A method for constructing a mouse model of COL4A5-K229X point mutation X-linked Alport syndrome

Abstract

This invention discloses a method for constructing a mouse model of COL4A5-K229X point mutation X-linked Alport syndrome. Cas9 mRNA, gRNA, and a donor vector were designed and prepared targeting the c.685A>T point mutation in exon 12 of the mouse COL4A5 gene. These components were mixed and microinjected into C57BL / 6J mouse zygotes to obtain F0 generation mice. Genotypes were identified by PCR amplification and Sanger sequencing, and positive mice were screened. Positive F0 generation mice were mated with wild-type mice to breed F1 and subsequent generations. The model phenotype was further verified by qPCR, biochemical analysis, light microscopy, transmission electron microscopy, and immunofluorescence. The model constructed by this invention exhibits hematuria, proteinuria, azotemia, podocyte loss, and irregular thickening and stratification of the glomerular basement membrane, consistent with the phenotype of human XLAS patients, providing an animal model tool for elucidating the pathogenesis and developing treatment strategies.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for constructing a mouse model of COL4A5-K229X point mutation X-linked Alport syndrome. Background Technology

[0002] Alport syndrome (AS) is a hereditary glomerular disease primarily caused by mutations in the COL4A3, COL4A4, and COL4A5 genes, which encode type IV collagen α3, α4, and α5 chains. Clinical features include early hematuria, proteinuria, progressive renal failure, often accompanied by inner ear and ocular abnormalities, ultimately progressing to end-stage renal disease (ESRD). Based on inheritance patterns, AS is classified into X-linked (XLAS), autosomal recessive (ARAS), and autosomal dominant (ADAS), with XLAS accounting for over 80% of cases and caused by mutations in the COL4A5 gene. The COL4A5 gene, located at Xq22.3, encodes the type IV collagen α5 chain, which forms a trimer with the α3 and α4 chains, maintaining the integrity of the glomerular basement membrane (GBM), cochlear basement membrane, and ocular structures. COL4A5 gene mutations are diverse, including missense, nonsense, splicing, and frameshift mutations. These mutations disrupt the formation of α345 trimers, leading to irregular thickening, layering, and clefts of the GBM, resulting in typical pathological changes.

[0003] Existing research has identified hundreds of pathogenic COL4A5 variants, such as missense mutations (approximately 37%), splicing mutations (approximately 15%), and nonsense mutations (approximately 20%) summarized in databases. These variants are associated with the age of onset of ESRD: nonsense mutations often lead to earlier progression. Although the clinical phenotype is clear, the pathogenesis is not fully elucidated, and treatment is limited to RAAS inhibitors, lacking specific interventions. Therefore, establishing animal models carrying patient mutations has become a crucial tool. Currently, several XLAS mouse models have been reported, mainly based on CRISPR / Cas9 or traditional knockout techniques to construct COL4A5 mutations.

[0004] For example, the COL4A5 G5X nonsense mutation model reported by Rheault et al. in 2004 used transposon insertion technology to simulate proteinuria and GBM abnormalities, but its construction efficiency was low. The COL4A5 R471X nonsense mutation model established by Hashikami et al. in 2018, using CRISPR / Cas9, showed hematuria, azotemia, and podocyte loss in male mice, with a disease course similar to that in humans. The COL4A5 Del-ATGG frameshift mutation model reported by Wu et al. in 2023, using CRISPR / Cas9 to introduce a 4 bp deletion, resulted in progressive renal failure and GBM stratification. Novel models from 2025 include the COL4A5 c.1517-1G>T splice mutation model, which showed growth retardation, proteinuria, and irregular thickening of the GBM in male mice. In addition, there are rat models, such as the COL4A5 deletion model from 2021, which simulates renal interstitial fibrosis.

[0005] These models have played a role in elucidating the mechanisms of XLAS and screening drugs, but they have limitations: the types of mutations they cover are limited, mainly focusing on a few nonsense or frameshift variants, and they cannot fully simulate the genetic heterogeneity of patients. For example, the nonsense mutation c.685A>T (p.K229X) located in exon 12 of the COL4A5 gene has been reported in patients to induce nonsense-mediated mRNA degradation (NMD) and potential aberrant splicing, but there is a lack of corresponding mouse models, which limits in-depth research on the specific mechanisms of this mutation (such as early hematuria and differences in disease course). Therefore, there is an urgent need to develop mouse models carrying the K229X mutation to expand the tools for XLAS research and provide a more comprehensive preclinical platform. Summary of the Invention

[0006] The purpose of this invention is to overcome the defects of the prior art and provide a method for constructing a mouse model of COL4A5-K229X point mutation X-linked Alport syndrome.

[0007] The technical solution of the present invention is as follows:

[0008] A method for constructing a mouse model of COL4A5-K229X point mutation X-linked Alport syndrome includes the following steps:

[0009] (1) Cas9 mRNA, gRNA and donor vector were designed and prepared for the c.685A>T point mutation in exon 12 of the mouse COL4A5 gene. The donor vector contained a 5′ homologous arm, a mutant insertion fragment and a 3′ homologous arm. The above design was based on the mouse COL4A5-202 transcript numbered ENSMUST00000112931.8 as the target.

[0010] (2) The Cas9 mRNA, gRNA and donor vector obtained in step (1) were mixed and microinjected into C57BL / 6J mouse zygotes to obtain F0 generation mice;

[0011] (3) Genotyping of the F0 generation mice obtained in step (2) was performed by PCR amplification and Sanger sequencing to screen out positive mice carrying the point mutation;

[0012] (4) The positive F0 generation mice obtained in step (3) are mated with wild-type C57BL / 6J mice to obtain F1 generation mice, and subsequent generations of mice are bred through mating, and the subsequent generations of mice are tested.

[0013] In a preferred embodiment of the present invention, the length of the 5′ homologous arm is 2.8 kb, and the length of the 3′ homologous arm is 3.0 kb.

[0014] In a preferred embodiment of the present invention, the forward primer for PCR amplification is shown in SEQ ID NO.01, the reverse primer is shown in SEQ ID NO.02, and the expected amplification product length is 651 bp.

[0015] In a preferred embodiment of the present invention, the detection in step (4) includes detecting the expression level of COL4A5 mRNA in the renal cortex of subsequent generations of mice by qPCR, wherein: the forward primer for detecting the expression level of the COL4A5 gene is shown in SEQ ID NO.03, and the reverse primer is shown in SEQ ID NO.04; the forward primer for detecting the expression level of the GAPDH gene as an internal reference is shown in SEQ ID NO.05, and the reverse primer is shown in SEQ ID NO.06.

[0016] In a preferred embodiment of the present invention, the detection in step (4) includes collecting 24-hour urine and serum from the subsequent generations of mice for biochemical detection of urinary albumin, urinary creatinine, serum creatinine and serum urea nitrogen.

[0017] More preferably, the detection in step (4) further includes light microscopic examination of the kidney tissue of the subsequent generations of mice by HE staining, Masson trichrome staining and PAS staining.

[0018] More preferably, the detection in step (4) also includes transmission electron microscopy observation of the renal cortex of the subsequent generations of mice, including glutaraldehyde pre-fixation, osmium tetroxide post-fixation, gradient dehydration, resin embedding and ultrathin sectioning.

[0019] Further preferably, the detection in step (4) also includes immunofluorescence detection of the subsequent generation of mouse kidney tissue, wherein goat anti-rabbit IgG (H+L) is labeled with type IV collagen α5 primary antibody and fluorescent secondary antibody Alexa Fluor® 488.

[0020] More preferably, the detection in step (4) further includes immunofluorescence detection of frozen sections of the kidney tissue from subsequent generations of mice, using an anti-Wilms tumor protein primary antibody and a mounting medium containing DAPI.

[0021] In a preferred embodiment of the present invention, the detection in step (4) includes recording the body weight, kidney weight / body weight ratio and survival time of the subsequent generations of mice, and performing survival curve analysis using the Kaplan-Meier method.

[0022] The beneficial effects of this invention are:

[0023] 1. The model constructed in this invention is highly consistent with human XLAS patients in terms of phenotypic and pathological features: K229X male mice develop hematuria starting at 7 weeks of age, followed by proteinuria and azotemia, with progressive increases in serum creatinine and blood urea nitrogen; kidney tissue shows significantly reduced COL4A5 mRNA expression (only about 20% of wild-type) and significant podocyte loss; light microscopy reveals glomerular sclerosis, interstitial fibrosis, and inflammatory cell infiltration; transmission electron microscopy reveals irregular thickening of the GBM with dense layering. These changes worsen with age, with a median survival of 38 weeks, simulating the progression from early nephritis to ESRD in patients. Compared to the existing R471X model (hematuria at 22 weeks) and the Del-ATGG model (proteinuria at 16 weeks), this model shows hematuria earlier and a slightly slower disease progression, highlighting the unique clinical relevance of the K229X mutation.

[0024] 2. The model constructed in this invention reveals the potential mechanism of the K229X mutation: it induces mRNA degradation through the NMD mechanism, leading to the loss of expression of the type IV collagen α5 chain; simultaneously, it may generate aberrant spliced ​​transcripts (exon 12 skipped), preserving some collagen domain function and explaining the relatively mild phenotype. This provides new evidence for studying the correlation between mutation sites and ESRD age (e.g., earlier progression of 5' mutations), expanding our understanding of XLAS genetic heterogeneity. Existing models mostly ignore the effects of splicing; this invention fills this gap.

[0025] 3. The model constructed in this invention serves as a reliable tool to support preclinical research and treatment development: utilizing the C57BL / 6J background ensures genetic stability; multi-dimensional validation (qPCR, biochemistry, immunofluorescence, electron microscopy) improves reproducibility (independent triple replicates). It can be used to evaluate gene therapies (such as CRISPR repair of COL4A5 mutations) and drug interventions (such as targeting GBM repair), potentially promoting the advancement of specific treatment strategies. Compared to existing models, this invention covers novel mutation types, enhances the analysis of AS complexity, and has significant scientific and applied value. Attached Figure Description

[0026] Figure 1 This invention demonstrates the construction of the COL4A5 p.K229X mutant mouse model in Example 1. Specifically: a. Evolutionary conservation analysis: showing the alignment results of the COL4A5 protein sequence, including the p.K229X mutation site (marked in red), across multiple species; b. A schematic diagram of the strategy for achieving K229X fragment knock-in at the COL4A5 gene locus using CRISPR / Cas9 technology; c. Sanger sequencing results of wild-type mice and COL4A5 mutant mice constructed using CRISPR / Cas9, with the K229X site highlighted in red; d. Relative expression levels of COL4A5 mRNA in the kidneys of 8-week-old and 26-week-old wild-type and K229X male mice (n=3 per group). Expression values ​​were standardized using the WT group as a baseline, and results are expressed as mean ± standard deviation (SD). WT: wild-type; Het: heterozygous; Hom: homozygous; Hem: hemizygous; SD: standard deviation.

[0027] Figure 2 This invention demonstrates that, compared to wild-type mice, K229X male mice exhibited significant loss of podocytes in Example 1. Specifically: a. Representative images of WT1-positive cells (podocytes) in the glomeruli of WT mice and K229X male mice; b. Counting of WT1-positive cells in each glomerular section confirmed that the number of podocytes in K229X male mice was significantly less than that in WT mice (n = 3); WT1: Wilms' tumor protein 1; ** P < 0.01; Data are expressed as mean ± SD; Red circles indicate the approximate extent of glomeruli in the kidney tissue.

[0028] Figure 3 The changes in body weight and kidney weight of wild-type and K229X male mice in Example 1 of this invention are shown. Data are expressed as mean ± standard deviation (n = 5); SD, standard deviation; WT, wild type.

[0029] Figure 4The survival curves of wild-type and K229X male mice in Example 1 of this invention are shown. When the survival rate of K229X mice was less than 30%, the K229X mice were euthanized to obtain end-stage renal cells; WT mice were wild-type.

[0030] Figure 5 The following table shows the blood and urine biochemical parameters of wild-type and K229X male mice in Example 1 of this invention. Specifically: a. Changes in 24-hour urinary albumin (U-ALB); b. Changes in 24-hour urinary albumin / creatinine ratio (U-ACR); c. Changes in serum urea nitrogen (S-BUN); d. Changes in serum creatinine (S-CRE). Data are expressed as mean ± standard deviation (SD), n=6; ****P<0.0001. WT: wild-type; U-ALB: urinary albumin; U-ACR: urinary albumin / creatinine ratio; S-CRE: serum creatinine; S-BUN: serum urea nitrogen; SD: standard deviation.

[0031] Figure 6 This invention illustrates the pathological changes in the kidney tissues of wild-type and K229X male mice in Example 1. Typical images of kidney tissues from 8-week-old and 26-week-old wild-type and K229X male mice: HE staining (×200), MT staining (×400), and PAS staining (scale bar 10 µm). In 8-week-old K229X mice, glomerular plexus collapse, crescent formation, and tubulointerstitial fibrosis were observed; by 26 weeks of age, the lesions worsened, with glomerular collapse accompanied by an increase in extraglomerular cells. No obvious abnormalities were observed in wild-type control mice at the same age. WT: wild-type; HE: hematoxylin-eosin; PAS: periodic acid-Schiff; MT: Masson trichrome.

[0032] Figure 7 This image shows transmission electron microscopy (TEM) images of the glomerular basement membrane (GBM) in wild-type and K229X male mice from Example 1 of this invention. Representative TEM images show the ultrastructure of the glomerular capillary loops in wild-type and K229X mice. In 8-week-old K229X mice, focal thinning, mild irregularity, and local fusion of foot processes are observed in the GBM. In 26-week-old K229X mice, the GBM shows significant irregular thickening and dense stratification. Blue arrows indicate the glomerular basement membrane; orange arrows indicate the foot processes of podocytes. b and e are magnified ×8000; a, c, d, and f are magnified ×10000. WT: Wild-type.

[0033] Figure 8 This image shows representative immunofluorescence staining of type IV collagen α5 chains in the kidneys of 26-week-old wild-type and K229X male mice in Example 1 of this invention. WT: wild-type; scale bar: 20µm. Detailed Implementation

[0034] The technical solution of the present invention will be further explained and described below with reference to specific embodiments and accompanying drawings.

[0035] Example 1

[0036] I. Materials and Methods

[0037] 1. Laboratory animals:

[0038] All C57BL / 6J mice were given free access to standard feed and water and housed in a constant temperature and humidity environment of 22±2℃ and 50±10% relative humidity, with a 12-hour light / 12-hour dark light cycle. All animal experiments were approved by the Ethics Committee for the Management and Use of Laboratory Animals of Qingdao University School of Medicine, and experimental procedures strictly followed the SRC-IACUC guidelines.

[0039] 2. Construction of the COL4A5 K229X point mutation knock-in mouse model:

[0040] The c.685A>T (p.K229X) mutation located in exon 12 of COL4A5 is highly conserved across species. Figure 1 a). To elucidate the potential effects of this mutation, this embodiment utilizes CRISPR / Cas9 technology to create a K229X point mutation knock-in mouse model ( Figure 1 b). The strategy targets the mouse COL4A5-202 transcript (ENSMUST00000112931.8), and the specific process is as follows: (1) Cas9 mRNA and gRNA are prepared by in vitro transcription; (2) The donor vector is constructed using the In-Fusion method, and the plasmid contains a 5′ homologous arm (2.8 kb), a mutant insertion fragment and a 3′ homologous arm (3.0 kb); (3) Cas9 mRNA and gRNA are mixed with the donor vector and microinjected into C57BL / 6J fertilized eggs, and F0 generation positive mice are obtained by PCR and sequencing identification; (4) F0 generation positive mice are mated with wild-type C57BL / 6J to obtain F1 generation.

[0041] 3. Genotyping:

[0042] Genomic DNA was extracted from the tail tip of mice using a mouse tissue direct PCR kit (Tiangen, China). PCR amplification was performed targeting exon 12 of the COL4A5 gene, using the following primer sequences:

[0043] 5′-tgaactgtgtgcctctgatga-3′ (forward primer, SEQ ID NO.01);

[0044] 5′-gggctcacctgatctccttt-3′ (reverse primer, SEQ ID NO.02);

[0045] Expected product length: 651 bp;

[0046] PCR cycling conditions: 95 °C pre-denaturation for 3 min; 35 cycles: 94 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 1 min; final extension at 72 °C for 10 min;

[0047] After separation by 1.5% agarose gel electrophoresis, the amplified products were directly subjected to Sanger sequencing to determine the genotype.

[0048] 4. mRNA expression analysis

[0049] Three male K229X mice (8 weeks old), three male K229X mice (26 weeks old), and three wild-type male mice were used.

[0050] Total RNA was extracted from the renal cortex using RNA-easy separation reagent (Vazyme Biotech Co., Ltd, China). The expression level of the COL4A5 gene was detected using a two-step RT-qPCR kit (Accurate Biology, China) for reverse transcription and real-time quantitative PCR. Primer sequences are shown in Table 1. TaqMan Rodent GAPDH internal control was used as an endogenous control for standardization.

[0051] Table 1 qPCR primer sequences

[0052] Gene Primers Sequence (5′-3′) COL4A5 forward primer cgggaccaaaggggaata, SEQ ID NO.03 reverse primer tgcctggtttacctctttt, SEQ ID NO.04 GAPDH forward primer ggcaaattcaacggcacagtcaag, SEQ ID NO.05 reverse primer tcgctcctggaagatggtgatgg, SEQ ID NO.06

[0053] 5. Urine and serum marker tests

[0054] During the period of 6-8 weeks of age, and every 4 weeks during the period of 8-24 weeks of age, mice were placed individually in metabolic cages with free access to water.

[0055] Collect 24-hour urine samples. Centrifuge the urine samples at 3000 rpm for 20 min, and collect the supernatant for testing. Urinary albumin and creatinine were measured using kits from Nanjing Jiancheng Bioengineering Institute. Blood was collected via the tail vein, incubated at room temperature for 2 h, and then centrifuged at 3000 rpm for 20 min to separate serum. Serum creatinine and blood urea nitrogen were also measured using kits from Nanjing Jiancheng Bioengineering Institute, following the instructions.

[0056] 6. Histological changes in the kidneys

[0057] To observe the histological changes in the kidneys of the K229X mouse model, kidney tissues were taken from 26-week-old K229X and wild-type male mice and analyzed by light microscopy, transmission electron microscopy and immunofluorescence.

[0058] 6.1 Light microscopy: Kidney tissue was fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, and stained with HE, Masson trichrome, and PAS for histological evaluation.

[0059] 6.2 Transmission Electron Microscopy: Renal cortex was cut into 0.5-1 mm³ pieces and pre-fixed with 4% glutaraldehyde at 4°C. Subsequently, it was fixed for 2 h at room temperature and in the dark with 1% osmium tetroxide (dissolved in 0.1 M PB, pH 7.4). After dehydration with a gradient of ethanol / acetone, the sections were impregnated with EMBed 812 resin and polymerized at 60°C. 1.5 μm semi-thin sections were first cut for localization, followed by 60-80 nm ultrathin sections. These sections were double-stained with uranium acetate and lead citrate, and finally observed and photographed under a transmission electron microscope.

[0060] 6.3 Immunofluorescence Paraffin Sections: Paraffin-embedded kidney sections were antigen-retrievaled using EDTA antigen retrieval solution (pH 8.0, Wuhan Saiwei Biotechnology Co., Ltd.), followed by blocking with 3% BSA for 30 min. Then, type IV collagen α5 primary antibody (Sigma 3112199) was added, and the sections were incubated overnight at 4°C; subsequently, they were incubated with Alexa Fluor® 488-labeled goat anti-rabbit IgG (H+L) at room temperature in the dark for 50 min. Images were observed and acquired under a fluorescence microscope.

[0061] 6.4 Frozen Sections: Frozen kidney tissue sections were fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton X-100 for 15 min, and blocked with 10% BSA for 10 min. Primary antibody against Wilms' tumor protein (Abcam ab89901) was added, and the sections were incubated overnight at 4°C. The sections were then incubated with the same fluorescent secondary antibody at room temperature in the dark for 1 h. After mounting with a DAPI-containing anti-fluorescence quenching mounting medium (Beyotime P0131), the sections were observed under a fluorescence microscope.

[0062] 7. Survival time

[0063] For mice that were near death or had already died, the time of death was recorded. If the weight loss exceeded 20% compared to the previous week, the mice were euthanized and samples were collected for terminal analysis. The entire survival experiment was terminated when the survival rate of hemizygous K229X male mice dropped below 30%.

[0064] 8. Statistical Analysis

[0065] All data were analyzed using GraphPad Prism 8.0.1 software. Student's test or two-way ANOVA was used for comparisons between two groups. qPCR results were calculated as relative expression levels using the 2^-ΔΔCt method and normalized to the geometric mean of GAPDH. Mouse survival data were analyzed using Kaplan-Meier survival curves. P < 0.05 was considered statistically significant. All experiments were independently repeated at least three times.

[0066] II. Experimental Results

[0067] 1. Establishment of COL4A5 point mutation knock-in mice

[0068] In this embodiment, the CRISPR / Cas9 system was used to construct the corresponding COL4A5 mutant mouse based on the K229X nonsense mutation carried by patient A as reported in the literature

[12] . The injected fertilized eggs were transplanted into pseudopregnant female mice, and the pups born about 20 days later were used as the F0 generation. The genotypes of the mice were identified by PCR amplification and sequencing. The F0 generation positive mice were mated with wild-type C57BL / 6J mice to obtain the F1 generation, which included 6 heterozygous female mice and 2 hemizygous male mice. The genotypes of the F1 generation mice were confirmed by PCR and sequencing. Figure 1 c). Subsequently, by mating heterozygous female mice with hemizygous male mice, this embodiment successfully obtained a sufficient number of wild-type and hemizygous mutant offspring in subsequent generations.

[0069] Three male K229X mice (8 weeks old), three male wild-type mice (26 weeks old), and three juvenile male mice were used. Total RNA was extracted from the renal cortex for qPCR analysis to detect the expression level of COL4A5 mRNA. The results showed that the expression level of COL4A5 mRNA in mutant mice was significantly lower than that in wild-type mice, and this reduction persisted at both 8 and 26 weeks of age. Figure 1 d). Furthermore, significant podocyte loss was also observed in 26-week-old K229X mice in this embodiment ( Figure 2 ).

[0070] Both wild-type and K229X male mice gradually increased in weight between 4 and 26 weeks of age; however, starting at 26 weeks, the weight of K229X mice began to decline slowly, while the weight of wild-type mice tended to stabilize. Figure 3 The kidney weight / body weight ratio of 26-week-old K229X mice showed a decreasing trend; by 32 weeks of age, both kidney weight and kidney weight / body weight ratio were significantly lower than those of wild-type mice (Figure 3). K229X mice began to die from 30 weeks of age, with a mortality rate of 75% (n=12) by 44 weeks of age, and a median survival of 38 weeks. Figure 4 ).

[0071] 2. Blood and urine biochemical analysis of K229X mice

[0072] The urinary albumin level in K229X mice began to rise and exceed the normal range at 8 weeks of age, and continued to rise with age from 8 to 24 weeks. Figure 5 a). After correction for urinary creatinine, the urinary albumin / creatinine ratio also increases with age. Figure 5 b). With increasing age, serum urea nitrogen and creatinine levels in K229X mice progressively increased ( Figure 5 c and 5d).

[0073] 3. Histopathological results

[0074] Kidney tissues from K229X hemizygous male mice and wild-type controls were collected at 8 weeks and 26 weeks of age, respectively, and observed using light and transmission electron microscopy. Histopathological analysis showed that the kidney tissues of K229X hemizygous male mice exhibited significant lesions compared to wild-type mice.

[0075] Light microscopy revealed that a few glomeruli in 8-week-old K229X mice showed focal glomerulosclerosis, fibrosis, inflammatory cell infiltration, and tubulointerstitial changes, with the lesions limited to the cortical area surrounding the affected glomeruli. Figure 6 By 26 weeks of age, the glomerular lesions in K229X mice were significantly aggravated and expanded, while no such pathological changes were observed in age-matched wild-type mice.

[0076] Transmission electron microscopy observation of the ultrastructure of glomeruli in 8-week-old and 26-week-old mice ( Figure 7 Eight-week-old K229X mice showed focal irregularities in GBM and local fusion of foot processes; by 26 weeks of age, the GBM in mutant mice showed irregular thickening, and layering was visible in the dense layer.

[0077] The expression of type IV collagen α5 chains was significantly reduced in the glomerular capillary ring and Bowman's capsule. Figure 8 ).

[0078] This embodiment utilizes the CRISPR / Cas9 system to construct COL4A5 mutant mice carrying the K229X nonsense mutation, which has been previously found and confirmed to be pathogenic in XLAS patients, providing a new tool for further exploring the pathogenesis of XLAS and developing treatment strategies.

[0079] This embodiment confirms that hemizygous male mice carrying the COL4A5 K229X mutation exhibit renal pathology similar to Alport syndrome. K229X male mice showed elevated urinary albumin, increased blood urea nitrogen and serum creatinine; decreased COL4A5 mRNA expression in renal tissue and loss of podocytes; typical AS-like GBM changes were observed under electron microscopy, while light microscopy revealed glomerular enlargement, focal segmental glomerulosclerosis, mesangial proliferation, tubular atrophy, and interstitial fibrosis. These pathological features are consistent with previously reported G5X, R471X, and Del-ATGG mutant mouse models, and the clinical phenotype is also similar to that of human patients, indicating that the K229X mouse model can effectively mimic the pathogenesis and progression of human XLAS.

[0080] Studies have shown that the progression of XLAS is influenced by both genetic background and the COL4A5 gene mutation site: the closer the mutation site is to the 5' end of the gene, the earlier ESRD occurs. In this example, the K229X mutation is located closer to the 5' end than the R471X mutation, and both have a C57BL / 6J background, theoretically it should show ESRD earlier; however, actual observations revealed that the disease progression in K229X mice was slightly slower. Furthermore, hematuria is a typical early manifestation of AS patients; hematuria can be detected in K229X mice at about 7 weeks of age, consistent with clinical findings, unlike the R471X mice where hematuria gradually appears after 22 weeks. The mechanisms of these differences require further investigation. qPCR results showed that the COL4A5 mRNA expression level in K229X mice was only about 20% of that in wild-type mice. Previous studies have confirmed that nonsense or frameshift mutations carrying premature stop codons can trigger nonsense-mediated mRNA degradation (NMD), leading to rapid transcript clearance. Therefore, this embodiment suggests that the K229X mutation, which induces mRNA degradation through the NMD mechanism, is the main reason for the significant reduction in the transcriptional level of the COL4A5 gene.

[0081] Interestingly, Eri Okada et al., through small gene splicing experiments, discovered that the nonsense variant K229X can simultaneously generate both "exon 12 skipped" and "non-skipped" transcripts. The exon 12 skipped transcript results in in-frame deletion, rather than truncated peptides; these transcripts retain the complete 7S and NC1 domains, allowing the type IV collagen α5 chain to retain some function. This partly explains the relatively mild phenotype of the K229X mutation. The mouse model constructed in this example is also the first model carrying the COL4A5 mutation, which may affect aberrant splicing, and is of great significance for further research on the pathogenesis of Alport syndrome with different mutation types.

[0082] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for constructing a COL4A5-K229X point mutation X-linked Alport syndrome mouse model, characterized by: Comprising the following steps: (1) Design and prepare Cas9 mRNA, gRNA and donor vector for the c.685A>T point mutation of the 12th exon of the mouse COL4A5 gene, wherein the donor vector comprises a 5' homologous arm, a mutation insertion fragment and a 3' homologous arm, and the design is based on the mouse COL4A5-202 transcript numbered ENSMUST00000112931.8 as the target; (2) Mix the Cas9 mRNA, gRNA and donor vector obtained in step (1) and microinject into the fertilized eggs of C57BL / 6J mice to obtain F0 mice; (3) Genotype the F0 mice obtained in step (2) by PCR amplification and Sanger sequencing, and screen out positive mice carrying the point mutation; the forward primer for PCR amplification is shown in SEQ ID NO. 01, the reverse primer is shown in SEQ ID NO. 02, and the expected length of the amplified product is 651 bp; (4) Cross the positive F0 mice obtained in step (3) with wild-type C57BL / 6J mice to obtain F1 mice, and breed subsequent generations of mice by crossbreeding, and detect the subsequent generations of mice; the detection includes detecting the expression level of COL4A5 mRNA in the renal cortex of the subsequent generations of mice by qPCR, wherein: the forward primer for detecting the expression level of the COL4A5 gene is shown in SEQ ID NO. 03, and the reverse primer is shown in SEQ ID NO. 04; the forward primer for detecting the expression level of the GAPDH gene as an internal reference is shown in SEQ ID NO. 05, and the reverse primer is shown in SEQ ID NO.

06.

2. The construction method of claim 1, wherein: The length of the 5' homologous arm is 2.8 kb, and the length of the 3' homologous arm is 3.0 kb.

3. The construction method of claim 1, wherein: The detection in step (4) includes collecting 24 h urine and serum of the subsequent generations of mice, and performing biochemical detection of urine albumin, urine creatinine, serum creatinine and serum urea nitrogen.

4. The construction method of claim 3, wherein: The detection in step (4) further includes light microscope examination of the kidney tissue of the subsequent generations of mice by HE staining, Masson's trichrome staining and PAS staining.

5. The construction method of claim 3, wherein: The detection in step (4) further includes transmission electron microscope observation of the renal cortex of the subsequent generations of mice, including glutaraldehyde pre-fixation, osmium post-fixation, gradient dehydration, resin embedding and ultrathin section steps.

6. The construction method of claim 3, wherein: The detection in step (4) further includes immunofluorescence detection of the kidney tissue of the subsequent generations of mice, wherein IV collagen alpha 5 primary antibody and fluorescent secondary antibody Alexa Fluor® 488 labeled goat anti-rabbit IgG (H+L) are used.

7. The construction method of claim 3, wherein: The detection in step (4) further includes immunofluorescence detection of the kidney tissue of the subsequent generations of mice by frozen section, wherein anti-Wilms tumor protein primary antibody and DAPI-containing mounting medium are used.

8. The construction method of claim 1, wherein: The detection in step (4) includes recording the body weight, kidney weight / body weight ratio and survival time of the subsequent generations of mice, and performing survival curve analysis using the Kaplan-Meier method.

Images