Cell membrane derived nano-vesicle layer for cell protection as well as preparation method and application of cell membrane derived nano-vesicle layer

By using DNA base complementary pairing ligation technology in cell membrane-derived nanovesicle layers, the environmental sensitivity and cytotoxicity problems of existing cell protection methods have been solved, achieving stable protection and proliferation shielding of cells.

CN121136898APending Publication Date: 2025-12-16BEIJING LIFE SCIENCE ACADEMY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511337785.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2025-12-16

Smart Images

  • Figure CN121136898A_ABST
    Figure CN121136898A_ABST
Patent Text Reader

Abstract

The invention provides a cell membrane derived nano-vesicle layer for cell protection as well as a preparation method and application thereof, and belongs to the technical field of biological medicines. In order to solve the technical problems that an existing cell protection method has the defects of high environmental sensitivity, strong cytotoxicity, inhibition of cell proliferation and the like, the technical scheme is characterized in that cell membrane derived nano-vesicles of mammalian cells are extracted, and a triangular prism (TP) structure composed of S1, S2 and S3 chains is synthesized through PCR to serve as a connecting skeleton; the method comprises the following steps: constructing NanoLink 1 (containing a cholesterol anchoring chain and DNA1) and NanoLink 2 (containing DNA2), respectively modifying the surfaces of cells and vesicles by virtue of cholesterol insertion membranes, and realizing specific connection by virtue of complementary pairing of bases of the DNA1 and the DNA2; a single-layer or multi-layer (preferably two-layer) vesicle assembly mode is adopted, and a protective armor is formed on the surface of a cell.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a cell membrane-derived nanovesicle layer for cell protection, its preparation method, and its application. Background Technology

[0002] Encapsulation of single living cells represents a groundbreaking frontier in bioengineering and materials science, enabling the creation of tailored protective microenvironments at the single-cell level. This strategy transforms the way cells are protected, manipulated, and enhanced, with implications permeating regenerative medicine, precision diagnostics, cell therapy, and synthetic biology. Therefore, achieving single-cell protection is of paramount importance. Furthermore, current methods for cell protection, such as forming encapsulation layers through the electrostatic adsorption of anionic and anionic groups onto cell surface anionic components, are highly dependent on environmental pH and ionic strength. They disintegrate due to charge neutralization at extreme pH levels (e.g., 3.0, 11.0). Additionally, the positive charge of polycations (e.g., PLL, polyethyleneimine (PEI)) directly interacts with the negative charge of the cell membrane, leading to membrane rupture or pore formation at high concentrations or molecular weights. Biomineralization, on the other hand, faces challenges such as excessive material rigidity and the inhibition of cell division by the mineral shell.

[0003] Cell-derived vesicles, as a protective layer for cells, exhibit several significant advantages in the field of cell protection. Firstly, they possess excellent biocompatibility and high safety. Because they originate from the cell itself, their chemical composition and structure are highly compatible with the cellular environment. During interaction with cells, they do not trigger immune rejection or other adverse biological effects, thus ensuring no damage to the cells and providing a reliable guarantee for maintaining normal cellular physiological functions. Secondly, cell-derived vesicles have unique loading capabilities. Through specific technical means, various bioactive molecules, drugs, genes, and other substances can be loaded into the interior or surface of vesicles, thereby endowing cells with additional functions and expanding the application potential of cells in disease treatment, tissue repair, and other fields.

[0004] DNA offers significant advantages as a linker between vesicles and cells. Its linking function is based on the principle of complementary base pairing, a pairing method with high specificity that ensures precise recognition and specific binding of target molecules in complex biological environments, greatly improving the accuracy and reliability of linking. Furthermore, as a natural biomolecule, DNA possesses excellent biocompatibility; when interacting with biological systems, it does not trigger significant immune responses or other adverse biological effects, allowing for safe and effective applications in biomedical fields.

[0005] Relevant patent documents retrieved: This document, published in the United States (publication number US8741577B2, publication date October 21, 2004), discloses an innovative surface-immobilized multilayer vesicle structure. By increasing the number of immobilization sites and optimizing the distance between the vesicles and the surface, the modification includes immobilizing connectives on the vesicle surface. For example, cholesterol-modified oligonucleotides are embedded in the lipid bilayer of the vesicles, with one end of the oligonucleotide exposed on the vesicle exterior. This technical solution significantly improves the performance of biosensors. Furthermore, this structure has broad application prospects in drug delivery and filtration applications. Summary of the Invention

[0006] The purpose of this invention is to provide: A cell membrane-derived nanovesicle layer for cell protection, its preparation method and application, and related technologies, to solve the technical problems of existing cell protection methods, such as high environmental sensitivity, strong cytotoxicity and inhibition of cell proliferation, or combinations thereof.

[0007] Terminology Explanation: Unless otherwise defined, all technical terms in this document have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent inventions, and publications cited in this document are incorporated herein by reference in their entirety. If multiple definitions exist for terms in this document, the definitions in this chapter shall prevail.

[0008] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0009] The definition of standard chemical terminology can be found in the reference "Molecular Biology, by Huang Lihua, Science Press".

[0010] Unless otherwise specified, conventional methods within the scope of the art, such as cell culture, PCR amplification, agarose gel electrophoresis, confocal microscopy, and cell viability testing (CCK-8 method), shall be used.

[0011] Unless specifically defined herein, the use of all commercially available products herein employs standard techniques. For example, it may be carried out using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various summary and more specific documents cited and discussed in this specification.

[0012] The terms “optional / arbitrary” or “optionally / arbitrarily” mean that an event or situation described subsequently may or may not occur, including both the occurrence and non-occurrence of the event or situation. For example, according to the definition below: the term “optional” means that an event or situation described subsequently may or may not occur, such as “optionally modified nucleic acid chain” meaning “unmodified nucleic acid chain” or “nucleic acid chain modified with groups such as cholesterol”.

[0013] In a first aspect, the present invention provides: a cell membrane-derived nanovesicle layer for cell protection, comprising cell-derived vesicles, NanoLink1 and NanoLink2; NanoLink1 and NanoLink2 include a triangular prism structure (TP), with the upper end of the triangular prism structure respectively connected to a DNA1 chain or a DNA2 chain, and the DNA1 chain and DNA2 chain being complementary. The lower end of the triangular prism structure is connected to three nucleic acid chains modified with cholesterol.

[0014] The cell source includes, but is not limited to, animal cell source, plant cell source, or bacterial cell source.

[0015] The cell source is preferably a mammalian cell source.

[0016] The cell source is further preferably any one or more of 293T cells, HeLa cells, or CHO cells.

[0017] The triangular prism structure is composed of S1, S2 and S3, wherein S1 is selected from a nucleotide sequence with more than 97% homology to SEQ ID NO.1, S2 is selected from a nucleotide sequence with more than 97% homology to SEQ ID NO.2, and S3 is selected from a nucleotide sequence with more than 97% homology to SEQ ID NO.3.

[0018] Wherein, S1 is preferably a nucleotide sequence with more than 98% homology to SEQ ID NO.1, S2 is preferably a nucleotide sequence with more than 98% homology to SEQ ID NO.2, and S3 is preferably a nucleotide sequence with more than 98% homology to SEQ ID NO.3.

[0019] Wherein, DNA1 is selected from a nucleotide sequence that has more than 97% homology with SEQ ID NO.5, and DNA2 is selected from a nucleotide sequence that has more than 97% homology with SEQ ID NO.6.

[0020] Wherein, DNA1 is preferably a nucleotide sequence with more than 98% homology to SEQ ID NO.5, and DNA2 is preferably a nucleotide sequence with more than 98% homology to SEQ ID NO.6.

[0021] The cholesterol-modifying nucleic acid chain is selected from a nucleotide sequence that has more than 93% homology with SEQ ID NO.4.

[0022] The modified cholesterol nucleic acid chain is preferably a nucleotide sequence with more than 96% homology to SEQ ID NO.4.

[0023] Secondly, the present invention provides a method for preparing a cell membrane-derived nanovesicle layer, comprising the following steps: (1) Extract vesicles from the target cells; (2) A triangular prism structure composed of S1, S2 and S3 is synthesized as a connecting skeleton; (3) The triangular prism structure obtained in step (2) and the cholesterol-modified nucleic acid chain are mixed and reacted with DNA1 or DNA2 respectively.

[0024] In step (1), the target cells include, but are not limited to, animal cell sources, plant cell sources, or bacterial cell sources.

[0025] In step (1), the target cell is preferably of mammalian cell origin.

[0026] In step (1), the target cells are preferably any one or more of 293T cells, HeLa cells, or CHO cells.

[0027] In step (2), the triangular prism result is synthesized by PCR.

[0028] In step (2), the ratio of S1:S2:S3 in the PCR reaction system is 0.5-2:0.5-2:0.5-2 by volume.

[0029] In step (2), the PCR reaction system further includes a buffer solution, which includes, but is not limited to, Tris-HCl and Mg2+. 2+ Or any one or more of EDTA2Na.

[0030] In step (2), the PCR reaction procedure is as follows: annealing includes a constant temperature of 92-98℃ for 3-8 minutes; 4-6 cycles, each cycle for 0.5-1.5 minutes, with a gradient temperature decrease of 0.5-1.5℃; 25-35 cycles, each cycle for 0.5-1.5 minutes, with a gradient temperature decrease of 0.2-0.6℃; 65-75 cycles, each cycle for 0.5-1.5 minutes, with a gradient temperature decrease of 0.6-1.0℃; constant temperature of 20-24℃ for 25-35 minutes, followed by stabilization at 2-6℃ for 0.5-1.5 hours.

[0031] In step (3), the volume ratio of the triangular prism structure and the cholesterol-modified nucleic acid chain to DNA1 or DNA2 in the reaction system is 2-4:1-3:1-3.

[0032] In step (3), the reaction system is reacted at room temperature for 0.5-1.5 hours.

[0033] The preparation method may further include step (4) nanowire encapsulation.

[0034] The nanowires are composed of H1, H2, H1-C, H2-C and a trigger.

[0035] H1 is selected from nucleotide sequences that have more than 96% homology with SEQ ID NO.8.

[0036] H1 is preferably a nucleotide sequence that has more than 98% homology with SEQ ID NO.8.

[0037] H2 is selected from nucleotide sequences that have more than 96% homology with SEQ ID NO.9.

[0038] H2 is preferably derived from a nucleotide sequence that has more than 98% homology with SEQ ID NO.9.

[0039] The H1-C is selected from nucleotide sequences that have more than 96% homology with SEQ ID NO.10.

[0040] The H1-C is preferably selected from a nucleotide sequence that has more than 98% homology with SEQ ID NO.10.

[0041] The H2-C is selected from nucleotide sequences that have more than 96% homology with SEQ ID NO.11.

[0042] The H2-C is preferably selected from a nucleotide sequence that has more than 98% homology with SEQ ID NO.11.

[0043] The Trigger is selected from a nucleotide sequence that has more than 91% homology with SEQ ID NO.7.

[0044] The trigger is preferably a nucleotide sequence that has more than 95% homology with SEQ ID NO.7.

[0045] The preparation conditions of the nanowires include: after H1 and H2 are annealed, the full sequence of H1, H2, H1-C, H2-C and Trigger required for preparing nanowires are mixed in proportion and incubated at room temperature for 3 hours to carry out self-assembly.

[0046] Thirdly, the present invention provides the application of the above-mentioned cell membrane-derived nanovesicle layer in cell protection.

[0047] The nanovesicle layer is used for cell protection, and the nanovesicle layer can be connected by multiple layers of vesicles or by a single layer of vesicles.

[0048] Preferably, the multilayer vesicle connection is a two-layer vesicle connection; The vesicle connection is further preferably characterized by the addition of a fluorescent marker on the vesicle surface.

[0049] The first priority is to optimize the PCR annealing procedure for the TP structure to improve preparation efficiency while ensuring the stability of the triangular prism structure composed of S1, S2, and S3.

[0050] The second preferred option is to use HeLa cell-derived nanovesicles, which are connected by two layers of vesicles to further enhance resistance to hypotonic environments.

[0051] The third preferred option is to introduce fluorescent markers (such as Cy5 and Fam) into NanoLink to enable visual tracking of the vesicle assembly process, facilitating verification of the connection effect.

[0052] Thirdly, this invention provides the application of cell-derived nanovesicle armor in cell protection. The cell protection includes, but is not limited to: resistance to physical stimulation, resistance to chemical stimulation, or shielding of immune recognition.

[0053] The resistance to physical stimuli is selected from: low osmotic pressure environment or drastic changes in osmotic pressure.

[0054] The resistance to chemical stimuli is selected from: pancreatic enzyme treatment; toxic nanoparticles or chemical toxins.

[0055] The shielded immune recognition is selected from: shielded immune cell recognition and attack.

[0056] The technical feature “cell-derived vesicles as a protective barrier” is supported by the preparation of HeLa cell vesicles and NTA detection (approximately 200 nm in diameter) in Example 1. Its subordinate concept includes other cell-derived vesicles, which, even after substitution, still fall within the protection scope of this invention. The technical feature “cholesterol membrane modification of NanoLink1 and NanoLink2” is supported by the modification of the cholesterol nucleic acid chain (SEQ ID NO.4-chol) in Example 1 and the verification by agarose gel. Equivalent technical means (such as other lipid anchoring) are also within the protection scope of this invention. The technical feature "nucleic acid chain hybridization ligation" is supported by co-focused fluorescence imaging in case 2. Other hybridization methods based on base complementarity are also within the scope of protection.

[0057] The technical feature "resistance to physical stimuli" is supported by cell morphology observation in the hypotonic environment of test example 4. When replaced with other physical stimuli (such as high osmotic pressure), it still falls within the scope based on the same protective mechanism. The technical feature of "resistance to chemical irritation" is supported by experimental data from test case 3 (pancreatic enzyme) and test case 5 (quantum dot), and its protective applications against other chemical irritants are also within its scope.

[0058] The beneficial effects of this invention are as follows: The present invention has at least the following beneficial effects: 1. This invention utilizes DNA technology to encode multifunctional nucleic acid template sequences, PCR to form TP structures, and simple self-assembly to form NanoLinks, avoiding complex design and synthesis. 2. This invention utilizes cell-derived vesicles for cell protection. Compared to the cytotoxic effects on cell proliferation caused by electrostatic adsorption or biomineralization of polyelectrolyte compounds to form a protective layer, these vesicles exhibit higher biocompatibility and safety. 3. This invention utilizes cell-derived nanovesicles for cell protection, which can resist adverse environments such as trypsin, hypotonicity, and some quantum dots, thereby achieving the protection of specific cells; 4. This invention is applicable to shielding cell surface membrane proteins, thereby protecting cells from being killed by immune cells. Attached Figure Description

[0059] Figure 1This is a schematic diagram illustrating the principle of constructing nanovesicles on the cell surface prepared in this invention. A represents the binding of vesicles with NanoLink2, B represents the binding of the cell surface with NanoLink1, C represents the connection between the cell and vesicles through complementary base pairing between NanoLinks, thereby completing the first layer of encapsulation on the cell surface, and D represents the connection between vesicles with NanoLink1 bound to the cell surface and vesicles on the cell surface through complementary base pairing between NanoLinks, ultimately forming the second layer of encapsulation on the cell surface.

[0060] Figure 2 This is a diagram showing the construction of cell-derived nanovesicles in Experiment 1 of this invention. A is a nanoparticle tracking analysis diagram of the vesicle sample after filtration through a 200 nm filter membrane, and B is an agarose gel image of the vesicles and NanoLink binding.

[0061] Figure 3 This is a diagram showing the cell encapsulation effect of cell-derived nanovesicles in Experiment 2 of this invention.

[0062] Figure 4 This is a diagram illustrating the protective effect of the vesicular armor on cells under serum pancreatic enzyme levels in Experiment 3 of this invention.

[0063] Figure 5 This is a diagram illustrating the protective effect of the vesicular armor on cells under hypotonic conditions in Experiment 4 of this invention.

[0064] Figure 6 This is a shielding diagram of the vesicle armor in Experiment 5 of this invention for quantum dots and toxic particles.

[0065] Figure 7 This is a diagram illustrating the shielding effect of the vesicle armor on cell surface membrane proteins in Experiment 6 of this invention. Detailed Implementation

[0066] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are not intended to limit the present invention, but only to illustrate the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are generally performed under conventional conditions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0067] Example 1 NanoLink fabrication specifically includes the following steps: 1) PCR reaction: Dissolve the three strands of TP, S1, S2, and S3, in buffer to 20 μM (except for the cholesterol chain, which was dissolved in DEPC; the others were dissolved in buffer). Add 1 μL of each of S1, S2, and S3 to a 200 μL PCR tube, mix well, centrifuge, and place in a PCR module. The program is as follows: annealing includes 95℃ for 5 minutes; 5 cycles of 1 minute each with a 1℃ gradient decrease; 30 cycles of 1 minute each with a 0.4℃ gradient decrease; 70 cycles of 1 minute each with a 0.8℃ gradient decrease; 22℃ for 30 minutes. Then, stabilize at 4℃ for 1 hour. The S1 sequence is: TCGCTGAGTATTTTCCACCACCAAACCACATTTGTTTTGCAAGTGTGGGCACGCACACTTTTCGCACCGCGACTGCGAGGACTTTTCACAAATCTG (SEQ ID NO.1). The sequence of S2 is: CACTGGTCAGTTTTCCACCACCAAACCACATTTGTTTTTACTCAGCGACAGATTTGTGTTTTCGCACCGCGACTGCGAGGACTTTTGGTTTGCTGA (SEQ ID NO.2). The sequence of S3 is: CCACACTTGCTTTTCAACCCACAATCCCAGTGTGTTTTCTGACCAGTGTCAGCAAACCTTTTCGCACCGCGACTGCGAGGACTTTTGTGTGCGTGC (SEQ ID NO.3); The reaction buffer for dissolving DNA strands comprises: Tris (0.12 g), MgCl2 (0.06 g), EDTA2Na (0.037 g), and ddH2O (50 mL), with a pH of 7.4; 2) NanoLink reaction for nucleic acid hybridization synthesis: Add 3 μL of PCR-synthesized 20 μM TP solution to 3 μL of 20 μM cholesterol nucleic acid chain and 2 μL of 20 μM DNA1 chain or DNA2 chain, mix well, and react at room temperature for one hour.

[0068] The cholesterol nucleic acid chain sequence is: GTCCTCGCAGTCGCGGTGCGTTTTTTTTTT-chol (SEQ ID NO. 4); The DNA1 nucleic acid sequence is: CAAATGTGGTTTGGTGGTGGtttttttttttttttttttttttttttGCGCACGCGTGCCGACGGCC (SEQ ID NO.5); The DNA 2 sequence is: CAAATGTGGTTTTGGTGGTGGtttttttttttttttttttttttttttttttttttttttGGCCGTCGGCACGCGTGCGC (SEQ ID NO. 6); 3) Hybrid chain synthesis of nanowires (optional): First, a hairpin structure is formed. 5 μL of 20 μM H1 and H2 are annealed. The annealing procedure is: 95℃ for 10 min, then immediately placed in ice for 30 min, and finally incubated at room temperature for 2 h. Then, 0.2 μM and 1 μL of the trigger chain are added to 1 μL each of 20 μM H1, H2, H1-C, and H2-C, respectively, and mixed thoroughly. H1 and H2 are the annealed solutions. The mixture is centrifuged and reacted at room temperature for 3 h to prepare multivalent nanowires with a trigger:H1:H2 ratio of 1:10:10. The trigger sequence is: ACGGCTTGCTGCTGCTGCTGCTGC (SEQ ID NO.7); The H1 sequence is: GACGTGCAGGCTGTGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAGCAGCACCGT (SEQ ID NO.8). The H2 sequence is: CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTGCTGCTGCTGCTGCTGCGTGAGCACGGACG (SEQ ID NO.9). The H1-C aptamer sequence is: CAGCCTGCACGTCTTTTTTTTTTTTTTTCGACATCTAACCTGGACAATGGTGTTTG (SEQ ID NO.10); The H2-C sequence is: ACGAAATGGAGTGTGGCTCACTGACGCTAGGTTTTTTTTTTTTTCGTCCGTGCTCAC (SEQ ID NO.11).

[0069] Detection example The basic principle upon which this invention is based is as follows: The NanoLink main framework is a TP structure synthesized by PCR, with three cholesterol-containing nucleic acid chains attached to its lower end and a linker strand DNA1 or DNA2 attached to its upper end, becoming NanoLink1 and NanoLink2, respectively. These links bind to cells and vesicles, respectively, and the vesicles encapsulate cells through complementary base pairing between DNA1 and DNA. This design effectively protects cells from adverse conditions such as low osmotic pressure environments, trypsin treatment, or exposure to nanoparticles. The method described above for preparing multi-cell-source nanovesicle armor for cell protection has been experimentally verified to be highly effective. Taking Example 1 as an example, the quantitative experiments in the following experiments were all repeated three times, and the results were averaged. Unless otherwise specified, the experimental methods used in the experiments were conventional methods. Unless otherwise specified, all experimental materials, reagents, and equipment in the examples can be obtained through conventional purchasing channels. Relevant experimental data are as follows: Example 1: Construction of cell-derived nanovesicles Remove the culture medium from the large dish containing confluent HeLa cells. Wash the dish with 2 mL of PBS solution near the pipette tip, discard the PBS, and repeat once. Add 3 mL of buffer, 90 μL of 4% paraformaldehyde (PFA), and 18 μL of 1 M dithiothreitol (DTT) solution. Incubate at 37°C for 3 h, then collect the supernatant. Filter the collected supernatant through 0.45 μm and 0.22 μm filters for NTA experiments. The vesicle diameter is approximately 200 nm. Figure 2 As shown in Figure A. After reacting 100 μL of filtered vesicles with 7 μL of 20 μM NanoLink2 at room temperature for 1 h, an agarose gel was run, and the structure is shown below. Figure 2 As shown in the three lanes of B, lane 1 is a nanovesicle and lane 2 is NanoLink2. The results show that NanoLink2 was successfully connected to the nanovesicle.

[0070] The buffer consists of 10 mM HEPES, 150 mM NaCl2, 2 mM CaCl2, and has a pH of 7.4.

[0071] Example 2: Examination of the cell encapsulation effect of cell-derived nanovesicles After seeding 6000 HeLa cells in 96-well plates overnight, 100 μL of 20 nM NanoLink1 was added to the HeLa cells and incubated at room temperature for 30 min. The supernatant was removed, and the cells were washed once with 200 μL of PBS. Then, 100 μL of 20 nM NanoLink2 modified with Cy5 and nanovesicles were added and reacted for 30 min at room temperature. After incubation at room temperature for 30 min, the supernatant was removed, and a first layer of vesicles was formed on the cell surface. After washing once with 200 μL of PBS, the supernatant was removed, and 100 μL of 20 nM NanoLink1 modified with Fam and nanovesicles were added and reacted for 30 min at room temperature. After incubation at room temperature for 30 min, the supernatant was removed, and a second layer of vesicles was formed on the cell surface. Then, 200 μL of confocal microscopy was added. Cells treated under the same conditions without NanoLink1 were used as a control. The cell surfaces showed obvious Cy5 and Fam fluorescence. The results are as follows. Figure 3 As shown.

[0072] Example 3: Investigation of the protective effect of vesicular armor on cells under serum trypsin levels After seeding 6000 HeLa cells in 96-well plates overnight and staining with calcein, two layers of vesicles were attached to the cell surface as shown in Experiment 2. 200 μL of trypsin was added, and confocal microscopy images were taken at 0 min, 10 min, and 20 min. Uncoated cells treated under the same conditions and cells coated only with NanoLink served as controls. Even with vesicle protection, a large number of cells adhered to the bottom of the plate. The results are as follows... Figure 4 As shown.

[0073] Example 4: Investigation of the protective performance of vesicular armor on cells under hypotonic conditions After 200,000 CEM cells were stained with calcein, two layers of vesicles were attached to the cell surface as shown in Experiment 2. Then, 200 μL of 0.3% and 0.9% NaCl solutions were added, respectively, and the cells were reacted at room temperature for 10 min before confocal imaging. Uncoated cells, nanowire-coated cells, and cells coated with nanowires after vesicle coating were used as controls under the same conditions. The vesicle-coated cells under hypotonic conditions did not show significant shrinkage. The results are as follows: Figure 5 As shown.

[0074] Example 5: Investigation on the shielding effect of vesicular armor on quantum dots and toxic particles After seeding 6000 HeLa cells in 96-well plates overnight, two layers of vesicles were attached to the cell surface as shown in Experiment 2. Then, approximately 10 nm of quantum dot solution was added to each cell, and the reaction was carried out at room temperature for 2 hours before confocal microscopy imaging. Uncoated cells treated under the same conditions served as a control; quantum dot penetration into the cells was reduced. Results are shown below. Figure 6 As shown.

[0075] Example 6: Shielding of cell surface membrane proteins by vesicular armor To prepare the TP-sgc8 formulation, 3 μL of PCR-synthesized 20 μM TP solution was added to 3 μL of 20 μM cholesterol nucleic acid chain and 1 μL of 20 μM Sgc8 chain, targeting tyrosine protein kinase 7 (PTK7). The mixture was then incubated at room temperature for one hour.

[0076] 1 ml of CEM and Ramos cell suspensions were transferred to 1.5 mL centrifuge tubes, centrifuged to remove the supernatant, and 1 ml of PBS was added. Then, 1 μL of Calcein and Hoechst dye were added, and the mixture was incubated at 37 °C for 15 min. After centrifugation to remove the supernatant, 1 ml of PBS was added again, and this process was repeated three times. Next, 2 μM TP-sgc8 and 200,000 Ramos cells were incubated at room temperature for 30 min, followed by centrifugation at 1500 rpm for 3 min, and removal of the supernatant. The mixture was resuspended in PBS to a final volume of 100 μL. 200,000 CEM cells with two layers of vesicles were added, and the mixture was incubated at room temperature for 30 min before co-polymerization was observed. Unencapsulated CEM cells treated under the same conditions served as a control. No significant aggregation of Ramos and CEM cells was observed. Figure 7 As shown.

[0077] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A cell membrane-derived nanovesicle layer for cell protection, characterized in that, It includes cell-derived vesicles, NanoLink1, and NanoLink2; NanoLink1 and NanoLink2 include triangular prism structures, the upper ends of which are respectively connected to DNA1 or DNA2 chains, and the DNA1 and DNA2 chains are complementary, and the lower ends of the triangular prism structures are each connected to three nucleic acid chains modified with cholesterol.

2. The cell membrane-derived nanovesicle layer according to claim 1, characterized in that, The triangular prism structure is composed of S1, S2 and S3, wherein S1 is selected from SEQ ID NO.1 or a nucleotide sequence with more than 97% homology to SEQ ID NO.1, S2 is selected from SEQ ID NO.2 or a nucleotide sequence with more than 97% homology to SEQ ID NO.2, and S3 is selected from SEQ ID NO.3 or a nucleotide sequence with more than 97% homology to SEQ ID NO.

3.

3. The cell membrane-derived nanovesicle layer according to claim 1, characterized in that, The DNA1 is selected from SEQ ID NO.5 or a nucleotide sequence with more than 97% homology to SEQ ID NO.5, and the DNA2 is selected from SEQ ID NO.6 or a nucleotide sequence with more than 97% homology to SEQ ID NO.

6.

4. The cell membrane-derived nanovesicle layer according to claim 1, characterized in that, The nucleic acid chain that modifies cholesterol is selected from SEQ ID NO.4 or a nucleotide sequence that has more than 93% homology with SEQ ID NO.

4.

5. The method for preparing the cell membrane-derived nanovesicle layer according to any one of claims 1-4, characterized in that, Includes the following steps: (1) Extract vesicles from the target cells; (2) A triangular prism structure composed of S1, S2 and S3 is synthesized as a connecting skeleton; (3) The triangular prism structure obtained in step (2) and the cholesterol-modified nucleic acid chain are mixed and reacted with DNA1 or DNA2 respectively.

6. The preparation method according to claim 5, characterized in that, In step (1), the target cells include any one or more of 293T cells, HeLa cells, or CHO cells.

7. The preparation method according to claim 5, characterized in that, In step (2), the triangular prism structure is synthesized by PCR. The PCR reaction system includes a volume ratio of S1:S2:S3 of 0.5-2:0.5-2:0.5-2. The PCR reaction program is as follows: annealing at 92-98℃ for 3-8 minutes; 4-6 cycles, each cycle for 0.5-1.5 minutes, with a gradient cooling of 0.5-1.5℃; 25-35 cycles, each cycle for 0.5-1.5 minutes, with a gradient cooling of 0.2-0.6℃; 65-75 cycles, each cycle for 0.5-1.5 minutes, with a gradient cooling of 0.6-1.0℃; 20-24℃ for 25-35 minutes, followed by stabilization at 2-6℃ for 0.5-1.5 hours.

8. The preparation method according to claim 5, characterized in that, It also includes step (4), nanowire wrapping.

9. The application of the cell membrane-derived nanovesicle layer according to any one of claims 1-4 or the cell membrane-derived nanovesicle layer prepared by the preparation method according to any one of claims 5-6 in cell protection.

10. The application according to claim 9, characterized in that, The cell protection includes at least one of the following: resistance to physical stimulation, resistance to chemical stimulation, and shielding from immune recognition.

Citation Information

Patent Citations

  • Surface immobilised multilayer structure of vesicles

    US8741577B2