Specific primer probe combination, method and kit for identifying avian influenza virus H9 prevalent strains SZ, A and X

Abstract

The invention relates to the field of virus detection, in particular to a specific primer probe combination, a method and a kit for identifying avian influenza virus H9 prevalent strains SZ, A and X. The sequences of the three pairs of primers are as shown in SEQ ID NO: 1-9. The primer probe combination provided by the invention can achieve the purpose of distinguishing and detecting different strains of avian influenza H9 through fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction). The primer probe combination provided by the invention has the advantages of high sensitivity, strong specificity and the like, and provides a new effective detection means for rapid differential diagnosis, epidemiological investigation and prevention and control of the avian influenza virus H9 clinically.

Description

Technical Field

[0001] This invention relates to the field of virus detection, and more specifically, to specific primer-probe combinations, methods, and kits for identifying circulating H9 avian influenza virus strains SZ, A, and X. Background Technology

[0002] Avian influenza H9 is an acute, highly contagious infectious disease caused by influenza A virus (AIV) of the Orthomyxoviridae family and the Influenza Virus genus. It is one of the most common viruses in poultry farming and is highly susceptible to gene mutation and recombination, leading to immune escape and immunization failure. In recent years, variant strains of avian influenza H9, such as the SZ, A, and X strains, have emerged, increasing the difficulty of disease control. Based on the HA gene of avian influenza H9, the virus is classified into SZ, A, and X strains. Commercially available inactivated vaccines using the SZ strain of avian influenza H9 are available, but the antigenicity of each strain differs. Inactivated vaccines made with the SZ strain cannot completely neutralize antibodies against other strains, and in more serious cases, they can break through maternal antibody protection, causing severe economic losses to the poultry industry. Currently, the economic losses caused by infections caused by the A and X strains of avian influenza H9 are the most severe. Therefore, the identification and typing of avian influenza H9 strains is of great significance for the diagnosis and control of this disease. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a set of primer and probe combinations and detection methods for rapid identification of the circulating strains of avian influenza virus H9, namely strain SZ, strain A and strain X.

[0004] The purpose of this invention is to provide primer and probe combinations for detecting the circulating H9 avian influenza virus strains SZ, A, and X.

[0005] Another object of the present invention is to provide a method for detecting circulating H9 avian influenza virus strains SZ, A, and X.

[0006] Another object of the present invention is to provide a kit for detecting circulating H9 avian influenza virus strains SZ, A, and X.

[0007] The specific primer-probe combination for rapid identification of circulating H9 avian influenza virus strains SZ, A, and X according to the present invention comprises the following primer pairs:

[0008] Primer pair used for detecting the circulating H9 avian influenza virus strain SZ:

[0009] SEQ ID NO:1 and SEQ ID NO:2 and probe SEQ ID NO:3;

[0010] Primer pair used for detecting the circulating H9 strain A of avian influenza virus:

[0011] SEQ ID NO:4 and SEQ ID NO:5 and probe pair SEQ ID NO:6;

[0012] Primer pair used for detecting the circulating H9 avian influenza virus strain X:

[0013] The sequences of each primer and probe in SEQ ID NO:7, SEQ ID NO:8, and probe pair SEQ ID NO:9 are as follows:

[0014] SEQ ID NO:1:5'-GCATGTTCAGATTCATTCTACAGA-3',

[0015] SEQ ID NO:2:5'-ATGCCCCACATGAAAAGAATG-3',

[0016] SEQ ID NO:3':5'-HEX-GACTCAAAAGAACAACGCTTACCCTATCC-BHQ-1-3';

[0017] SEQ ID NO:4:5'-ACAGCATGCTCAGGTTCATT-3',

[0018] SEQ ID NO:5:5'-CCCTCTCTGCGTCTCATCA-3',

[0019] SEQ ID NO:6:

[0020] 5'-ROX-AAACGGCGAGTACCCTACCCAAGACGCC-BHQ-2-3';

[0021] SEQ ID NO:7:5'-AACACATGCTCAGGTTCATTC-3',

[0022] SEQ ID NO:8:5'-GTGTTCTTTGCACATCCTCG-3',

[0023] SEQ ID NO:9:5'-Cy5-TGCCCAATACACGAATACTCAAGGGAAGAGC-BHQ-3-3'.

[0024] This invention provides a method for rapidly identifying circulating H9 avian influenza virus strains SZ, A, and X, the detection method comprising the following steps:

[0025] The primer pairs SEQ ID NO:1, SEQ ID NO:2 and probe SEQ ID NO:3 for detecting the prevalent H9 avian influenza virus strain SZ; the primer pairs SEQ ID NO:4 and SEQ ID NO:5 and probe pair SEQ ID NO:6 for detecting the prevalent H9 avian influenza virus strain A; and the primer pairs SEQ ID NO:7 and SEQ ID NO:8 and probe pair SEQ ID NO:9 for detecting the prevalent H9 avian influenza virus strain X were used to amplify the genome of the test samples by PCR and collect HEX, ROX and Cy5 signals.

[0026] Based on the results of probe fluorescence signal collection, the infection of strains SZ, A, and X was identified. The results were determined as follows: positive controls HEX, ROX, and Cy5 signals showed amplification curves with a Ct value less than 36, and negative control standards did not show amplification curves. Otherwise, the test failed and had to be repeated.

[0027] For the sample to be tested, if the HEX signal has an amplification curve and the Ct value is <36, then the sample to be tested is the SZ strain of the H9 circulating avian influenza virus.

[0028] For the sample to be tested, if the ROX signal has an amplification curve and the Ct value is <36, then the sample to be tested is the circulating strain A of avian influenza virus H9.

[0029] For the sample to be tested, if the Cy5 signal has an amplification curve and the Ct value is <36, then the sample to be tested is the circulating strain X of avian influenza virus H9.

[0030] For the sample to be tested, if there is no amplification curve for HEX, ROX and Cy5 signals, or if the Ct value is >36, then the sample to be tested is not the circulating strain SZ, A or X of avian influenza virus H9.

[0031] Furthermore, the detection method requires the use of RT-PCR reaction reagents and positive controls, including positive control plasmids for strain SZ, strain A, strain X, and negative controls.

[0032] Genotyping primers: The primers for strain SZ, strain A, and strain X are all at a concentration of 10 mM;

[0033] Positive samples: These include nucleic acid samples from strains SZ, A, and X, prepared by extracting RNA using a magnetic bead assay kit;

[0034] Positive controls: These include positive control plasmids for strain SZ, strain A, and strain X, each with a concentration of 0.01 ng / mL.

[0035] Negative control: Sterile double-distilled water.

[0036] Preferably, the amplification conditions are: reverse transcription at 50℃ for 10 min; pre-denaturation at 95℃ for 1 min, denaturation at 95℃ for 15 s, annealing and extension at 60℃ for 30 s, for 45 cycles, with fluorescence signals collected at the end of each cycle.

[0037] The samples to be tested include, but are not limited to, environmental, serum, tissue, excrement, and aerosol samples.

[0038] The present invention has the following advantages and beneficial effects:

[0039] This invention provides specific primer sets for identifying circulating H9 avian influenza virus strains SZ, A, and X. A fluorescent probe detection method is constructed using RT-PCR, allowing for determination of whether the virus is a circulating H9 avian influenza virus strain SZ, A, or X based on the probe's amplification curve and Ct value, without sequencing. This method can be applied to the identification of infections caused by circulating H9 avian influenza virus strains SZ, A, and X.

[0040] The fluorescence quantitative RT-PCR detection method provided by this invention has the advantages of high specificity, high sensitivity, and good reproducibility. It can accurately identify whether a sample contains the circulating strains of avian influenza virus H9, namely strain SZ, strain A, and strain X, and can effectively solve the problem of difficulty in distinguishing different strains during the prevention and control of circulating avian influenza virus H9. Attached Figure Description

[0041] Figure 1 The results of the detection of the circulating H9 avian influenza virus strain SZ are as follows;

[0042] Figure 2 The results of testing for the circulating H9 avian influenza virus strain A;

[0043] Figure 3 The results of testing for the circulating H9 avian influenza virus strain X;

[0044] Figure 4 The results show the specificity detection results of primer probes for the circulating H9 avian influenza virus strains SZ, A, and X.

[0045] Figures 5-10 The results show the sensitivity of primer probes for the circulating H9 avian influenza virus strains SZ, A, and X. Detailed Implementation

[0046] This invention aims to provide a set of primer-probe combinations and detection methods capable of identifying infections caused by circulating H9 avian influenza virus strains SZ, A, and X, to solve the problem of identifying infections caused by circulating H9 avian influenza virus strains SZ, A, and X. This primer-probe combination and detection method can effectively identify circulating H9 avian influenza virus strains SZ, A, and X.

[0047] According to the method for identifying circulating H9 avian influenza virus strains SZ, A, and X of the present invention, the required detection reagents include RT-PCR reaction reagents, three pairs of typing primers and probes, and positive and negative control samples.

[0048] (1) PCR reaction reagents: 5×FastAmpli RT Buffer (DG), 12.5×FastAmpli Part Taq / UNG Mix (with dNTPs) (DG), 50×FastAmpli Part RTase (DG).

[0049] (2) Three pairs of typing primers: the primer pair of the H9 prevalent strain SZ of avian influenza virus and the probe with the sequence shown in SEQ ID NO:3, wherein the primer pair includes primers with the sequences shown in SEQ ID NO:1 and SEQ ID NO:2; the primer pair of the H9 prevalent strain A of avian influenza virus and the ID probe with the sequence shown in SEQ ID NO:6, wherein the primer pair includes primers with the sequences shown in SEQ ID NO:4 and SEQ ID NO:5; and the primer pair of the H9 prevalent strain X of avian influenza virus and the probe with the sequence shown in SEQ ID NO:9, wherein the primer pair includes primers with the sequences shown in SEQ ID NO:7 and SEQ ID NO:8. The primer concentration is 10 mM, and the sequences of the primers and probes are as follows:

[0050] SEQ ID NO:1:5'-GCATGTTCAGATTCATTCTACAGA-3',

[0051] SEQ ID NO:2:5'-ATGCCCCACATGAAAAGAATG-3',

[0052] SEQ ID NO:3':5'-HEX-GACTCAAAAGAACAACGCTTACCCTATCC-BHQ-1-3';

[0053] SEQ ID NO:4:5'-ACAGCATGCTCAGGTTCATT-3',

[0054] SEQ ID NO:5:5'-CCCTCTCTGCGTCTCATCA-3',

[0055] SEQ ID NO:6:

[0056] 5'-ROX-AAACGGCGAGTACCCTACCCAAGACGCC-BHQ-2-3';

[0057] SEQ ID NO:7:5'-AACACATGCTCAGGTTCATTC-3',

[0058] SEQ ID NO:8:5'-GTGTTCTTTGCACATCCTCG-3',

[0059] SEQ ID NO:9:5'-Cy5-TGCCCAATACACGAATACTCAAGGGAAGAGC-BHQ-3-3'.

[0060] (3) Positive controls: These include positive control plasmids for the SZ strain of the H9 avian influenza virus, the A strain of the H9 avian influenza virus, and the X strain of the H9 avian influenza virus.

[0061] (4) Negative control samples include sterile double-distilled water.

[0062] The sequences obtained by amplification using sequences SEQ ID NO:1 to SEQ ID NO:3 are as follows (5′-3′):

[0063] SEQ ID NO:10:

[0064] GCATGTTCAGATTCATTCTACAGATCTTGTGAGACTCAAAAGAACAAC

[0065] GCTTACCCTATCCATATCGTCGAGAGACCATCAGCTGTTAACGGATTGTGTTATCCCGGGAATGTAGAAAACATTCTTTTCATGTGGGGCAT;

[0066] The sequences obtained by amplification using sequences SEQ ID NO:4 to SEQ ID NO:6 are as follows (5′-3′):

[0067] SEQ ID NO:11:

[0068] ACAGCATGCTCAGGTTCATTAAAACGGCGAGTACCCTACCCAAGACGCCCAGTGTCAGACAGAAAAAGGTTGGCTTAAACACAACACTGCCCGTTCCAAAATGTAAGTAAGTATGCATTTGGAAACTGCTCAAATGATGAGACGCAGAGAGGG;

[0069] The sequences obtained by amplification using sequences SEQ ID NO:7 to SEQ ID NO:9 are as follows (5′-3′):

[0070] SEQ ID NO:12:

[0071] AACACATGCTCAGGTTCATTCCATGGTATGGATACATTCTTTCAGGAGAGAGCCATGGAAGAATTTGCCCAATACACGAATACTCAAGGGAAGAGCGCGAGGATGTGCAAAGAACAC.

[0072] In this invention, the fluorescent groups used to label the probe include HEX, ROX, Cy5, BHQ1, BHQ2, BHQ3, etc.

[0073] The method of using the above-mentioned test reagents includes the following steps in sequence:

[0074] (1) RNA extraction: RNA of the H9 circulating strains SZ, A and X of avian influenza virus was extracted using a magnetic bead method viral nucleic acid extraction kit. The extracted RNA was used as a template. The template, PCR reaction reagent and primer pair were mixed in proportion, amplified and HEX, ROX and Cy5 signals were collected.

[0075] (2) RT-PCR amplification: The PCR amplification system is 25 μL, specifically including 5 μL 5×FastAmpli RT Buffer (DG), 2 μL 12.5×FastAmpli Part Taq / UNG Mix (with dNTPs) (DG), 0.5 μL 50×FastAmpli Part RTase (DG), 5 μL extracted RNA template, 0.5 μL primer pair, 0.25 μL probe, and 5 μL ddH2O.

[0076] The amplification conditions were as follows: reverse transcription at 50℃ for 10 min; pre-denaturation at 95℃ for 1 min, denaturation at 95℃ for 15 s, annealing and extension at 60℃ for 30 s, for 45 cycles. Fluorescence signals were collected at the end of each cycle.

[0077] (3) Result judgment: Positive control HEX, ROX and Cy5 signals have amplification curves and Ct values ​​less than 36; negative control standards do not have amplification curves. Otherwise, the test fails and needs to be repeated.

[0078] For the sample to be tested, if the HEX signal has an amplification curve and the Ct value is <36, then the sample to be tested is the SZ strain of the H9 circulating avian influenza virus.

[0079] For the sample to be tested, if the ROX signal has an amplification curve and the Ct value is <36, then the sample to be tested is the circulating strain A of avian influenza virus H9.

[0080] For the sample to be tested, if the Cy5 signal has an amplification curve and the Ct value is <36, then the sample to be tested is the circulating strain X of avian influenza virus H9.

[0081] For the sample to be tested, if there are no amplification curves for HEX, ROX, and Cy5 signals, or if the Ct value is >36, then the sample to be tested is not the SZ strain, A strain, or X strain of the H9 avian influenza virus.

[0082] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, all examples were performed under conventional experimental conditions, such as nucleic acid extraction using the magnetic bead-based viral nucleic acid extraction kit according to the manufacturer's instructions.

[0083] The test materials used in the following examples:

[0084] Clinical samples of the H9 avian influenza virus circulating strain SZ, strain A, and strain X were all provided by Ruipu Biotechnology Co., Ltd.

[0085] The following description, in conjunction with embodiments and accompanying drawings, provides further details. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0086] Example 1: Design and screening of primers and probes

[0087] Comparing the HA gene sequences of the circulating H9 avian influenza virus strains SZ, A, and X, it was found that the HA gene sequences of these three strains exhibited high homology and contained relatively few mutation sites. This made it difficult for primers provided by primer design software (SEQ ID NO. 13-21) (Table 1) to distinguish the specificity of primers between different strains, causing significant difficulties in experimental research. The inventors, through repeated comparisons of the genomic sequences of the circulating H9 avian influenza virus strains SZ, A, and X, and using real strain samples, repeatedly screened and tested the specificity of primers and probes for these three strains before finally selecting a primer-probe combination that could truly distinguish between the three strains.

[0088] A quantitative real-time PCR method was used to screen and identify primer and probe combinations for the circulating strains of avian influenza virus H9, namely strain SZ, strain A, and strain X. The specific method for quantitative real-time PCR is as follows: Swab sample preparation: Swabs were taken from the throat, trachea, or cloaca of dead chickens to collect secretions, as well as from chicken cages and wall surfaces in the farm. All swabs were placed in the same collection tube for pooled testing. Total RNA was extracted from the collected samples using a magnetic bead-based viral nucleic acid extraction kit. The nucleic acid was serially diluted with TE buffer for subsequent PCR testing.

[0089] Result determination: No amplification curve was found in the negative control sample, while an amplification curve was found in the positive sample; therefore, the test was valid.

[0090] Results: Feasibility results for detecting different types of circulating H9 avian influenza virus can be found in [link to results]. Figures 1-3 Since the tested samples included clinical samples of the H9 avian influenza virus circulating strain SZ, strain A, and strain X, and amplification curves were observed in SEQ ID NO:1-3 in the HEX channel, SEQ ID NO:4-6 in the ROX channel, and SEQ ID NO:7-9 in the Cy5 channel, with Ct values ​​less than 36, and the positive control standard showed an amplification curve while the negative control standard did not, this indicates that the control in this experiment was valid.

[0091] The synthesized primers and probes were used to amplify viral nucleic acid samples of the circulating H9 avian influenza virus strains SZ, A, and X, respectively. The amplification statistics are shown in Table 2. Figures 1-3From the results, a set of primer and probe combinations suitable for detecting and identifying the circulating strains of avian influenza virus SZ, A, and X of H9 are selected. These are the primer pairs SEQ ID NO:1, SEQ ID NO:2 and probe SEQ ID NO:3 for the circulating strain SZ of H9, the primer pairs SEQ ID NO:4, SEQ ID NO:5 and probe SEQ ID NO:6 for the circulating strain A of H9, and the primer pairs SEQ ID NO:7, SEQ ID NO:8 and probe SEQ ID NO:9 for the circulating strain X of H9.

[0092] Table 1. Primer and probe information for multiple sets of designs targeting different circulating H9 avian influenza viruses.

[0093]

[0094]

[0095] Table 2. Primer specificity detection results between primers and probes for circulating H9 avian influenza virus strains SZ, A, and X.

[0096]

[0097] The sites for amplifying the HA gene of the circulating H9 avian influenza strain obtained through screening are shown in Table 3, where the gene sequences are underlined.

[0098] Table 3

[0099]

[0100]

[0101] Example 2: Testing the specificity of circulating H9 avian influenza virus strains SZ, A, and X.

[0102] Primers and probes selected from the prevalent H9 avian influenza virus strains SZ, A, and X were used to detect positive samples of these strains. Simultaneously, other positive samples from common chicken infectious diseases, including Mycoplasma synoviae MS, Mycoplasma gallisepticum MG, avian infectious laryngotracheitis virus AILT, avian infectious bronchitis virus IBV, Newcastle disease virus NDV, and Haemophilus paragallinarum AP, were selected to verify the specificity of the nucleic acids. The quantitative real-time PCR method and primers and probes described in Example 1 (SEQ ID NO: 1-9) were used. The detection results are as follows: Figure 4 As shown, Figure 4 1,2-Avian influenza virus H9 circulating strain SZ, 3,4-Avian influenza virus H9 circulating strain A, 5,6-Avian influenza virus H9 circulating strain X, 7,8-Mycoplasma synoviae MS, 9,10-Mycoplasma gallisepticum MG, 11,12-Avian infectious laryngotracheitis virus AILT, 13,14-Avian infectious bronchitis virus IBV, 15,16-Newcastle disease virus NDV, 17,18-Haemophilus paragallinarum AP.

[0103] Test results as follows Figure 4 As shown in Table 4, the results indicate that the primers and probes for the screened H9 circulating strain SZ of avian influenza virus only recognize the SZ strain of avian influenza virus H9, the primers and probes for the A strain of avian influenza virus H9 only recognize the A strain of avian influenza virus H9, and the primers and probes for the X strain of avian influenza virus H9 only recognize the X strain of avian influenza virus H9. Other viruses did not show amplification curves, indicating good specificity.

[0104] Table 4. Specificity detection results of primer and probe for circulating H9 avian influenza virus strains SZ, A, and X.

[0105]

[0106]

[0107] Example 3: Testing the sensitivity of primers and probes for circulating H9 avian influenza virus strains SZ, A, and X.

[0108] Positive control plasmids for the circulating H9 avian influenza virus strain SZ, strain A, and strain X were constructed. These plasmids were prepared using a concentration of 1.304 × 10⁻⁶. 9Positive control plasmids of avian influenza virus H9 epidemic strain SZ, avian influenza virus H9 epidemic strain A, and avian influenza virus H9 epidemic strain X were prepared and serially diluted 10-fold with sterile double-distilled water as templates. 5 μL of each dilution was used as template and detected according to the real-time PCR method described in Example 1. The sensitivity was calculated based on the highest dilution with the highest template amount used to produce the expected positive curve, and a standard curve was plotted. The sensitivity detection results for avian influenza virus H9 epidemic strain SZ are as follows: Figure 5 and Figure 6 As shown, the susceptibility test results for the circulating H9 avian influenza virus strain A are as follows: Figure 7 and Figure 8 As shown, the susceptibility test results for the circulating H9 avian influenza virus strain X are as follows: Figure 9 and Figure 10 As shown, the detection results indicate that the designed and screened primers and probes have high sensitivity, good linear range, and a detection limit of up to 13.4 copies.

[0109] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A specific primer-probe combination for rapid identification of circulating H9 avian influenza virus strains SZ, A, and X, characterized in that, The specific primer-probe combination includes the following primer pairs: Primer pair for detecting the circulating H9 avian influenza virus strain SZ: SEQ ID NO:1 and SEQ ID NO:2 and probe SEQ ID NO:3; Primer pairs for detecting the circulating H9 strain A of avian influenza virus: SEQ ID NO:4 and SEQ ID NO:5 and probe pair SEQ ID NO:6; Primer pairs for detecting the circulating H9 avian influenza virus strain X: SEQ ID NO:7 and SEQ ID NO:8 and probe pair SEQ ID NO:9, wherein the sequences of each primer and probe are as follows: SEQ ID NO:1:5'-GCATGTTCAGATTCATTCTACAGA-3', SEQ ID NO:2:5'-ATGCCCCACATGAAAAGAATG-3', SEQ ID NO:3':5'-HEX-GACTCAAAAGAACAACGCTTACCCTATCC-BHQ-1-3'; SEQ ID NO:4:5'-ACAGCATGCTCAGGTTCATT-3', SEQ ID NO:5:5'-CCCTCTCTGCGTCTCATCA-3', SEQ ID NO:6: 5'-ROX-AAACGGCGAGTACCCTACCCAAGACGCC-BHQ-2-3'; SEQ ID NO:7:5'-AACACATGCTCAGGTTCATTC-3', SEQ ID NO:8:5'-GTGTTCTTTGCACATCCTCG-3', SEQ ID NO:9: 5'-Cy5-TGCCCAATACACGAATACTCAAGGGAAGAGC-BHQ-3-3'.

2. A method for rapidly identifying circulating H9 avian influenza virus strains SZ, A, and X, characterized in that, The method includes the following steps: The primer pairs SEQ ID NO:1, SEQ ID NO:2 and probe SEQ ID NO:3 for detecting the prevalent H9 avian influenza virus strain SZ; the primer pairs SEQ ID NO:4 and SEQ ID NO:5 and probe pair SEQ ID NO:6 for detecting the prevalent H9 avian influenza virus strain A; and the primer pairs SEQ ID NO:7 and SEQ ID NO:8 and probe pair SEQ ID NO:9 for detecting the prevalent H9 avian influenza virus strain X were used to amplify the genome of the test samples by PCR and collect probe fluorescence signals. Based on the results of probe fluorescence signal collection, infection with the circulating H9 avian influenza virus strains SZ, A, or X can be identified.

3. The method for rapidly identifying circulating H9 avian influenza virus strains SZ, A, and X according to claim 2, characterized in that, If for the sample to be tested, there is an amplification curve of the fluorescent group attached to the 5' end of primer 3 and the Ct value is <36, then the sample to be tested contains the circulating strain SZ of avian influenza virus H9. If for the sample to be tested, there is an amplification curve of the fluorescent group attached to the 5' end of primer 6 and the Ct value is <36, then the sample to be tested contains the circulating strain A of avian influenza virus H9. If, for the sample to be tested, there is an amplification curve of the fluorescent group attached to the 5' end of primer 9 and the Ct value is <36, then the sample to be tested contains the circulating strain X of avian influenza virus H9.

4. A kit for rapid identification of circulating H9 avian influenza virus strains SZ, A, and X, characterized in that, The kit includes the specific primer and probe combination described in claim 1 for rapidly identifying the circulating H9 avian influenza virus strains SZ, A, and X.

5. The kit for rapid identification of circulating H9 avian influenza virus strains SZ, A, and X according to claim 4, characterized in that, The kit also includes RT-PCR reaction reagents, positive controls and negative controls for the circulating H9 avian influenza virus strains SZ, A, and X.

Images