Application of the StPG34322 gene in regulating potato ripening
By overexpressing the StPG34322 gene in potato, the problem of unclear early maturity mechanism was solved, and molecular marker technology for early maturity breeding was realized, which promoted the early maturity of potato tubers and breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-06
- Publication Date
- 2026-03-13
AI Technical Summary
There is insufficient research on the function of the StPG34322 gene in potato tuber development in the existing technology, resulting in an unclear mechanism of early maturity in potatoes and a lack of effective breeding methods for early maturity.
We provided the StPG34322 gene and its encoded protein, constructed a recombinant vector to overexpress the gene in potatoes, promoted early tuber formation in potatoes, and used molecular marker technology to identify early-maturing varieties.
Overexpression of the StPG34322 gene promotes earlier tuber formation in potatoes, providing a molecular marker for screening early-maturing varieties, supporting early-maturing breeding, and enhancing research on the molecular regulation of potato tuber formation.
Smart Images

Figure CN121064307B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to... StPG34322 Application of genes in regulating potato ripening. Background Technology
[0002] Potatoes are the world's third largest and my country's fourth largest food crop. Due to their advantages such as cold resistance, tolerance to poor soil, high and stable yields, wide adaptability, and comprehensive nutrition, they are widely cultivated worldwide and play a vital role in ensuring food security for both my country and the world. Early maturity is one of the important agronomic traits of potatoes and a key criterion for identifying varietal characteristics. The potato tuber is a vegetative modified organ formed from the swelling of the apex of an underground stolon. Tuber formation is mainly regulated by external temperature and light; short-day conditions and low temperatures favor the conversion of potato stolons into tubers.
[0003] Studies have shown that the flowering and tuber formation time of potatoes is regulated by two different FT homologous genes, called flowering hormones. StSP3D and tuberculin StSP6A The abscisic acid signaling pathway transcription factor StABL1 can interact with StSP6A, forming a protein complex that affects potato tuber formation by regulating the gibberellin metabolic pathway. However, research on the mechanisms promoting the conversion of potato runners to tubers, i.e., early potato maturity, remains insufficient. Currently, regarding... StPG34322 The function of genes in potato tuber development has not been reported in the literature; therefore, research... StPG34322 The relevant regulatory mechanisms have important theoretical and practical significance. Summary of the Invention
[0004] To address the shortcomings of existing technologies, this invention provides... StPG34322 Genes and the proteins they encode, and demonstrate overexpression. StPG34322 Genes that can promote early tuber formation in potatoes can be used as molecular markers for developing early-maturing potato varieties, providing more options for early-maturing potato breeding.
[0005] To achieve the above objectives, the present invention is implemented through the following solution:
[0006] In a first aspect, the present invention provides a protein related to potato ripening, the amino acid sequence of said protein being (a) or (b).
[0007] (a) A protein composed of the amino acids shown in SEQ ID NO. 1;
[0008] (b) A functionally equivalent derivative protein consisting of the amino acid sequence shown in SEQ ID NO. 1, with one or more amino acid residues substituted and / or deleted and / or added;
[0009] In some specific embodiments, the present invention provides a protein having an amino acid sequence that has 80% identity with the sequence shown in SEQ ID NO. 1 and has the function of regulating potato tuber quality; preferably 85% identity, more preferably 90% identity, even more preferably 95% identity, and most preferably 99% identity.
[0010] In a second aspect, the present invention also provides a gene encoding the above-mentioned protein, wherein the nucleotide sequence of the gene is (a), (b) or (c).
[0011] (a) A nucleotide sequence as shown in SEQ ID NO. 2;
[0012] (b) The nucleotide sequence encoded by hybridization to the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions;
[0013] (c) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO. 2 and encodes a nucleotide sequence.
[0014] Those skilled in the art will fully understand that, since the same amino acid may be determined by multiple different codons, the nucleotide sequence encoding the above-mentioned protein is not limited to one type. It can be obtained by mutating one or more nucleotides of the mutant nucleotide sequence shown in SEQ ID NO. 2 to form a synonymous mutation, resulting in a nucleotide sequence that can also encode the mutant amino acid sequence of the present invention. Alternatively, a nucleotide sequence that can encode the mutant amino acid sequence of the present invention can be designed based on codon optimization.
[0015] In this invention, the nucleic acid may be optimized or unoptimized, and this invention does not limit the specific type of nucleic acid.
[0016] In this invention, the stringent conditions refer to conditions where the probe hybridizes with its target sequence to a level of detectability exceeding that with other sequences. These stringent conditions are sequence-dependent and can vary depending on the environment. By strictly controlling hybridization or washing conditions, target sequences that are 100% complementary to the probe can be identified. The stringent conditions can be selectively adjusted to allow for some sequence mismatches, thereby enabling the detection of lower levels of similarity.
[0017] In some specific embodiments, the present invention provides a protein gene nucleotide sequence that has 80% identity with the sequence shown in SEQ ID NO. 2; preferably 85% identity, more preferably 90% identity, even more preferably 95% identity, and most preferably 99% identity.
[0018] Thirdly, recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the above-mentioned genes also fall within the scope of protection of this invention.
[0019] In some specific embodiments, potatoes are included. StPG34322 The method for constructing a recombinant gene expression vector includes the following steps:
[0020] S1: Obtain the potatoes StPG34322 Gene sequence; amplification StPG34322 The gene coding region sequence;
[0021] S2: Using homologous recombination, the product obtained in S1... StPG34322 The gene sequence was constructed into a plant expression vector that already contains the 35S promoter to obtain the recombinant expression vector 35S:StPG34322.
[0022] Fourthly, the application of any of the aforementioned proteins, genes, recombinant vectors, expression cassettes, transgenic cell lines, or recombinant bacteria in early-maturing potato breeding also falls within the scope of protection of this invention.
[0023] Furthermore, through overexpression StPG34322 Genes that can promote earlier tuber formation in potatoes;
[0024] Furthermore, increasing the expression of the protein shown in SEQ ID NO. 1 can promote earlier tuber formation in potatoes.
[0025] Furthermore, the present invention provides StPG34322 The application of genes as molecular markers in either 1) or 2):
[0026] 1) Used for identifying or assisting in the screening of early-maturing potato varieties;
[0027] 2) Prepare products for identification or to assist in screening early-maturing potato varieties.
[0028] In some specific embodiments, potatoes StPG34322 Methods for using genes as molecular markers to identify early-maturing potato varieties include:
[0029] S1: Constructing the 35S promoter-driven plant expression vector 35S:StPG34322;
[0030] S2: The expression vector 35S:StPG34322 obtained in S1 was overexpressed by genetic transformation. StPG34322 Genetically modified potatoes;
[0031] S3: Identification of the transgenic potatoes obtained from S2 StPG34322 Gene expression levels;
[0032] S4: Identification of the overexpression obtained in S2 StPG34322 Tuber formation phenotype of genetically modified potatoes after induction with 8% sucrose.
[0033] Further, S2 specifically involves: preparing explants; infecting explants with Agrobacterium and co-culturing them to obtain co-cultured explants; screening the co-cultured explants to obtain screened explants; inoculating the screened explants onto a screening / differentiation medium to obtain differentiated shoots; and performing rooting culture on the differentiated shoots until rooting to obtain rooted shoots. StPG34322 Genetically modified potatoes; for roots StPG34322 PCR testing was performed on genetically modified potatoes.
[0034] Furthermore, S3 also includes detection via real-time quantitative PCR. StPG34322 Level of expression.
[0035] Furthermore, S4 also includes a high-sugar-induced tuber system for assessing tuber formation ability.
[0036] Furthermore, it can be used to prepare molecular markers, molecular probes, and detection kits.
[0037] Fourthly, the present invention provides a method for preparing transgenic plants, comprising the following steps: introducing the gene encoding the above-mentioned protein into potatoes to obtain transgenic potato plants.
[0038] Furthermore, the coding gene is introduced into the plant via a recombinant expression vector; the recombinant expression vector is obtained by inserting the coding gene into the multiple cloning site of the initial vector p2300MGFPUV-35S.
[0039] Beneficial effects: This invention is the first to reveal a method for regulating potato ripening. StPG34322 The gene, which is present in potato cultivars Desiree Overexpression of the virus can promote the conversion of stolons into tubers, which helps potatoes mature earlier. This indicates that the overexpressing lines have the ability to undergo tuber formation earlier than the wild type. This provides important theoretical support for identifying the molecular regulatory mechanisms of potato early maturity and tuber formation, and has broad application prospects. Attached Figure Description
[0040] Figure 1 for StPG34322 DNA-level PCR identification results of transgenic lines;
[0041] Figure 2 for StPG34322 Detection of transgenic line expression levels;
[0042] Figure 3 For overexpressionStPG34322 Effects on tuber formation phenotype in plants induced by high glucose in vitro;
[0043] Among them, 3a represents overexpression. StPG34322 Growth of test-tube seedlings of wild-type Desiree; 3b is a schematic diagram of the high-glucose induction system; 3c is the overexpression... StPG34322 Statistical chart of tuber formation in transgenic lines. Detailed Implementation
[0044] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise specified, the test materials used in the following embodiments were purchased from conventional biochemical reagent stores. Unless otherwise stated, percentages and parts are by weight. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar with the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0045] Example 1 StPG34322 Gene cloning and overexpression vector construction
[0046] 35S:StPG34322 overexpression plants were created in the context of the potato variety Desiree. The wild potato material Desiree used in this invention was obtained from the potato germplasm resource bank of the Potato Science Research Institute of Yunnan Normal University.
[0047] Using cDNA from Desiree leaves as a template, and based on the CDS sequence of StPG34322 (SEQ ID NO. 2), homologous arm sequences of the p2300MGFPUV-35S vector were added to both sides of the primers for PCR amplification.
[0048] StPG34322-F (SEQ ID NO. 03): 5'-CACGGGGGACTCTAGAATGTCGATTGAAGCTTTGAAGTCAC-3'
[0049] StPG34322-R (SEQ ID NO. 04): 5'-TTCTGGATCCTCTAGAATCGAAAAATAAACGCGGCTTC-3'
[0050] The PCR reaction system is shown in the table below:
[0051]
[0052] The reaction procedure is as follows:
[0053]
[0054] use Xba I digested the p2300MGFPUV-35S vector plasmid containing 35S with enzyme I. The reaction system is as follows:
[0055]
[0056] The reaction procedure is as follows:
[0057]
[0058] The PCR products and the digested vector plasmids were purified and ligated using In-Fusion ligase according to the instructions. The specific steps are as follows:
[0059] The following connection system is configured on ice:
[0060]
[0061] The reaction procedure is as follows:
[0062]
[0063] The following are the specific steps for transforming E. coli using the DH5α Chemically Competent Cell product instructions from Weidi Biotechnology:
[0064] a. DH5α competent cells from Remove from 80°C and quickly insert into ice. After 5 minutes, wait for the bacterial block to melt, add 2.5 μL of the above ligation product and gently mix by tapping the bottom of the EP tube with your hand. Let stand in ice for 25 minutes.
[0065] b. Heat shock in a 42°C water bath for 45 seconds, then quickly return to the ice and let stand for 5 minutes (shaking will reduce conversion efficiency).
[0066] c. Add 700 μL of antibiotic-free LB, mix well, and incubate at 37°C and 200 rpm for 60 minutes.
[0067] d. Centrifuge at 5000 rpm for 1 min to collect the bacterial cells, and take about 100 μL of supernatant to gently resuspend the bacterial cells by pipetting and spread them on LB plates containing Kan;
[0068] e. Invert the plate and incubate it overnight in a 37°C incubator.
[0069] Preliminary identification of positive clones: Amplification was performed using specific primers Cas9-909F / Cas9-2450R on the vector, and positive clones were sequenced. Plasmids were extracted from the correctly sequenced positive clones for later use.
[0070] Example 2: Agrobacterium-mediated potato genetic transformation
[0071] (1) Agrobacterium transformation
[0072] The positive plasmid was transformed with Agrobacterium using the product instructions of Weidi Bio GV3101 (Weidi Bio, AC1001). The specific operation is as follows:
[0073] Pick GV3101 Agrobacterium competent cells stored at 80°C were thawed on ice;
[0074] Add 1 μL of plasmid DNA to be transformed to every 50 μL of competent cells, mix gently, and incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min.
[0075] Add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C with shaking for 2 hours;
[0076] Take about 100 μL of bacterial culture and spread it on an LB agar plate containing Kan. Invert the plate and incubate at 28°C for 2-3 days.
[0077] Colony PCR identification.
[0078] (2) Agrobacterium-mediated potato genetic transformation
[0079] The genetic transformation recipient material is potato (Desiree), and the process includes the following steps:
[0080] Pre-culture: Explants of Desiree with axillary buds were cut and grown on MS30 medium (4.3 g MS powder + 30 g sucrose + 3 g G3251) for 4 weeks. The stems of C65 plants grown for 4 weeks were cut into pieces about 1 cm in size (without axillary buds) and placed on Z1N2 solid medium (4.3 g MS powder + 20 g sucrose + 3 g G3251 + 1 mg / mL ZT + 2 mg / mL NAA, pH=5.8) for pre-culture under light for 48 h.
[0081] Co-culture: The transformed Agrobacterium was activated on LB solid medium and shaken until OD was reached. 600=0.5, centrifuge at 4000 rpm for 10 min to collect bacterial cells, then resuspend in MS20 liquid and add AS (40 mg / mL) at 1:1000; place the pre-cultured stem segments in this liquid for 10 min to infect, drain the bacterial solution and place the stem segments on Z1N2AS medium (MS powder 4.3 g + sucrose 20 g + G3251 3 g + ZT 1 mg / mL + NAA 2 mg / mL + AS 40 mg / mL) and co-culture in the dark for 48 h;
[0082] Regeneration culture: The stem segments were transplanted and cultured on the differentiation medium Z2N0.01 (MS powder 4.3 g + sucrose 20 g + G3251 3 g + ZT 2 mg / mL + NAA 0.01 mg / mL + TMT 200 g / mL + Kana 100 mg / mL) and the medium was changed every two weeks until the regenerated seedlings were obtained.
[0083] (3) StPG34322 Identification of overexpressing plants
[0084] Take leaves from rooted plantlets and place them in 2 mL centrifuge tubes. Add steel balls and flash-freeze in liquid nitrogen for 2 min. Remove the leaves and shake vigorously in a foam box until they are pulverized. Add 500 μL of 2x CTAB and incubate at 65°C for 1 h, shaking 2-3 times during incubation. Then, cool at 4°C for about 5 min, add 500 μL of chloroform, mix by inversion, centrifuge at 12000 rpm for 10 min, and transfer the supernatant to a new 1.5 mL centrifuge tube. Add 500 μL of pre-chilled anhydrous ethanol, mix by inversion, and incubate at -20°C for 1-2 h. Centrifuge at 12000 rpm for 10 min, discard the supernatant, and wash 2-3 times with 75% ethanol. The resulting white precipitate should be left to stand for about 1 h, and the DNA should be redissolved in an appropriate amount of water for later use.
[0085] Using the extracted DNA as a template, the following primer pairs were used for amplification:
[0086] 2300-test-F:AGCAAGTGGATTGATGTGATATCT
[0087] 2300-test-R:CCTCTCAGAAAATGAGCTTTTGCTC
[0088] The PCR reaction system is as follows:
[0089]
[0090] The PCR amplification conditions are as follows:
[0091]
[0092] DNA-level PCR identification results of genetically modified potatoes are as follows Figure 1 As shown, the DNA molecular weight standard is DNA Molecular Weight Marker III, and numbers #1, #2, and #3 represent overexpression. StPG34322 The obtained transgenic lines were used with Desiree as a negative control. As can be seen, since the band of number #1 was weak, the expression level of plants number #2 and #3 was subsequently selected for identification.
[0093] Example 3 Identification of genetically modified potatoes StPG34322 Gene expression level
[0094] After three weeks of growth in tissue culture flasks, leaves were harvested from the selected positive seedlings for RNA extraction. Three biological replicates were established for each line and wild type. Culture conditions: temperature 18–22℃, 16 h light, 8 h dark. RNA extraction was performed using the TIANGEN plant total RNA extraction kit, and RNA was stored at -80℃. First-strand cDNA synthesis was performed using the TransGen Biotech reverse transcription kit. Detection was performed using quantitative real-time PCR. StPG34322 Expression levels. Constitutive expression genes in potatoes. StActin The following primers are used for quantitative real-time analysis as internal reference genes:
[0095] Actin -qRT-F:GGGATGGAGAAGTTTTGGTGGTGG
[0096] Actin -qRT-R:CTTCGACCAAGGGATGGTGTAGC
[0097] StPG34322 -qRT-F:GGGATGGAGAAGTTTTGGTGGTGG
[0098] StPG34322 -qRT-R:CTTCGACCAAGGGATGGTGTAGC
[0099] After qPCR, amplification and melting curves were analyzed using a 2... –ΔΔCT Calculate the relative expression levels of genes (see...) Figure 2 The error bars represent SE (n = 3, * P <0.05,** P <0.01, *** P <0.001; Student's st-test). Results showed that compared to Desiree wild-type, overexpression...StPG34322 In genetically modified potatoes StPG34322 Gene expression was significantly higher than that of the wild type, with an increase of 3.5 to 7 times.
[0100] Example 4 Overexpression StPG34322 In vitro identification of tuber formation phenotype in genetically modified potatoes
[0101] The obtained overexpression StPG34322 Transgenic potatoes #2, #3, and the wild-type Desiree were used as base seedlings for propagation via tissue culture. After the tissue culture seedlings had grown for 3 weeks, robust seedlings with consistent growth were selected for high-sugar induction experiments: stem segments were cut and inserted into MS medium containing 8% sucrose. Each stem segment must have one leaf. Tubers induced by high sugar will be produced from axillary buds. The operation must be carried out in a sterile environment. The scissors and tweezers used in tissue culture must be sterilized to avoid contamination.
[0102] Growth conditions: Temperature 18–22℃, continuous darkness. Seventy stem segments were inserted from each of the transgenic potato lines and the wild-type Desiree for tuber formation time and yield statistics. 35S:StPG34322 #2, #3, and Desiree materials were inserted into a high-glucose induction medium, and the number of tuber-forming stem segments was counted daily after 5 days.
[0103] Figure 3 'a' represents overexpression. The growth of the test-tube seedlings of the wild Desiree strains showed that the overexpression lines #2 and #3 matured significantly earlier. Compared with the control group Desiree, the leaves of the overexpression lines aged and flowered earlier. StPG34322 Figure b shows a schematic diagram of the high-glucose induction system. It can be seen that two types of tubers appear at the axillary buds after high-glucose induction: stolons and mini-tubers. The number of tuber segments was counted daily after 5 days of induction until overexpression was observed. Figure 3 The genetically modified potatoes fully tubered and overexpressed StPG34322 Statistics on tuber formation induced by high sugar in vitro in genetically modified potatoes, as follows: StPG34322 As shown in Figure c, compared to Desiree plants, overexpression Figure 3 The tuber formation time of the transgenic potatoes was significantly earlier, indicating that overexpression... StPG34322 StPG34322 Genetically modified potatoes have the ability to undergo tuber formation earlier than wild-type potatoes.
[0104] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Those skilled in the art, under the guidance of the present invention, can make various similar representations without departing from the spirit and claims of the present invention, and such modifications all fall within the protection scope of the present invention.
Claims
1. The use of a protein with an amino acid sequence as shown in SEQ ID NO. 1 in the regulation of potato maturity, characterized in that: The expression of the protein shown in SEQ ID NO. 1 is improved, and the potato is promoted to form tubers in advance.
2. The application of StPG34322 gene with nucleotide sequence as shown in SEQ ID NO. 2 in regulating potato maturity, characterized in that: The gene shown in SEQ ID NO. 2 is overexpressed, and the potato is promoted to form tubers in advance.
3. Application of the StPG34322 gene with the nucleotide sequence shown in SEQ ID NO. 2 as a molecular marker in identifying or assisting in screening early-maturing varieties of potatoes.
4. Application of the detection reagent of the StPG34322 gene with the nucleotide sequence shown in SEQ ID NO. 2 in preparing a product for identifying or assisting in screening early-maturing varieties of potatoes.