etc. of the TaPPKL1 gene sequence; or by adding an exogenous donor template, thereby causing mutation of the wheat TaPPKL1 protein.

[0011] In a second aspect of the present application, a nucleic acid molecule encoding the wheat TaPPKL1 mutant of the present application is provided.

[0012] The nucleic acid molecule is selected from the group consisting of a genomic sequence, a cDNA sequence, an RNA sequence, or a combination thereof.

[0013] The nucleic acid molecule can be single-stranded or double-stranded.

[0014] The nucleic acid molecule can further comprise an additional helper element selected from the group consisting of a signal peptide, a secretion peptide, a tag sequence (such as 6His), a nuclear localization signal, or a combination thereof.

[0015] The nucleic acid molecule further comprises a promoter operably linked to the ORF sequence encoding the mutant polypeptide.

[0016] The promoter is selected from the group consisting of a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a strong promoter.

[0017] In some embodiments, the nucleic acid molecule comprises a gene as shown in (a1) or (a2) or (a3) below:

[0018] (a1) a cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 1, or, a deletion of the base at position 513 corresponding to the sequence of wheat TaPPKL1-5A gene as shown in SEQ ID NO: 4;

[0019] (a2) a cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 2, or, inserting a base T at the position corresponding to the 531st position of the sequence of the wheat TaPPKL1-5B gene as shown in SEQ ID NO: 5;

[0020] (a3) a cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 3, or, deleting the bases at the positions corresponding to the 530th and 531st positions of the sequence of the wheat TaPPKL1-5D gene as shown in SEQ ID NO: 6.

[0021] In a third aspect of the present application, there is provided an expression cassette or a vector comprising the nucleic acid molecule of the present application.

[0022] In some embodiments, the expression cassette comprises the nucleic acid molecule of the present application and a regulatory element operably linked thereto.

[0023] The regulatory element is selected from one or more of the following group: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

[0024] In some embodiments, the vector comprises the nucleic acid molecule encoding the wheat TaPPKL1 mutant of the present application. Preferably, the vector further comprises an expression regulatory element operably linked to the nucleic acid molecule.

[0025] In some embodiments, the vector comprises a cloning vector, an expression vector, a shuttle vector or an integration vector.

[0026] In some embodiments, the vector can be a vector for gene editing of the endogenous TaPPKL1 gene in a host cell.

[0027] In some embodiments, the expression vector further comprises at least one replication origin to enable self-replication.

[0028] In some embodiments, the vector can be a vector that is integrated into the genome and replicated together with the chromosome into which it is integrated when introduced into a host cell.

[0029] The vector can be of the type of plasmid, virus, cosmid, bacteriophage, etc., which are well known to those skilled in the art. Preferably, the vector in the present application is a plasmid.

[0030] In some embodiments, the present application provides an editing vector system comprising one or more vectors, which comprises at least a guide sequence targeting a parent TaPPKL1 protein-encoding gene. The guide sequence comprises a partial nucleotide sequence of the parent TaPPKL1 protein-encoding gene, preferably at least 15 bp of the nucleotide sequence of the TaPPKL1 protein-encoding gene, more preferably at least 20 bp of the nucleotide sequence of the TaPPKL1 protein-encoding gene.

[0031] In some embodiments, the editing vector system further comprises a gene editing enzyme, which comprises a nuclease of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Tanscription Activator-like (TAL) effector nucleases), ZFN (Zinc finger nuclease) editing tool.

[0032] In some embodiments, the gene editing enzyme is a Cas protein, also known as CRISPR enzyme or Cas effector protein, which includes but is not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, FDK1 protein. Preferably, the Cas protein is operably linked to a first regulatory element.

[0033] In some embodiments, the gene editing enzyme is a Cas9 protein, and the vector further comprises a Scaffold sequence that can specifically bind to the Cas9 protein. After the Scaffold sequence is operably linked to the guide sequence, a guide guide sequence (gRNA) is formed. Preferably, the gRNA is operably linked to a second regulatory element.

[0034] In other embodiments, the gene editing enzyme is a Cas12 protein, such as Cas12a, Cas12b, Cas12i, and the vector further comprises a Direct Repeat sequence that can specifically bind to the Cas12 protein. After the Direct Repeat sequence is operably linked to the guide sequence, a guide guide sequence (gRNA) is formed. Preferably, the gRNA is operably linked to a second regulatory element.

[0035] The above-mentioned regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences).

[0036] In some embodiments, a resistance gene is further comprised in the editing vector to facilitate screening, which includes hyg, bar, kana, rif, spec, amp, which are well known to those skilled in the art.

[0037] In some embodiments, the Cas protein is selected from nCas9 or other nick- active Cas9 proteins. Wherein "n" represents nick, i.e., Cas protein only has single strand cleavage activity.

[0038] In a fourth aspect of the present application, a host cell is provided, which comprises the nucleic acid molecule or the expression cassette or the vector of the present application, or the nucleic acid molecule is integrated into the genome of the host cell.

[0039] In some embodiments, the host cell is a eukaryotic cell, such as a yeast cell or an animal cell or a plant cell.

[0040] In some embodiments, the host cell is a prokaryotic cell, such as E. coli.

[0041] In some embodiments, the plant includes angiosperms and gymnosperms.

[0042] In some embodiments, the plant includes monocotyledons and dicotyledons.

[0043] In some embodiments, the plant includes herbaceous plants and woody plants.

[0044] In some embodiments, the plant includes wheat, maize, Arabidopsis, tobacco, rice, sorghum, barley, millet, soybean, tomato, potato, quinoa, lettuce, rape, Chinese cabbage, strawberry, etc.

[0045] In a fifth aspect of the present application, the wheat TaPPKL1 mutant, the nucleic acid molecule, the expression cassette or the vector, and the host cell of the present application are used in any one of the following aspects:

[0046] (b1) regulating the plant height of wheat;

[0047] (b2) regulating the grain size or yield of wheat;

[0048] (b3) regulating the yield of wheat;

[0049] (b4) breeding dwarf wheat varieties;

[0050] (b5) Wheat breeding.

[0051] In some embodiments, the modulating wheat plant height is negatively modulating wheat plant height, or, decreasing wheat plant height.

[0052] In some embodiments, the decreasing wheat plant height means that the plant height of a wheat plant comprising the wheat TaPPKL1 mutant, nucleic acid molecule, expression cassette or vector, host cell of the present application is lower than that of a wheat plant comprising wild type parent TaPPKL1 protein.

[0053] The plant height refers to the height from the ground to the highest part of the wheat.

[0054] In some embodiments, the wheat plant comprising the wheat TaPPKL1 mutant, nucleic acid molecule, expression cassette or vector, host cell of the present application has a plant height that is about 10%-90% lower, for example, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85% lower than that of the wild type parent.

[0055] In some embodiments, the modulating wheat kernel size or yield is positively modulating wheat kernel size or yield, or, increasing kernel length and width.

[0056] In some embodiments, the increasing kernel length and width means that the wheat plant comprising the wheat TaPPKL1 mutant, nucleic acid molecule, expression cassette or vector, host cell of the present application has a kernel length and width that is about 5%-30% higher, for example, 5%, 8%, 10%, 15%, 20%, 25%, 30% higher than that of the wild type parent.

[0057] In some embodiments, the modulating wheat yield means positively modulating wheat yield, or,

[0058] Increasing wheat yield.

[0059] In some embodiments, the wheat TaPPKL1 mutant plant of the present application has a yield, kernel weight that is about 5%-30% higher, for example, 5%, 8%, 10%, 15%, 20%, 25%, 30% higher than that of the wild type parent.

[0060] In a sixth aspect, the present application provides a method for decreasing wheat plant height, comprising the step of introducing the wheat TaPPKL1 mutant of the present application into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is wheat.

[0061] In a seventh aspect, the present application provides a method for breeding a dwarf wheat variety, comprising the step of introducing the wheat TaPPKL1 mutant of the present application into a plant cell, a plant seed, a plant tissue, a plant part, or a plant.

[0062] In an eighth aspect, the present application provides a method for increasing the length and width of a wheat grain, comprising the step of introducing the wheat TaPPKL1 mutant of the present application into a plant cell, a plant seed, a plant tissue, a plant part, or a plant.

[0063] In the above method, introducing the wheat TaPPKL1 mutant of the present application comprises the step of expressing the TaPPKL1 mutant protein in a plant cell, a plant tissue, a plant part, or a plant, for example, the step of expressing the mutant protein by an expression vector, or the step of integrating the nucleic acid molecule encoding the mutant protein into the plant genome for expression.

[0064] In some embodiments, introducing the wheat TaPPKL1 mutant of the present application comprises the step of mutating and expressing the endogenous TaPPKL1 protein coding gene of a plant.

[0065] In some embodiments, the TaPPKL1 mutant comprises deletion, addition, truncation, substitution, etc. of TaPPKL1.

[0066] In the above method, the method for introducing the mutation comprises natural variation, physical mutagenesis (such as ultraviolet mutagenesis, X-ray or Y-ray mutagenesis), chemical mutagenesis (such as nitrous acid, hydroxylamine, EMS, nitroso guanidine, etc.), biological mutagenesis (such as virus or bacteria mediated mutagenesis), gene editing.

[0067] It should be further noted that, since wheat is an allohexaploid, the TaPPKL1 gene comprises three copies of TaPPKL1-5A, TaPPKL1-5B and TaPPKL1-5D, and thus, the above three homologous copies of the gene need to be edited simultaneously.

[0068] Those skilled in the art can easily mutate the nucleotide sequence of the TaPPKL1 gene of the present application by using known methods, such as site-directed mutagenesis (including oligonucleotide primer mediated site-directed mutagenesis, PCR mediated site-directed mutagenesis and cassette mutagenesis, etc.) or directed evolution (including error-prone PCR, DNA shuffling and in vitro random priming recombination, etc.).

[0069] Based on the above technical solutions, the present application has the following technical effects:

[0070] 1. The present application screens a group of mutant wheat TaPPKL1 gene sequences.

[0071] 2. The application constructs an expression vector that can knock out TaPPKL1 gene in vivo of wheat by designing a guide single-stranded RNA (sgRNA) of TaPPKL1 gene, and obtains offspring of TaPPKL1 gene knockout through genetic transformation of wheat tappkl1-2#, Compared with the wild type, the plant height is significantly reduced, and the grain length and width are significantly increased.

[0072] 3. The application provides a feasible method for realizing rapid breeding of wheat and improving wheat yield by using genetic engineering technology, and has important breeding application value. BRIEF DESCRIPTION OF DRAWINGS

[0073] Figure 1 For the gene editing strain in the embodiment of the application, three homologous copies occur tappkl1-2# Sequencing results

[0074] Figure 2 For the gene editing strain in the embodiment of the application, three homologous copies occur tappkl1-2# A comparison diagram of protein coding results of the wild type and the gene editing strain, wherein A is a comparison diagram of protein coding results of the TaPPKL1-5A gene, B is a comparison diagram of protein coding results of the TaPPKL1-5B gene, and C is a comparison diagram of protein coding results of the TaPPKL1-5D gene

[0075] Figure 3 For the gene editing strain in the embodiment of the application, three homologous copies occur tappkl1-2# Sequencing and amplification fragments of the editing site, wherein 1 is a Transgen 2K plus marker, 2 to 11 are tappkl1-2# Sequencing and amplification fragments of the editing site of the offspring, 12 is a negative control amplified with water as a template, and 13 is a sequencing and amplification fragment of the JW1

[0076] Figure 4 For the gene editing strain in the embodiment of the application, three homologous copies occur tappkl1-2# A comparison diagram of plant height, grain length and width, wherein A and B are a comparison diagram of plant height of the gene knockout strain and the wild type JW1 wheat tappkl1-2# Comparison of plant height of the strain; C and D are a comparison diagram of grain length of the gene knockout strain and the wild type JW1 wheat tappkl1-2# Comparison of grain length of the strain; E and F are a comparison diagram of grain width of the gene knockout strain and the wild type JW1 wheat tappkl1-2# Grain width of the strain is significantly increased, and G is a comparison diagram of 1000-grain weight of the gene knockout strain and the wild type JW1 wheat tappkl1-2# Comparison of 1000-grain weight of the strain; H is a comparison diagram of single plant yield of the gene editing strain and the wild type JW1 wheat tappkl1-2# Significantly increased, wherein * represents p<0.05, *** represents p<0.001, and **** represents p<0.0001. DETAILED DESCRIPTION

[0077] The application will be further described in conjunction with the specific embodiments, and the examples given are only for the purpose of illustrating the application, but not for limiting the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0078] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0079] As described above, mining the key genes for controlling grain size and plant height has important application value for wheat line improvement and high-yield variety breeding.

[0080] Therefore, the application has carried out in-depth research on the genes for regulating wheat grain size and plant height. In the application, wild-type wheat variety JW1 is used as experimental material, and CRISPR / Cas9 gene editing technology is used to carry out the following mutation treatment on wheat TaPPKL1-5A gene, TaPPKL1-5B gene and TaPPKL1-5D gene.

[0081] (1) The 513th base corresponding to the sequence of wheat TaPPKL1-5A gene shown in SEQ ID NO: 4 is deleted, causing a frameshift mutation, and the reading frame changes. The mutant protein TaPPKL1-5A starts to have a frameshift from the 172nd amino acid, and the translation terminates after the 185th amino acid, and the corresponding function of the gene is lost.

[0082] (2) The 531th base corresponding to the sequence of wheat TaPPKL1-5B gene shown in SEQ ID NO: 5 is inserted with T, causing a frameshift mutation, and the reading frame changes. The mutant protein TaPPKL1-5B starts to have a frameshift from the 178th amino acid, and the translation terminates after the 233rd amino acid, and the corresponding function of the gene is lost.

[0083] (3) The 530th and 531th bases corresponding to the sequence of wheat TaPPKL1-5D gene shown in SEQ ID NO: 6 are deleted, causing a frameshift mutation, and the reading frame changes. The mutant protein TaPPKL1-5C starts to have a frameshift from the 178th amino acid, and the translation terminates after the 232nd amino acid, and the corresponding function of the gene is lost.

[0084] The amino acid sequence of TaPPKL1-5A of the wheat TaPPKL1 mutant is shown as SEQ ID NO:1, the amino acid sequence of TaPPKL1-5B of the wheat TaPPKL1 mutant is shown as SEQ ID NO:2, and the amino acid sequence of TaPPKL1-5D of the wheat TaPPKL1 mutant is shown as SEQ ID NO:3.

[0085] By comparing the wheat TaPPKL1 mutant and the wild type wheat variety JW1, it is found that the plant height of the wheat TaPPKL1 mutant is significantly reduced, and the grain length and width are significantly increased. Therefore, by means of existing genetic engineering, site-directed mutation treatment is carried out on the wheat TaPPKL1-5A gene, TaPPKL1-5B gene and TaPPKL1-5D gene, so that a wheat mutant with reduced plant height and increased grain length and width is obtained, which lays a foundation for the cultivation of high-yield wheat.

[0086] The high-fidelity enzyme required for PCR amplification is KOD-FX NEO (Toyobo); the restriction endonuclease BsaI required for Gibson assembly and the T4 ligase are both purchased from the NEB company; the gel recovery kit and the plasmid extraction kit required for enzyme digestion fragment recovery are both purchased from Thermo Fisher Scientific. The inorganic salt required for medium preparation is purchased from the National Pharmaceutical Group, and the vitamin and antibiotic are purchased from the Sigma company. The E. coli strain used in the present application is E. coli Transgen 5α, purchased from Beijing Quanshi Gold Company.

[0087] The wheat variety JW1 used in the present application is a new germplasm with good tissue culture ability selected by the Crop Institute of Shandong Agricultural Academy, and the public can obtain it from the Crop Institute of Shandong Agricultural Academy. This biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes.

[0088] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific examples.

[0089] Example 1: Design and expression vector of sgRNA

[0090] 1. Design of sgRNA targeting TaPPKL1

[0091] TaPPKL1 gene exists one copy on chromosome 5A, 5B and 5D of wheat (TaPPKL1-5A, TaPPKL1-5B, TaPPKL1-5D) respectively. The nucleotide sequence of TaPPKL1 gene in A genome has 100% sequence similarity with the sequence of gene TraesCS5A02G373900 (Chromosome 5A: 571,780,121-571,789,960 forward strand.) in Ensembl Plants database (http: / / plants.ensembl.org / index.html), the nucleotide sequence of coding region (CDS) of TaPPKL1-5A is shown as SEQ ID NO: 4; the nucleotide sequence of TaPPKL1 gene in B genome has 100% sequence similarity with the sequence of gene TraesCS5B02G375800 (Chromosome 5B: 553,346,620-553,356,553 forward strand.) in Ensembl Plants database, the nucleotide sequence of coding region (CDS) of TaPPKL1-5B is shown as SEQ ID NO: 5; the nucleotide sequence of TaPPKL1 gene in D genome has 100% sequence similarity with the sequence of gene TraesCS5D02G383300 (Chromosome 5D: 452,843,590-452,852,376 forward strand.) in Ensembl Plants database, the nucleotide sequence of coding region (CDS) of TaPPKL1-5D is shown as SEQ ID NO: 6.

[0092] In order to design sgRNA which can edit the coding region of TaPPKL1 gene, suitable target sites in the coding region of TaPPKL1 gene were searched by website CRISPRdirect (http: / / crispr.dbcls.jp / ), 20bp sequence fragments before or after PAM structure were set as target sequences, one of the sgRNAs was taken as an example for knockout experiment, the nucleotide sequence of which was GGGTGGAATTGGCCCAGCTG (SEQ ID NO: 7), the CCA before sgRNA target sequence was PAM sequence (relative to the forward sequence of genome), and because CCA was located in intron region, it was not shown in the corresponding CDS sequence of TaPPKL1 gene.

[0093] 2. pBUE411-TaPPKL1 binary expression vector

[0094] The embodiment adopts a plant CRISPR / Cas9 gene editing vector pBUE411 containing a wheat U3 promoter TaU3 to start sgRNA, and Cas9 simulates the characteristics of a higher GC content at the 5' end of a grass gene, which is a plant codon-optimized gene designed and synthesized. The plasmid pBUE411 is publicly available from China Agricultural University, and its sequence is known, with a length of 17430 bp.

[0095] The plant binary expression vector pBUE411-TaPPKL1 is composed of expression cassette E1 and expression cassette E2; wherein expression cassette E1 is, from upstream to downstream, TaU3 promoter from wheat, sgRNA targeting TaPPKL1 gene, and terminator T1; expression cassette E2 is, from upstream to downstream, ubiquitin promoter Ubi from corn, corn Cas9 coding sequence, and terminator T2. The nucleotide sequences of the wheat TaU3 promoter TaU3, the terminator T1, the corn ubiquitin promoter Ubi, the corn Cas9 coding sequence, and the terminator T2 have been disclosed in the patent “202411320638.3”. The nucleotide sequence information of pBUE411-TaPPKL1 is: the 802-821 bases in the nucleotide sequence of the plant binary expression vector pBUE411-TaPND in the patent “202411320638.3” are replaced by cagctgggccaattccaccc (SEQ ID NO: 8), which is the nucleotide sequence of the plant binary expression vector pBUE411-TaPPKL1 of the present application.

[0096] Example 2: Obtaining and identifying of transgenic offspring

[0097] 1. Obtaining of TaPPKL1 transgenic offspring

[0098] The recombinant binary expression vector pBUE411-TaPPKL1 in Example 1 was transformed into Agrobacterium EHA105 competent cells, specifically: the recombinant binary expression vector pBUE411-TaPPKL1 was added to Agrobacterium EHA105 competent cells for ice bath for 5 min, quick freezing in liquid nitrogen for 5 min, 37°C heat shock reaction for 5 min, then ice bath for 5 min, adding LB without antibiotics, and placing in a 28°C shaker for recovery for 2 h, then coating on LB (containing rifampicin, streptomycin and kanamycin) plates with a coater, and incubating at 28°C until the clones grew out. Single clones were picked and inoculated in LB culture solution containing corresponding antibiotics, and shaken at 28°C, 160 rpm, for 24 h.

[0099] Take the JW1 wheat seeds about 15 days after pollination, and peel the young embryos. Take 1 mL of bacterial solution in a 1.5 mL centrifuge tube, add 1.4 μL of acetyl chavicol ketone (0.1 M) and mix well. After 5 minutes of infection with the prepared bacterial solution, place it on the co-culture medium and incubate it in the dark at 23°C for 3 days. After co-culture, place it on the rest medium and incubate it in the dark at 25°C for 5 days. Transfer the callus to the screening medium 1, seal the petri dish with sealing film, and incubate it in the dark at 25.5°C for 2 weeks. After cutting the callus, transfer it to the screening medium 2, seal the petri dish again with sealing film, and continue to incubate it in the dark at 25.5°C for 2 weeks. After 2 weeks of cutting and screening the callus, transfer the resistant callus showing green bud spots to the regeneration medium. Seal the petri dish and place it in the 25°C incubator with light / dark (16 h / 8 h) for 2 weeks. After 2 weeks of regeneration, transfer the healthy growing seedlings to a new resistant regeneration small box. When the seedlings grow to a certain size, they can be sampled for detection.

[0100] The various media involved in the above wheat genetic transformation and their preparation are as follows:

[0101] Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol. 1223 DOI 10.007 / 978-1-4939-1695-5_15, Spring Science+Businedd Media New York 2015.

[0102] The formulations of the co-culture medium, rest medium, screening medium 1, screening medium 2 and regeneration medium are shown in Table 1.

[0103] Table 1 Medium formulation

[0104]

[0105] The young leaves of regenerated wheat were taken, and the genomic DNA was extracted by CTAB method, and PCR identification was performed by using primers on two vectors BUE-DF1 (TCATTGAGCAGATTTCCGAGT, SEQ ID NO: 9) and BUE-DR1 (ATTTGCAGCTTTTCTAGGTCT, SEQ ID NO: 10). The PCR reaction system was as follows: 2x PCR master mix: 10 μL, BUE-DF1 (10 μM): 0.5 μL, BUE-DR1 (10 μM): 0.5 μL, gDNA (50 ng / μL): 1 μL, ddH2O: 8 μL. The PCR reaction program was as follows: 95 °C pre-denaturation for 5 min, 95 °C denaturation for 30 s; 58 °C annealing for 30 s, 72 °C extension for 30 s, 32 cycles of reaction; 72 °C recombination for 5 min.

[0106] 2. Identification of TaPPKL1 transgenic knockout offspring

[0107] Wheat is an allohexaploid, TaPPKL1 gene is a copy on chromosome 5A, and the homologous copies on chromosomes 5B and 5D are TaPPKL1-5B and TaPPKL1-5D. The DNA sequences of the three copies are highly homologous, and the amino acid sequence similarity is as high as 98.8%. The gene editing conditions of the three homologous copies need to be detected simultaneously. In this experiment, the Hi-TOM gene editing site detection kit purchased from Xi'an Qingxue Biotechnology Co., Ltd. was used. The kit completes the high-throughput library construction process by PCR, and the Hi-TOM online software is used to directly analyze the variation information of multiple samples and multiple sites. The specific primers Seq-F1 (GGAGTGAGTACGGTGTGCCTCCACTATTCCCAAGCTAATCTAACC, SEQ ID NO: 11) and Seq-R1 (GAGTTGGATGCTGGATGGCTGTTGTGTAAGATCTAGAACATGAAGG, SEQ ID NO: 12) containing the target sequence on both sides were used to amplify TaPPKL1, TaPPKL1-5B and TaPPKL1-5D at the same time. The first round of PCR reaction system: wheat plant leaf DNA transformed with pBUE411-TaPPKL1 gene as template 1 μL, 2× Taq Master Mix in the kit 10 μL, Seq-F1 and Seq-R1 (Table 1) (10 μM) each 0.5 μL, Nuclease-free Water to make up the volume to 20 μL. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 20 s, a total of 32 cycles; finally 72℃ extension for 5 min. After PCR, 5 μL of PCR product was taken for agarose gel electrophoresis detection to ensure the presence of target product and good specificity. Then the second round of PCR reaction was carried out, Hi-TOM Mix in the kit 12 μL, 1 μL of the first round of PCR product as template, Nuclease-free Water to make up the volume to 20 μL. PCR reaction program: 94℃ denaturation for 2 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 25 s, a total of 33 cycles; finally 72℃ extension for 5 min. The amplified product was mixed and gel recovered, and the gel recovery product was the library sequencing sample, which was then sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing.

[0108] The gene editing results of the target genes wheat TaPPKL1, TaPPKL1-5B and TaPPKL1-5D genes are shown in Figure 1 , and the amino acid sequences encoded by them are shown in Figure 2A, B and C in the figure. After alignment, mutant protein TaPPKL1-5A has a frame shift from the 172nd amino acid, and the translation terminates at the 185th amino acid; mutant protein TaPPKL1-5B has a frame shift from the 178th amino acid, and the translation terminates after the 233rd amino acid; mutant protein TaPPKL1-5D has a frame shift from the 178th amino acid, and the translation terminates after the 232nd amino acid. The results show that the sgRNA and Cas9 elements are successfully transformed and function, and the TaPPKLs gene is edited, resulting in the premature termination of translation of the three proteins TaPPKL1-5A, TaPPKL1-5B and TaPPKL1-5D, and the loss of the corresponding function of the gene.

[0109] Example 3 Phenotype identification of wheat after knocking out TaPPKL1-5A, TaPPKL1-5B and TaPPKL1-5D genes

[0110] To obtain homozygous knockout lines of the three homologous copies of TaPPKL1-5A, TaPPKL1-5B and TaPPKL1-5D, a cleavage amplification polymorphism sequence (Caps) marker is developed for the editing site, and the offspring of the gene editing mutants are identified until the homozygous mutants with simultaneous knockout of TaPPKL1-5A, TaPPKL1-5B and TaPPKL1-5D are obtained.

[0111] The TaPPKL1-5A, TaPPKL1-5B and TaPPKL1-5D genes of the gene editing offspring are amplified by PCR using Seq-1F (SEQ ID NO: 11) and Seq-R1 (SEQ ID NO: 12). The PCR reaction system is: KOD-FX NEO buffer: 10 μL, dNTP (2 mM): 4 μL, Seq-F1 (10 μM): 0.6 μL, Seq-R1 (10 μM): 0.6 μL, gDNA of gene knockout lines (about 20 ng / μL): 1 μL, KOD-FX NEO: 0.4 μL, ddH2O to 20 μL. The touchdown PCR reaction program is used: 98°C pre-denaturation for 2 min, 98°C denaturation for 12 s; 60°C annealing for 20 s, 68°C extension for 45 s; 98°C pre-denaturation for 2 min, 98°C denaturation for 12 s; 55°C annealing for 20 s, 68°C extension for 45 s; 98°C pre-denaturation for 2 min, 98°C denaturation for 12 s; 50°C annealing for 20 s, 68°C extension for 45 s; a total of 35 cycles; 68°C reannealing for 5 min. After PCR, 5 μL of PCR product is taken for agarose gel electrophoresis detection, and the detection result is as follows: Figure 3As shown. After library construction, the amplified products were sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing. This allows for the screening of homozygous gene knockout strains. tappkl1-2# .

[0112] The wild-type recipient variety JW1 and TapPKL1 genes and their homologous copies were homozygous knockout lines (named JW1 and TapPKL1). tappkl1-2# Wheat plants (JW1 and JW2) were planted together in the artificial climate chamber of Shandong University's Qingdao campus under the following conditions: 16 hours of light and 8 hours of darkness; daytime temperature 22℃ and nighttime temperature 16℃; humidity 40%-50%; and CO2 concentration 500ppm-700ppm. Wheat plant height was measured during the grain-filling stage, and images of the plants were taken using a Canon high-performance SLR camera. tappkl1-2# The seeds were photographed. After harvesting, they were dried in a 30℃ oven for 14 days. The images of the JW1 seeds were then photographed using a Canon high-performance SLR camera. tappkl1-2# The seeds were photographed, and Image-Pro Plus 6.0 was used to analyze and measure the images, and the JW1 content was statistically analyzed. tappkl1-2# The length, width, thousand-grain weight, and yield per plant of the grain. For example... Figure 4 As shown in A and B, compared to wild-type JW1, tappkl1-2# The plant height was significantly reduced. For example... Figure 4 As shown in C, D, E, and F, compared to wild-type JW1, tappkl1-2# The length and width of the grains increased significantly. For example... Figure 4 As shown in G and H, compared to wild-type JW1, tappkl1 -2# wheat plants showed a significant increase in thousand-grain weight and yield per plant. This indicates that knockout of the TapPKL1 gene has a significant negative regulatory effect on wheat plant height and a significant positive regulatory effect on wheat grain length and width. This invention constructs a pBUE411-TaPPKL1 binary recombinant vector containing sgRNA that specifically targets TapPKL1 and its homologous genes. Using Agrobacterium-mediated infection of wheat embryo-induced callus tissue, the TapPKL1 gene is specifically edited, rendering it nonfunctional. This significantly reduces wheat plant height and increases wheat grain length and width, providing a new method for breeding high-yielding wheat.

[0113] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of knocking out wheat TaPPKL1 gene in reducing the plant height of wheat, characterized in that, The wheat TaPPKL1 gene has three copies A, B and D in wheat, and the coding sequences are shown as SEQ ID NO:4-SEQ ID NO:6; the application is achieved by simultaneously knocking out the three copies A, B and D of TaPPKL1 gene in wheat.

2. The application of knocking out wheat TaPPKL1 gene in breeding wheat varieties with short culm, characterized in that, The wheat TaPPKL1 gene has three copies A, B and D in wheat, and the coding sequences are shown as SEQ ID NO:4-SEQ ID NO:6; the application is achieved by simultaneously knocking out the three copies A, B and D of TaPPKL1 gene in wheat.

3. A method of reducing plant height in wheat, characterized by, The application relates to a method for improving the yield of wheat, comprising knocking out the endogenous TaPPKL1 protein coding gene in plants by using a gene editing technology, wherein the plants are wheat. The wheat TaPPKL1 protein coding gene has three copies A, B and D in wheat, and the coding sequences are shown as SEQ ID NO:4-SEQ ID NO:

6.

4. A method of breeding a dwarf wheat variety, characterized by, The application relates to a method for improving the yield of wheat, comprising knocking out the endogenous TaPPKL1 protein coding gene in plants by using a gene editing technology, wherein the plants are wheat. The wheat TaPPKL1 protein coding gene has three copies A, B and D in wheat, and the coding sequences are shown as SEQ ID NO:4-SEQ ID NO:6.

Images