Application of MNDA in diagnosis of multiple sclerosis
By detecting MNDA levels in the blood and utilizing specific probes and detection technologies, the specificity problem in the early diagnosis of multiple sclerosis has been solved, enabling efficient diagnosis and treatment screening and providing significant diagnostic efficacy.
Patent Information
- Application Number
- CN202511308978.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-15
- Publication Date
- 2025-12-12
AI Technical Summary
Current technologies lack effective, simple, and reliable biomarkers for the early diagnosis of multiple sclerosis, and magnetic resonance imaging (MRI) lacks specificity, making early diagnosis of the disease difficult.
Using reagents to detect MNDA levels, including probes, primers, or binding agents that specifically recognize the MNDA gene, and through techniques such as PCR and gene chip detection, the transcriptional or expression levels of MNDA in the blood are detected. Products and systems for diagnosing multiple sclerosis are constructed, therapeutic drugs are screened, and computational models are built for diagnosis.
Analyzing MNDA levels provides significantly high diagnostic efficacy, improves the accuracy of early diagnosis of multiple sclerosis, and offers new directions for treatment.
Smart Images

Figure CN121109575A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to the application of MNDA in the diagnosis of multiple sclerosis. Background Technology
[0002] Multiple sclerosis (MS) is an autoimmune disease characterized by inflammatory demyelinating lesions in the white matter of the central nervous system. The most commonly affected sites in MS are the periventricular white matter, optic nerve, spinal cord, brainstem, and cerebellum.
[0003] Magnetic resonance imaging (MRI) plays a crucial role in the diagnosis of multiple sclerosis (MS), but it lacks specificity in the early stages of the disease. Cerebrospinal fluid and blood, containing products of immune-related proteins, are also increasingly being used as supplementary diagnostic tools. However, due to the complex clinical manifestations of MS, a specific diagnostic method for its early stages remains lacking.
[0004] Therefore, there is an urgent need for an effective, simple, and reliable diagnostic biomarker for MS. Summary of the Invention
[0005] To overcome the shortcomings of existing technologies, this invention provides the application of MNDA in the diagnosis of multiple sclerosis.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A first aspect of the present invention provides the use of a reagent for detecting MNDA levels in a sample in the preparation of products for diagnosing multiple sclerosis.
[0008] Furthermore, the MNDA level includes MNDA transcriptional level and MNDA expression level.
[0009] Furthermore, the MNDA level refers to the MNDA transcriptional level.
[0010] Furthermore, the reagent is selected from probes that specifically recognize the MNDA gene, primers that specifically amplify the MNDA gene, or binders that specifically bind to the protein encoded by the MNDA gene.
[0011] Furthermore, the reagent also includes a detectable marker.
[0012] Furthermore, the detectable markers include radioactive isotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent components, magnetic particles, and bioluminescent components.
[0013] Furthermore, the reagents also include reagents for detecting the expression level of MNDA gene or protein by PCR, gene chip detection, NGS detection, nucleic acid probe method, ELISA, Western blotting, mass spectrometry, immunohistochemistry, and Raman spectroscopy.
[0014] A second aspect of the present invention provides a product for diagnosing multiple sclerosis, the product comprising a reagent for detecting MNDA expression levels in a sample.
[0015] Furthermore, the product includes a reagent kit, test strip, or chip.
[0016] Furthermore, the kit also includes instructions.
[0017] Furthermore, the kit also includes a buffer solution.
[0018] Furthermore, the sample was selected from blood.
[0019] Furthermore, the blood is selected from peripheral blood.
[0020] A third aspect of the invention provides the use of MNDA as a target in screening candidate drugs for the treatment of multiple sclerosis.
[0021] Furthermore, the method for screening candidate drugs for treating multiple sclerosis includes: treating a culture system expressing or containing the MNDA gene or its encoded protein with a substance to be screened; and detecting the expression or activity of the MNDA gene or its encoded protein in the system; wherein, when the substance to be screened inhibits the expression level or activity of the MNDA gene or its encoded protein, the substance to be screened is a candidate drug for treating multiple sclerosis.
[0022] A fourth aspect of the invention provides the application of MNDA in constructing a computational model for diagnosing multiple sclerosis.
[0023] The fifth aspect of the invention provides the application of MNDA in the construction of systems / devices for diagnosing multiple sclerosis.
[0024] A sixth aspect of the present invention provides a system / device for diagnosing multiple sclerosis, the system / device comprising:
[0025] Acquisition unit: Used to acquire gene expression data in the sample to be tested;
[0026] Extraction unit: used to extract expression data of target genes, including MNDA;
[0027] Prediction unit: Based on the expression data of the target gene, it performs classification prediction to obtain the classification result of whether the sample to be tested has multiple sclerosis;
[0028] Furthermore, the method for classification prediction based on the expression data of the target gene includes: if the expression level of MNDA is high, the classification result of the test sample is that it has multiple sclerosis; if the expression level of MNDA is low, the classification result of the test sample is that it does not have multiple sclerosis.
[0029] Advantages and beneficial effects of the present invention:
[0030] This application analyzed database data to screen for the gene MNDA, which shows significant differential expression in multiple sclerosis. Further verification was conducted using sequencing data and collected clinical samples, demonstrating that MNDA is significantly upregulated in patients with multiple sclerosis and has high diagnostic efficacy. This provides a new direction for the diagnosis and treatment of multiple sclerosis and has broad application prospects. Attached Figure Description
[0031] Figure 1 This is a graph showing the representation of MNDA in the database;
[0032] Figure 2 It is the ROC curve of MNDA in the database;
[0033] Figure 3 This is a graph showing the expression of MNDA in sequencing data;
[0034] Figure 4 This is a graph showing the expression of MNDA in clinical samples;
[0035] Figure 5 This is the ROC curve of MNDA in clinical samples. Detailed Implementation
[0036] The following provides definitions for some of the terms used in this specification. Unless otherwise stated, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0037] This invention provides the application of a reagent for detecting MNDA expression levels in a sample in the preparation of products for diagnosing multiple sclerosis.
[0038] In some implementations, MNDA includes wild-type, mutant, or fragments thereof. The term encompasses full-length, unprocessed MNDA, and any form of MNDA derived from cells and processed, as well as variants of MNDA (e.g., splice variants or allelic variants). The term encompasses, for example, human MNDA and MNDA from any other vertebrate source, including mammalian MNDA such as primates and rodents (e.g., mice and rats), gene ID: 4332.
[0039] In some embodiments, the expression level or level refers to the absolute or relative amount of the MNDA gene / protein. The expression level of MNDA in this application can be determined by a variety of techniques, including but not limited to PCR, gene chip detection, NGS detection, nucleic acid probe method, ELISA, Western blotting, mass spectrometry, immunohistochemistry, and Raman spectroscopy.
[0040] The reagents are selected from probes that specifically recognize the MNDA gene, primers that specifically amplify the MNDA gene, or binding agents that specifically bind to the protein encoded by the MNDA gene.
[0041] In some embodiments, the probe that specifically recognizes MNDA can be DNA, RNA, a DNA-RNA chimera, PNA, or other derivatives. There is no limitation on the length of the probe; any length is acceptable as long as specific hybridization and binding to the target nucleotide sequence are achieved. The probe length can be as short as 25, 20, 15, 13, or 10 bases. Similarly, the probe length can be as long as 60, 80, 100, 150, 300 bases or longer, even encompassing the entire gene.
[0042] In some implementations, primers are short nucleic acid molecules, such as DNA oligonucleotides, that can form a hybrid between the primer and the target nucleic acid strand through nucleic acid hybridization and annealing with a complementary target nucleic acid molecule. The primer can be extended along the target nucleic acid molecule using polymerase. Therefore, primers can be used to amplify target nucleic acid molecules, where the primer sequence is specific to the target nucleic acid molecule; for example, the primer will hybridize with the target nucleic acid molecule under very high-tightness hybridization conditions.
[0043] In some embodiments, the primers or probes of this application may be chemically synthesized using phosphorimide solid-phase support or other well-known methods. They may also be modified using many techniques known in the art. Non-limiting examples of such modifications include methylation, capping, substitution with one or more analogs of natural nucleotides, and modifications between nucleotides, such as modifying uncharged linkers (e.g., methyl phosphate, triphosphate, phosphorimide, carbamate, etc.) or modified charged linkers (e.g., thiophosphate, dithiophosphate, etc.).
[0044] The reagent also includes a detectable marker.
[0045] In some embodiments, a detectable marker refers to a composition capable of generating a detectable signal indicating the presence of a target polynucleotide in a sample. Suitable markers include, but are not limited to, radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent components, magnetic particles, and bioluminescent components. Therefore, a marker is any composition detectable by a device or method, including but not limited to spectroscopic, photochemical, biochemical, immunochemical, electrochemical, optical, chemical detection devices, or any other suitable device. In some embodiments, the marker can be detected visually without the aid of a device.
[0046] Among them, radioactive isotopes include but are not limited to 3 H, 14 C 35 S, 125 I, 131 I.
[0047] Enzymes include, but are not limited to, horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase, and acetylcholinesterase.
[0048] Fluorescent molecules include, but are not limited to, FITC, rhodamine, and lanthanide phosphors.
[0049] The products include reagent kits, test strips, or chips.
[0050] In some embodiments, the kit may also include a fluorescent dye, and a variety of known fluorescent dyes may be used. Examples include methods using an intercalator with a marking function, and methods using probes that bind fluorescent substances to nucleotides that specifically hybridize to the relatively amplified DNA sequence. Examples of intercalators include ethidium bromide and SYBR Green I as unsaturated fluorescent dyes, and Resolight and EvaGreen as saturated fluorescent dyes. The dosage should be as recommended by the manufacturer or distributor of the fluorescent dye used.
[0051] The kit also includes an instruction manual, which may include guidance on obtaining and processing samples.
[0052] In addition, the kit may contain genomic DNA as a positive control for PCR and sterile water as a negative control.
[0053] In some embodiments, the kit components may be packaged in an aqueous medium or in a lyophilized form. Suitable containers in the kit typically include at least one vial, test tube, long-necked flask, PET bottle, syringe, or other container for holding one component and for appropriate aliquoting. When more than one component is present in the kit, the kit will also typically include a second, third, or other additional container for separately holding the additional components. However, different combinations of components may be contained in a single vial. The kit of this application will also typically include a container for containing the reactants, sealed for commercial sale. Such a container may include injection-molded or blow-molded plastic containers for holding the desired vials.
[0054] In some embodiments, the solid support of the kit may be plastic, silicon wafer, metal, resin, glass, membrane, particles, precipitate, gel, polymer, sheet, sphere, polysaccharide, capillary, film, plate, or slide. The biological sample may be a cell culture, cell line, tissue, oral tissue, gastrointestinal tissue, organ, organelle, biological fluid, serum sample, urine sample, or skin.
[0055] In some implementations, a chip, also referred to as an array, refers to a solid support containing linked nucleic acid or peptide probes. An array typically contains a variety of different nucleic acid or peptide probes attached to a substrate surface at different known locations. It can typically be produced using mechanosynthesis or photoguided synthesis, which combines photolithography and solid-phase synthesis methods. The array can comprise a flat surface or can be nucleic acids or peptides on beads, gels, polymer surfaces, fibers such as optical fibers, glass, or any other suitable substrate. The array can be packaged in a manner that allows for diagnostic or other manipulation of a fully functional device.
[0056] The chips include gene chips and protein chips.
[0057] In some embodiments, the gene chip includes a solid-phase carrier and probes immobilized on the solid-phase carrier, the probes including oligonucleotide probes targeting the MNDA gene for detecting MNDA gene transcription levels; the protein chip includes a solid-phase carrier and a specific antibody against the MNDA protein immobilized on the solid-phase carrier. The gene chip can be used to detect the expression levels of multiple genes, including the human MNDA gene (e.g., multiple genes associated with multiple sclerosis); the protein chip can be used to detect the expression levels of multiple proteins, including the human MNDA protein (e.g., multiple proteins associated with multiple sclerosis). By simultaneously detecting multiple biomarkers associated with multiple sclerosis, the accuracy of diagnosing multiple sclerosis can be greatly improved.
[0058] This invention provides the application of MNDA in constructing a computational model for diagnosing multiple sclerosis.
[0059] In some implementations, the computational model includes the expression level of MNDA. As those skilled in the art will know, the steps of associating MNDA levels with a certain probability or risk can be implemented and realized in different ways. For example, mathematically combining the measured concentrations of MNDA with one or more other biomarkers and associating the combined value with the underlying diagnostic question. The measured biomarker values can be combined using any suitable existing technical mathematical method.
[0060] This invention provides a system / device for diagnosing multiple sclerosis, the system / device comprising:
[0061] Acquisition unit: Used to acquire gene expression data in the sample to be tested;
[0062] Extraction unit: used to extract expression data of target genes, including MNDA;
[0063] Prediction unit: Based on the expression data of the target gene, it performs classification prediction to obtain the classification result of whether the sample to be tested has multiple sclerosis.
[0064] The method for classification prediction based on the expression data of the target gene includes: if the expression level of MNDA is high, the classification result of the test sample is that it has multiple sclerosis; if the expression level of MNDA is low, the classification result of the test sample is that it does not have multiple sclerosis.
[0065] In some implementations, the system may be implemented manually, automatically, or in combination thereof to perform or complete the selected tasks. Furthermore, the actual instruments and equipment according to the implementations of the system of this application may implement multiple selected tasks via hardware, software, firmware, or a combination thereof using an operating system.
[0066] For example, the hardware used to perform the selected task can be a chip or circuit. As software, the selected task can be implemented as multiple software instructions executed by a computer using any suitable operating system. In this application, one or more tasks according to exemplary embodiments of the methods and / or systems described herein can be performed by a processing unit, such as a computing platform for executing multiple instructions. Optionally, the processing unit includes volatile memory for storing instructions and / or data, and / or non-volatile memory for storing instructions and / or data, such as a magnetic hard disk and / or removable media. Optionally, a network connection is also provided. A display and / or user input devices such as a keyboard or mouse are also optionally provided.
[0067] The invention is further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments described herein are by way of example and are not intended to limit the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention.
[0068] Example 1: Bioinformatics Analysis of MNDA Gene Expression
[0069] 1. Experimental Materials and Methods
[0070] Bioinformatics analysis was performed on the expression of the MNDA gene in patients with multiple sclerosis and healthy controls in the GSE159225 database (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE159225) (healthy controls:multiple sclerosis patients = 20:30). The rank-sum test was used to test for differences between groups, and ROC curves were plotted using the pROC package in R.
[0071] 2. Experimental Results
[0072] The results are as follows Figure 1 As shown, the MNDA gene was significantly upregulated in multiple sclerosis patients (M) compared to healthy controls (H); meanwhile, ROC curve analysis showed that the AUC value of the MNDA gene was 0.762, indicating high diagnostic efficacy. Figure 2 ).
[0073] Example 2: The MNDA gene showed significant differences in sequencing data.
[0074] 1. Materials and Methods
[0075] 1.1 Clinical Samples
[0076] Transcriptome sequencing analysis was performed on 29 healthy samples and 8 samples from patients with multiple sclerosis.
[0077] 1.2 Library Construction and Sequencing
[0078] Total RNA containing polyA structures was enriched using Oligo(dT) magnetic beads. The RNA was then fragmented into segments approximately 300 bp in length using ionolysis. Using the RNA as a template, the first-strand cDNA was synthesized using 6-base random primers and reverse transcriptase. The second-strand cDNA was then synthesized using the first-strand cDNA as a template.
[0079] After library construction, PCR amplification was used for fragment enrichment, followed by library selection based on fragment size (450 bp). Next, the libraries were quality-checked using an Agilent 2100 Bioanalyzer, and the total and effective concentrations of the libraries were measured. Then, based on the effective concentration and the required data volume, libraries containing different index sequences (each sample had a different index added, and the data from each sample was distinguished by the index) were mixed proportionally. The mixed libraries were uniformly diluted to 2 nM and denatured using alkaline methods to form single-stranded libraries.
[0080] After RNA extraction, purification, and library construction, the samples were sequenced using next-generation sequencing (NGS) on the Illumina sequencing platform to perform paired-end (PE) sequencing.
[0081] 1.3 Data Filtering and Statistics
[0082] Sequencing data contains some low-quality reads with adapters, which can significantly interfere with subsequent information analysis. Therefore, further filtering of the sequencing data is necessary. The main criteria for data filtering include: 1) using Fastp to remove sequences with adapters at the 3' end; 2) removing reads with an average quality score lower than Q20.
[0083] 1.4 Reference Genome
[0084] A reference genome index was created using Bowtie2, and then the filtered reads were aligned to the reference genome using Bowtie2 (http: / / bowtie-bio.sourceforge.net / index.shtml).
[0085] 1.5 Differential Gene Analysis
[0086] A bar chart of gene expression differences was created based on gene expression levels.
[0087] 2. Experimental Results
[0088] The results are as follows Figure 3 As shown in Table 1, the MNDA gene was significantly upregulated in patients with multiple sclerosis (M) compared to healthy controls (H).
[0089] Table 1. Expression of MNDA gene in sequencing data
[0090] gene_id Fold Change <![CDATA[log2FoldChange]]> p-value q-value Regulation MNDA 1.974785197 0.981695736 0.001060543 0.026394758 Up
[0091] Example 3: Significant differences were observed in clinical samples of the MNDA gene.
[0092] 1. Experimental Materials and Methods
[0093] 1.1 Clinical Samples
[0094] This study included 33 patients with relapsing-remitting multiple sclerosis who met the diagnostic criteria in the "Chinese Expert Consensus on the Diagnosis and Treatment of Multiple Sclerosis (2023 Edition)" and 9 healthy controls matched for sex and age during the same period, who visited the Department of Neurology of the Second Hospital of Hebei Medical University between 2023 and June 2025. The specimens were peripheral blood. Peripheral blood neutrophils were isolated using a kit, RNA was extracted and reversed into cDNA for PCR detection. The primer sequences are shown in Table 2.
[0095] Table 2 Primer Sequences
[0096] Homo Forward MNDA AGCGTACACAAGAAGAACACAA (SEQ ID NO:1) Homo Reverse MNDA GTTTCAGCTTGCGGTCAACTG (SEQ ID NO:2)
[0097] Inclusion criteria for patients with multiple sclerosis (MS): Study participants must meet all of the following conditions simultaneously:
[0098] I. Meets the diagnostic criteria for relapsing-remitting multiple sclerosis (RRMS) in the Chinese Expert Consensus on the Diagnosis and Treatment of Multiple Sclerosis (2023 Edition).
[0099] II. In the acute phase (symptoms worsen or new symptoms appear, lasting ≥24 hours, and there were no worsening symptoms for at least 30 days before the onset).
[0100] III. No hormones, immunosuppressants, or disease-modifying treatments (DMTs) have been received within at least 4 weeks prior to the onset of the disease.
[0101] IV. Not receiving treatments that can affect immune status, such as plasma exchange or immunoglobulin therapy.
[0102] V. Sign a written informed consent form and agree to have a blood sample collected for relevant testing.
[0103] Inclusion criteria for healthy controls: Healthy volunteers must meet all of the following conditions:
[0104] I. Age, sex and MS patients were matched for enrollment.
[0105] II. No history of autoimmune diseases, neurological diseases, malignant tumors, or hematological diseases.
[0106] III. No history of acute or chronic infection, and no fever, upper respiratory tract infection or other infection symptoms within 1 month prior to enrollment.
[0107] IV. Not receiving any immunomodulatory drugs (such as hormones, immunosuppressants, anti-tumor drugs, etc.).
[0108] V. The woman is not pregnant or breastfeeding.
[0109] VI. Sign a written informed consent form.
[0110] Exclusion criteria (applicable to all study participants): Participants meeting any of the following criteria will be excluded:
[0111] I. Comorbid other autoimmune diseases.
[0112] II. Comorbid malignant tumors, active infections, and hematological diseases.
[0113] III. Pregnant or breastfeeding women.
[0114] IV. Comorbid significant cognitive impairment, mental disorders, or communication impairments, making it impossible to complete follow-up and cooperate with sampling.
[0115] V. Has severe organ dysfunction such as heart, liver, or kidney failure, or other life-threatening serious diseases.
[0116] VI. Recent use of drugs that can significantly affect neutrophil function (such as glucocorticoids, antitumor drugs, white blood cell-boosting drugs, etc.) or presence of underlying diseases that affect the number of peripheral blood neutrophils (such as myelodysplastic syndromes, etc.).
[0117] VII. Failure to sign a written informed consent form.
[0118] 1.2 Extraction of neutrophils from human peripheral blood
[0119] Reagent preparation: heparin sodium anticoagulant tubes, lymphocyte separation solution, red blood cell lysis solution, PBS buffer.
[0120] Operating procedures
[0121] 1) Blood collection
[0122] Collect 5 mL of fresh human peripheral blood into a heparin sodium anticoagulant tube and invert to mix (to avoid agglutination).
[0123] 2) Density gradient centrifugation
[0124] Add the following to a 15 mL centrifuge tube in sequence: lower layer: 4 mL lymphocyte separation medium; upper layer: slowly add 4 mL blood (slowly add along the tube wall to avoid mixing).
[0125] Centrifugation conditions: 2000 rpm, 20 min, vertical centrifugation at room temperature.
[0126] After centrifugation, the cells are separated into layers (from top to bottom): ① Plasma layer (pale yellow layer, discard); ② Monocyte / lymphocyte layer (white membrane layer, discard); ③ Separation solution layer (clear layer, discard); ④ Neutrophil / granulocyte and erythrocyte sedimentation layer (red).
[0127] 3) Collect neutrophils
[0128] ① Lysis of red blood cells: Add 6 mL of red blood cell lysis buffer to the above red layer, mix on a shaker for 15 minutes at 3000 rpm for 15 minutes, discard the red liquid and keep the precipitate; add 3 mL of red blood cell lysis buffer to the precipitate, mix on a shaker for 10 minutes at 3000 rpm for 10 minutes, discard the liquid and obtain granulocyte precipitate.
[0129] 1.3 Neutrophil RNA Extraction and Reverse Transcription of cDNA
[0130] Reagent preparation: RNA extraction solution (manufacturer Servicebio catalog number: 3023), reverse transcription kit (nearshore protein catalog number: E047), chloroform substitute, isopropanol, 75% ethanol, enzyme-free water.
[0131] Operating procedures
[0132] 1) Add 1 mL of RNA extraction solution to the neutrophil pellet, mix by pipetting, let stand at room temperature for 5 minutes, add 100 μL of chloroform substitute, mix by vortex, centrifuge at 4°C, 2000g, for 15 min, and transfer the colorless aqueous phase to an enzyme-free 1.5 mL centrifuge tube.
[0133] 2) Add 500 μL of isopropanol to the colorless aqueous extract, gently invert to mix, let stand at room temperature for 10 min, centrifuge at 4°C, 2000g, for 15 min, a white precipitate (RNA precipitate) will be visible at the bottom of the tube, discard the supernatant.
[0134] 3) Add 1 mL of 75% ethanol to the white precipitate, invert to mix, centrifuge at 4°C, 2000g, for 5 min, discard the supernatant, and keep the precipitate. Repeat this step twice.
[0135] 4) Add 20 μL of enzyme-free water to the above precipitate, mix well by pipetting, and dissolve the RNA precipitate.
[0136] 5) Measure RNA concentration and perform cDNA reverse transcription using a reverse transcription kit.
[0137] 3. Experimental Results
[0138] Clinical sample experimental results as follows Figure 4As shown, compared with healthy controls (HC), the MNDA gene was significantly upregulated in patients with multiple sclerosis (MS), and the ROC curve results showed that its AUC value reached 0.805, indicating high diagnostic efficacy. Figure 5 (Table 3).
[0139] Table 3 Area under the curve
[0140] area <![CDATA[Standard error a > <![CDATA[Progressive Sig. b > Asymptotic 95% confidence interval 0.805 0.071 0.006 Lower limit: 0.666 Upper limit: 0.943
[0141] The test result variable 1: VAR00002 has at least one knot between the positive and negative actual state groups. The statistic may be biased.
[0142] a. Under nonparametric assumptions
[0143] b. Null hypothesis: Real area = 0.5
[0144] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.
Claims
1. Application of reagents for detecting MNDA levels in samples in the preparation of products for diagnosing multiple sclerosis.
2. The application according to claim 1, characterized in that, The reagents are selected from probes that specifically recognize the MNDA gene, primers that specifically amplify the MNDA gene, or binding agents that specifically bind to the protein encoded by the MNDA gene.
3. The application according to claim 2, characterized in that, The reagent also includes a detectable marker; Preferably, the detectable markers include radioactive isotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent components, magnetic particles, and bioluminescent components.
4. The application according to claim 2, characterized in that, The reagents also include those for detecting the expression level of MNDA gene or protein by PCR, gene chip detection, NGS detection, nucleic acid probe method, ELISA, immunoblotting, mass spectrometry, immunohistochemistry, and Raman spectroscopy.
5. A product for diagnosing multiple sclerosis, characterized in that, The product includes reagents for detecting MNDA expression levels in samples.
6. The product according to claim 5, characterized in that, The products include reagent kits, test strips, or chips; Preferably, the kit also includes instructions; Preferably, the kit further includes a buffer solution; Preferably, the sample is selected from blood; Preferably, the blood is selected from peripheral blood.
7. Application of MNDA as a target in screening candidate drugs for the treatment of multiple sclerosis; Preferably, the method for screening candidate drugs for the treatment of multiple sclerosis includes: Treat culture systems that express or contain the MNDA gene or its encoded protein with the substance to be screened; The system is used to detect the expression or activity of the MNDA gene or its encoded protein; wherein, when the substance to be screened inhibits the expression level or activity of the MNDA gene or its encoded protein, the substance to be screened is a candidate drug for the treatment of multiple sclerosis.
8. Application of MNDA in constructing a computational model for diagnosing multiple sclerosis.
9. Application of MNDA in the construction of systems / devices for diagnosing multiple sclerosis.
10. A system / device for diagnosing multiple sclerosis, characterized in that, The system / equipment includes: Acquisition unit: Used to acquire gene expression data in the sample to be tested; Extraction unit: used to extract expression data of target genes, including MNDA; Prediction unit: Based on the expression data of the target gene, it performs classification prediction to obtain the classification result of whether the sample to be tested has multiple sclerosis; Preferably, the method for classification prediction based on the expression data of the target gene includes: if the expression level of MNDA is high, the classification result of the test sample is that it has multiple sclerosis; if the expression level of MNDA is low, the classification result of the test sample is that it does not have multiple sclerosis.
Citation Information
Cited By
Biomarker for dyszoospermia and application thereof
CN122060857A